Антипролиферативное действие карнозина и его производных

advertisement
ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ
«НАУЧНЫЙ ЦЕНТР НЕВРОЛОГИИ»
РОССИЙСКОЙ АКАДЕМИИ МЕДИЦИНСКИХ НАУК
На правах рукописи
РЫБАКОВА ЮЛИЯ СЕРГЕЕВНА
Антипролиферативное действие карнозина и его производных на
опухолевые клетки нейрального происхождения
03.01.04 – биохимия
Диссертация на соискание ученой степени
кандидата биологических наук
Научный руководитель:
доктор биологических наук
Федорова Татьяна Николаевна
МОСКВА 2013
1
СОДЕРЖАНИЕ
ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ. ..................................................................... 10
РАЗДЕЛ
1.1.
Редокс-статус
клетки
определяется
соотношением
внутриклеточных про- и антиоксидантов. ...................................................... 10
1.1.1. Активные формы кислорода и их значение в жизни клетки............ 10
1.1.2. Основные представители антиоксидантной системы клетки и их
роль в поддержании редокс-статуса. ............................................................ 12
РАЗДЕЛ 1.2. Редокс-регуляция клеточной пролиферации. .......................... 16
1.2.1. Клеточный цикл и его регуляция. ....................................................... 17
1.2.2. Редокс-регуляция клеточного цикла. .................................................. 25
РАЗДЕЛ 1.3. Современное состояние знаний о противоопухолевом эффекте
короткоцепочечных пептидов. ......................................................................... 35
1.3.1. Карнозин и его производные. Общая характеристика. ..................... 35
1.3.2. Антиоксидантные свойства карнозина и его производных. ............ 38
1.3.3. Эффект карнозина и его производных на пролиферацию
нормальных и опухолевых клеток. ............................................................... 41
1.3.4. Пинеалон. Общая характеристика и свойства. .................................. 44
ГЛАВА 2. МЕТОДЫ ИССЛЕДОВАНИЯ........................................................... 46
2.1. Культуры клеток. ........................................................................................ 46
2.2. Исследуемые соединения. .......................................................................... 47
2.3. Исследование клеточной пролиферации. ................................................. 47
2.3.1. Время удвоения популяции. ................................................................ 47
2.3.2. Эффективность посева и доля выживших клеток. ............................ 48
2.4. Проточная цитометрия. .............................................................................. 48
2.4.1. Измерение уровня АФК. ...................................................................... 49
2
2.4.2. Определение доли мертвых клеток. .................................................... 50
2.4.3. Анализ клеточного цикла. .................................................................... 50
2.4.4. Двухпараметрический анализ клеточного цикла. ............................. 52
2.5. Иммуноблоттинг. ........................................................................................ 52
2.6. Определение активности MnСОД. ............................................................ 53
2.7. Определение активности каталазы. .......................................................... 53
2.8. Полимеразная цепная реакция (ПЦР) в режиме реального времени. ... 54
2.9. Статистическая обработка результатов. ................................................... 54
ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ. ................................................. 55
РАЗДЕЛ 3.1. Изучение характера действия карнозина на пролиферацию
клеток. ................................................................................................................. 55
3.1.1. Карнозин снижает количество клеток РС-12 в культуре. ............... 55
3.1.2. Карнозин снижает уровень АФК в клетках культуры РС-12. .......... 57
3.1.3. Карнозин и его производные индуцируют накопление клеток РС-12
в S и G2/М фазах клеточного цикла. ............................................................. 58
3.1.4. Изучение воздействия синтетического трипептида пинеалона на
клеточный цикл. .............................................................................................. 62
РАЗДЕЛ 3.2. Изучение механизма регуляции клеточного цикла под
действием карнозина. ........................................................................................ 65
3.2.1.
Карнозин избирательно ингибирует пролиферацию клеток
глиобластомы. ................................................................................................. 65
3.2.2.
Карнозин снижает уровень АФК и индуцирует экспрессию
MnСОД. ............................................................................................................ 69
3.2.3. Карнозин индуцирует G2 блок и усиливает экспрессию циклина В1.
........................................................................................................................... 73
3
РАЗДЕЛ 3.3. Изучение функциональной нагрузки структурных элементов в
молекуле карнозина при антипролиферативном эффекте. ............................ 77
РАЗДЕЛ 3.4. Возможности применения карнозина в радиотерапии. .......... 81
ГЛАВА 4. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ ...................................................... 82
ВЫВОДЫ ............................................................................................................... 95
СПИСОК ЛИТЕРАТУРЫ..................................................................................... 96
4
ВВЕДЕНИЕ
Карнозин представляет собой природный дипептид, состоящий из двух
аминокислот – β-аланина и L-гистидина. В организме человека карнозин
представлен во многих тканях (мышцы, мозг, печень, ткани глаза, желудок,
почки, легочная ткань) достигая наивысшей концентрации в скелетных
мышцах (~ 20 мM) и в обонятельных луковицах головного мозга (~ 2.5 мM)
[1, 2]. Карнозин синтезируется с помощью фермента карнозин-синтетазы,
которая катализирует образование пептидной связи между β-аланином и Lгистидином используя энергию АФТ и ионы Mg2+ с использованием энергии
АТФ [3-7]. Разрушение карнозина на составляющие его аминокислоты
осуществляется главным образом сывороточной карнозиназой (CN1) [8, 9].
Карнозин демонстрирует многообразие функций, приведем некоторые
из них. Во время интенсивной мышечной работы карнозин выполняет
функцию
протонного
буфера,
связывающего
избыток
протонов,
образующихся вместе с молочной кислотой, и препятствующего развитию
ацидоза [10]. Карнозин также способен образовывать комплексы с металлами
переменной валентности (Cu2+, Zn2+, Fe2+ и др.) [11-13]. Антиоксидантные
свойства карнозина заключаются в его способности образовывать комплексы
с двумя высоко реакционноспособными окислителями – гидроксильным
радикалом
и
супероксидным
анионом,
снижая
их
реактивность
и
предотвращая дальнейшее распространение окислительного повреждения
[14-17]. Кроме того, в нескольких независимых исследованиях было
продемонстрировано
эффективное
подавление
накопления
продуктов
перекисного окисления липидов (малоновый диальдегид, пероксильные
радикалы, ненасыщенные альдегиды, 4-гидроксиноненаль) в присутствии
карнозина, что снижало уровень окислительного повреждения макромолекул,
способствуя сохранению их структуры и функций [15, 18, 19].
Антипролиферативный эффект карнозина на опухолевые клетки был
впервые описан Nagai и Suda в 1986 году [20]. В их работе подкожные
5
инъекции карнозина мышам линии ddY, с предварительно вживленными
клетками саркомы, способствовали снижению интенсивности пролиферации
опухолевых клеток и увеличению выживаемости животных. Позже в
независимом исследовании Renner et al. на мышах с ксенографтами
HER2/neu
фибробластов
NIH3T3
внутрибрюшинные
инъекции
показали,
карнозина
что
ежедневные
существенно
подавляют
пролиферацию злокачественных клеток и опухолевый рост [21]. Holliday и
McFarland продемонстрировали избирательность действия карнозина на
опухолевые клетки. Добавление карнозина к смеси клеток карциномы (HeLa)
и
нормальных
человеческих
фибробластов
(MRC-5)
приводило
к
выборочному уничтожению HeLa клеток и удлиняло продолжительность
жизни
фибробластов
[22,
23].
Обработка
карнозином
нормальных
эмбриональных стволовых клеток и злокачественных клеток эмбриональной
терато-карциномы также приводило к избирательной гибели последних.
Полученные данные указывали на то, что ни степень дифференцировки, ни
скорость пролиферации клеток не являются определяющими факторами
избирательного действия карнозина на опухолевые клетки. Несмотря на
наличие
большого
количества
экспериментальных
данных
об
антипролиферативном действии карнозина на опухолевые клетки, механизм
противоопухолевого эффекта остается не выясненным.
На сегодняшний день в литературе накоплено множество данных о том,
что
интенсивность
антиоксидантов
пролиферации
внутри
клетки
зависит
[24,
25].
от
соотношения
Показано,
что
про-
и
быстро
пролиферирующие клетки характеризуются более высоким содержанием
прооксидантов и пониженной активностью антиоксидантной системы по
сравнению с клетками, делящимися медленно или находящимися в
состоянии покоя [26, 27]. Было показано, что уровень прооксидантов в
опухолевых
клетках
часто
превышает
прооксидантный
уровень
в
нормальных клетках того же типа, что возможно является причиной их
6
чрезмерной пролиферации [28, 29]. Добавление небольших концентраций
прооксиданта пероксида водорода усиливало пролиферацию клеток [28], а
повышение экспрессии антиоксидантного фермента MnСОД, наоборот,
приводила
к
замедлению
пролиферации
[30].
Поскольку
карнозин
демонстрирует эффективные антиоксидантные свойства, мы предположили,
что ингибирование пролиферации опухолевых клеток происходит в
результате снижения уровня внутриклеточных прооксидантов под действием
карнозина.
Работа выполнена в соответствии с планом НИР ФГБУ «НЦН» РАМН в
рамках темы №146 «Исследование в условиях in vitro и in vivo проблем
эффективности безопасности наноструктурных комплексов, обладающих
нейропротекторным действием».
Цель
исследования.
Изучение механизма антипролиферативного
действия карнозина и его производных на опухолевые клетки нейрального
происхождения.
Задачи исследования:
1. Изучить характер воздействия карнозина на пролиферацию культур
опухолевых клеток феохромоцитомы крысы (РС-12), карциномы горла и рта
(FaDu, Cal27) и молочной железы (MB231) человека, глиобластомы человека
(U-118-MG);
2. Выявить, сопровождаются ли индуцируемые карнозином изменения
пролиферации опухолевых клеток колебаниями внутриклеточного уровня
АФК и антиоксидантных ферментов;
3. Выяснить, являются ли индуцируемые карнозином изменения
пролиферации опухолевых клеток результатом модификации прогрессии
клеточного цикла;
7
4. Сравнить антипролиферативные свойства карнозина с действием его
производных, а также синтетического трипептида пинеалона;
5.
Оценить
эффект
совместного
применения
карнозина
и
ионизирующего излучения на гибель опухолевых клеток.
Научная новизна. Настоящая работа представляет собой оригинальное
экспериментальное исследование, в котором было впервые показано
избирательное
действием
подавление
карнозина.
пролиферации
Установлено,
клеток
что
глиобластомы
замедление
под
пролиферации
глиобластомы сопровождается накоплением клеток в G2 фазе клеточного
цикла и активацией экспрессии циклина B1. Продемонстрировано, что
параллельно с изменениями в прогрессии клеточного цикла происходит
повышение активности MnСОД и понижение внутриклеточного уровня
АФК. Выявлено, что метилированное производное карнозина – анзерин –
подавляет
пролиферацию
глиобластомы
эффективнее, чем
карнозин.
Показано, что предварительная инкубация клеток с карнозином снижает
выживаемость
клеток
глиобластомы
под
действием
ионизирующего
излучения.
Теоретическая и практическая значимость работы. Полученные
результаты
существенно
антипролиферативного
расширяют
действия
представления
карнозина
на
о
опухолевые
природе
клетки
нейрального происхождения, что важно для понимания молекулярных
механизмов действия карнозина в целом. Полученные в работе данные об
эффекте совместного действия карнозина и ионизирующего излучения на
выживаемость клеток глиобластомы открывают перспективу для применения
карнозина в комбинированной терапии опухолей головного мозга.
8
Основные положения, выносимые на защиту:
1. Карнозин ингибирует пролиферацию опухолевых клеток нейрального
происхождения, при этом наиболее выраженный эффект проявляется на
клетках глиобластомы человека U-118-MG;
2. Ингибирование пролиферации клеток глиобластомы под действием
карнозина
сопровождается
снижением
уровня
АФК
и
увеличением
активности MnСОД;
3. Изменения в антиоксидантной системе клеток глиобластомы
сопровождаются накоплением клеток в G2 фазе клеточного цикла и
усилением экспрессии циклина В1;
4. Метилированное производное карнозина, анзерин, ингибирует
пролиферацию клеток глиобластомы эффективнее, чем карнозин;
5.
Предварительная
выживаемость
клеток
инкубация
глиобластомы
клеток
под
с
карнозином
действием
снижает
ионизирующего
излучения.
Протокол
диссертационного
исследования
«Антипролиферативное
действие карнозина и его производных на опухолевые клетки нейрального
происхождения» было одобрено локальным этическим комитетом ФГБУ
«НЦН» РАМН. Протокол №12/13 от 11.12.2013.
Апробация работы. Диссертация апробирована и рекомендована к
защите на совместном заседании научных сотрудников ФГБУ «Научный
центр неврологии» РАМН 18 октября 2013 года.
Материалы диссертационной работы были представлены на V Stromboli
Conference on Cancer and Ageing: “The Primeval Life-Generating Molecules.
Therapeutic and Aging-Reversing Properties” (Стромболи, Италия, 2010) и The
4th Quadrennial Meeting of the World Federation of Neuro-Oncology held in
9
conjunction with the 2013 SNO Scientific Meeting and Education Day (СанФранциско, США, 2013)
Публикации. По материалам диссертации опубликовано 4 научные
работы, из них 1 публикация в изданиях, рекомендуемых ВАК Министерства
образования и науки РФ и 2 работы в зарубежных рецензируемых журналах.
Личный вклад автора. Автором лично выполнено культивирование
клеточных линий и исследования клеточной пролиферации, проведено
измерение уровня АФК, доли мертвых клеток, а также анализ клеточного
цикла, определена активность и экспрессия антиоксидантных ферментов.
Выполнена последующая аналитическая обработка и обобщение полученных
результатов, сформулированы выводы и подготовлены публикации.
Структура и объем диссертации. Диссертация состоит из введения,
обзора литературы, описания материалов и методов исследования, изложения
результатов, их обсуждения, выводов и списка литературы. Работа содержит
120 стр. машинописного текста, 1 таблицу и 29 рисунков. Список литературы
включает 271 источник (18 отечественных и 253 зарубежных).
ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ
РАЗДЕЛ 1.1. Редокс-статус клетки определяется соотношением
внутриклеточных про- и антиоксидантов
1.1.1. Активные формы кислорода и их значение в жизни клетки
Наиболее распространенные и реакционноспособные прооксиданты в
клетке – активные формы кислорода (АФК). АФК представляют собой
продукты частичного восстановления кислорода, содержащие один или
несколько неспаренных электронов, и относятся к классу свободных
радикалов [31].
10
Главным источником АФК в клетке является дыхательная цепь
митохондрий [32], где теряется порядка 2% супероксида. Помимо этого АФК
образуются при работе некоторых ферментов (НАДФН-окcидаза [33],
ксантиноксидаза [34], монооксигеназа, NO-синтаза [35] и др), метаболизме
ксенобиотиков,
активации
дыхательного
взрыва
в
лейкоцитах,
под
воздействием цитокинов, ионизирующего и УФ-излучения [36]. Образование
АФК происходит в несколько стадий. Одноэлектронное восстановление
кислорода
приводит
к
формированию
супероксидного
аниона
(или
супероксида, О2•-), который сам по себе не является окислителем, а наоборот,
по свойствам напоминает слабое основание. Поэтому при физиологическом
pH супероксид присутствует частично в протонированной форме (НО2•, pKa =
4.8), которая является достаточно сильным окислителем [37]. НО2•
представляет собой, по сути дела, пероксильный радикал (ROO•) без
радикала (R), и поэтому подобно ROO•, легко инициирует перекисное
окисление липидов (ПОЛ), приводя к образованию новых форм АФК:
продуктов ПОЛ, пероксильных (ROO•) и алкоксильных (RO•) радикалов [38].
Супероксид достаточно быстро дисмутирует с образованием пероксида
водорода (Н2О2): О2-• + 2HО2•  2O2 + H2O2, (k=9,7x107 M-1•s-1) [39].
Взаимодействие между супероксидом и пероксидом водорода (реакция
Фентона) приводит к образованию гидроксильного радикала (HO•): 2О2-• +
H2О2 + 2H+  2HO• + 2HO- + O2. Сама по себе реакция идет очень медленно
(k<0.1 M-1•s-1), однако значительно ускоряется в присутствии ионов
переходных металлов (Fe2+, Cu2+ и др.) [40]. HO• является самым сильным
окислителем в водных растворах, реагируя с огромной скоростью с любыми
находящимися по близости молекулами (k ≈ 109 – 1010 M-1•s-1 для соединений
содержащих C, H, O, S, N) [37]. Описанные выше превращения можно
обобщить в виде четырех простых реакций:
О2 + 1е- + (H+)  О2•- (НО2•)
НО2•- + 1е- + H+  Н2О2
11
Н2О2 + 1е- + Н+  Н2О + НО•
НО• + 1е- + H+  Н2О
В
результате
воздействия
ионизирующего
или
УФ-излучения,
некоторых химических соединений (ксенобиотики и др.), а также при
старении
и
опухолевой
внутриклеточного
повреждению
уровня
трансформации
АФК,
макромолекул
что
(ДНК,
происходит
приводит
белки,
к
липиды),
повышение
окислительному
нарушению
их
структуры, функции и в итоге к гибели клетки. В то же время, на
сегодняшний день накоплено множество данных о том, что в небольших
количествах АФК играют важную роль в жизни клетки [41-44]. В
независимых исследованиях было продемонстрировано участие АФК в
регуляции
пролиферативных
процессов.
Добавление
O2•-
к
среде
культивирования нормальных фибробластов или лимфоцитов усиливало
пролиферацию клеток [45, 46]. Laurent et al. показали, что небольшие
концентрации Н2О2 (0,02 – 0,13 мкМ) индуцируют пролиферацию
нормальных мышиных фибробластов NIH 3T3, а также опухолевых клеток
линий СТ26 (карцинома прямой кишки мыши) и Нера 1-6 (гепатома мыши)
[28]. Сравнительный анализ образования АФК в нормальных и опухолевых
клетках выявил, что уровень АФК в опухолевых клетках значительно выше
по сравнению с нормальными клетками того же вида [29]. Образование АФК
в нормальных клетках происходит в главным образом за счет работы
НАДФН-оксидаз, в то время как основным источником АФК в опухолевых
клетках являются митохондрии [28].
1.1.2. Основные представители антиоксидантной системы клетки и
их роль в поддержании редокс-статуса
Концентрация
антиоксидантной
внутриклеточных
системой
клетки,
прооксидантов
которая
регулируется
включает
как
низкомолекулярные вещества (витамин Е, С, β-каротин, глутатион, НАДФН,
12
пируват, тиоредоксин и др.), так и ферменты (супероксиддисмутаза,
глутатионпероксидаза, каталаза, тиоредоксин пероксидаза и др.). Таким
образом, в норме в клетке постоянно поддерживается равновесие между
скоростью образования прооксидантов и их устранением с помощью
системы
антиоксидантов.
Это
равновесие
называется
окислительно-
восстановительным балансом или редокс-статусом [47].
Самым распространенным низкомолекулярным антиоксидантом клетки
является цистеин-содержащий трипептид - глутатион (Gly-Cys-Glu, GSH),
его концентрация в цитоплазме может достигать 11 мМ [48]. Благодаря
наличию чувствительной к окислению -SH группы цистеина GSH способен
улавливать малейшие изменения редокс-статуса и реагировать на них.
Соотношение восстановленной формы глутатиона (GSH) и окисленной
(GSSH) часто используется для оценки состояния внутриклеточного
окислительно-восстановительного баланса [47, 49].
Одним из основных антиоксидантных ферментов клетки является
супероксиддисмутаза
(СОД),
катализирующая
реакцию
дисмутации
супероксида: О2-• + О2-•  O2 + H2O2. Несмотря на то, что дисмутация О2-•
происходит быстро и сама по себе, СОД делает реакцию практически
молниеносной (k=2х109 M-1•s-1) [50]. Cуществует три изоформы СОД:
митохондриальная (MnСОД) [50], цитоплазматическая (CuZnСОД) [51] и
внеклеточная, на поверхности клеточных мембран, (ЕС(CuZn)СОД) [52].
Поскольку митохондрии являются главным источником АФК в клетке,
митохондриальная MnСОД представляется первым барьером защищающим
клетку от окислительного повреждения. Несколькими независимыми
лабораториями было показано, что полное ингибирование MnСОД (Sod2-/-) у
новорожденных мышей приводит к гибели животных в течение 1-18 дней
после рождения
и
сопровождается дилатационной кардиомиопатией,
усилением накопления липидов в печени и метаболическим ацитодозом [53,
54]. Ингибирование экспрессии других изоформ СОД, каталазы или
13
глутатионпероксидазы
было
совместимо
с
жизнью.
Частичное
ингибирование активности MnСОД (Sod2+/-) приводило к нарушению
функционирования
митохондрий
и
усилению
их
окислительного
повреждения, а также увеличению риска развития опухолей [55-57].
Окислительное повреждение митохондрий и нарушение их функции, видимо,
и являются причиной усиления образования митохондриальных АФК в
опухолевых клетках. Пероксид водорода, образующийся в результате
дисмутации О2-•, утилизируется в пероксисомах с помощью каталазы (H2O2 +
H2O2

H2O
+
O2)
[58,
59]
или
в
цитоплазме
с
помощью
глутатионпероксидазы (GPx) (H2O2 + 2GSH  2H2O + GSSG). Причем, GPx
катализирует реакцию не только с H2O2, но и с ROOH приводя к образованию
спиртов (ROH) [60, 61].
Благодаря способности модулировать внутриклеточный уровень АФК
антиоксиданты способны влиять на пролиферацию клеток. Как было
отмечено выше (см. 1.1.1), в небольших количествах АФК индуцируют
пролиферацию клеток. Снижение уровня Н2О2 за счет усиления экспрессии
каталазы в эндотелиальных клетках и HER-2/Neu-трансформированных Rat-1
фибробластах приводило к ингибированию пролиферации этих клеток [62,
63]. Понижение уровня АФК под действием синтетического антиоксиданта
N-ацетил-цистеина (NAC) в клетках слизистой оболочки полости рта тажке
приводило к замедлению пролиферативных процессов [64, 65].
Исследование пролиферации эмбриональных мышиных фибробластов с
различным уровнем экспрессии MnСОД выявило, что пролиферация клеток
содержащих MnСОД (+/+) замедляется по мере увеличения плотности
популяции (контактное торможение). Частичное подавление экспрессии
MnСОД приводило к тому, что MnСОД (+/-) клетки были нечувствительны к
контактному торможению и продолжали пролиферировать. Рост MnСОД (-/-)
фибробластов был существенно замедлен. Усиление экспрессии MnСОД в
MnСОД
(+/-)
клетках
приводило
14
к
замедлению
пролиферации.
Ингибирование MnСОД в клетках экспрессирующих MnСОД (+/+),
наоборот, приводило к усилению пролиферации. Интересно отметить, что
обработка MnСОД (+/-) клеток с помощью Tiron, ловушки для O2-•,
приводила к понижению уровня O2-• и замедлению пролиферации, указывая
на
важную
роль
O2-•
в
поддержании
пролиферации.
Замедление
пролиферации также сопровождалось повышением концентрации Н2О2,
продукта
работы
MnСОД
Исследование
[66].
посттрансляционных
модификаций в молекуле MnСОД выявило различия в сайтах метилирования
в пролиферирующих и покоящихся клетках. Уровень метилирования MnСОД
в
активно
пролиферирующих
клетках
был
ниже,
чем
в
клетках,
пролиферация которых была замедленна [27].
Опухолевые клетки часто характеризуются смещением редокс в более
окисленное состояние, что происходит в результате усиления образования
АФК и ослабления работы антиоксидантных ферментов [67-70]. В отличие от
нормальных клеток, в которых уровень GSH снижался по мере увеличения
количества клеток (т.н. контактное торможение), уровень GSH в опухолевых
клеток был постоянно высоким [71]. Вероятно, поэтому опухолевые клетки
были невосприимчивы к действию NAC, предшественнику GSH. Обработка
клеток карциномы молочной железы с помощью NAC не приводила к
восстановлению редокс и формированию G1 блока [72]. Снижение
внутриклеточного
уровня
GSH
за
счет
ингибирования
γ-
глутамилцистеинсинтетазы с помощью DL-бутионин-S,R-сульфоксимина
(BSO), приводило к смещению внутриклеточного редокс-статуса в более
окисленное состояние и аресту клеточной пролиферации [73].
Активность антиоксидантных ферментов в опухолевых клетках часто
понижена по сравнению с нормальными клетками того же типа что,
вероятно, является одной из причин активной пролиферации опухолевых
клеток. Например, активность CuZnСОД и MnСОД в нормальных клетках
печени мыши составляла, соответственно, 122 и 35 ед/мг, в то время как, в
15
клетках гепатомы активность CuZnСОД падала до 40 ед/мг, а активность
MnСОД вообще не определялась [74]. Повышение экспрессии MnСОД в
опухолевых клетках приводило к замедлению опухолевого роста [74-76].
Сходные данные были получены для каталазы и некоторых изоформ GPx.
Снижение активности ферментов приводило к повышению уровня АФК,
усилению пролиферативных процессов, а также способствовало развитию
опухолевой трансформации [77, 78]
Резюмируя вышесказанное, важно отметить следующее: в клетке
постоянно поддерживается баланс между про- и антиоксидантами. Наиболее
распространенными прооксидантами являются АФК, к которым относятся:
О2•-, Н2О2, НО•, ROO• и др. Основные регуляторы уровня внутриклеточных
прооксидантов – антиоксиданты MnСОД, каталаза и GSH. Повышение
уровня АФК приводит к гибели клетки, однако в небольших количествах
АФК
способны
индуцировать
пролиферативные
процессы.
Быстро
делящиеся опухолевые клетки часто характеризуются повышенным уровнем
АФК и пониженной активностью антиоксидантной системы, что возможно
является одной из причин их активной пролиферации. Повышение
антиоксидантной активности и понижение уровня АФК приводят к
замедлению пролиферативных процессов, это открывает возможность
контролировать пролиферацию опухолевых с помощью антиоксидантов.
РАЗДЕЛ 1.2. Редокс-регуляция клеточной пролиферации
Для того чтобы понять, механизм редокс-регуляции пролиферации,
необходимо вспомнить - что такое пролиферация. Пролиферация - это
процесс увеличения количества клеток, определяющийся соотношением
скоростей деления клеток и их гибели. Гибель клеток может происходить как
в результате повреждения целостности клетки (некроз), так и путем
активации внутриклеточных программ (апоптоз). Деление клетки строго
регулируется как внутренними программами, так и внешними факторами
(факторы роста, цитокины и др.), воздействующими на внутренние
16
программы. Каждому делению предшествует комплекс последовательных
внутриклеточных изменений, т.н. клеточный цикл, основная цель которого –
удвоение содержимого клетки и его равномерное распределение между
двумя дочерними клетками при делении.
1.2.1. Клеточный цикл и его регуляция
Клеточный цикл представляет собой высокоорганизованную и строго
регулируемую последовательность переходов от G1 фазы к S, к G2 и митозу
(М). Переход от одной фазы к другой регулируется последовательной
экспрессией белков циклинов и активацией циклин-зависимых киназ (cyclin
dependent kinase, CDK). CDK представляют собой серин/треоининовые
протеинкиназы, которые активируются при соединении с циклинами и
запускают
события
клеточного
цикла,
путем
фосфорилирования
соответствующих остатков в белках-мишенях [79]. На Рис. 1.1. представлены
основные циклин/CDK комплексы позвоночных, специфичные для той или
иной фазы клеточного цикла. Уровень циклинов меняется по мере
прогрессии клеточного цикла, приводя к колебаниям активности CDK (См.
Рис. 1.1). Помимо циклинов активность CDK комплексов регулируется с
помощью
CDK-активирующей
киназы
(CDK-activating
kinase,
CAK),
ингибиторов CDK (cyclin-dependent kinase inhibitor protein, CKI), а также
протеолитическими процессами (убиквитинирование) [80, 81].
Для
полной
активации
комплекса
циклин/CDK
необходимо
фосфорилирование CDK по Thr161 (CDK1), Thr160 (CDK2) или Thr172/177
(CDK4/6), которое осуществляется в ядре с помощью CAK [83-85]. САК
состоит из трех субъединиц: CDK7, циклин H и белка Mat1, который
активирует комплекс циклин H/CDK7. Связывание с циклином приводит к
конформационным изменениям в CDK, которые делают возможным
фосфорилирование CDK с помощью CAK [86]. Активность CAK-киназы
постоянна на протяжении всего клеточного цикла [87].
17
Рисунок 1.1. Основные фазоспецифические
комплексы
циклинов с циклин-зависимыми
киназами у позвоночных. Из [82],
с изменениями. См. пояснения в
тексте.
На сегодняшний день насчитывается два семейства CKI: INK4 и Cip/Kip.
Семейство INK4 включает белки р15, р16, р18 и р19, которые специфически
связываются с CDK4/6, препятствуя образованию комплекса с циклином D
[88, 89]. Увеличение уровня белка р16 часто наблюдается в стареющих
клетках и сопровождается снижением пролиферативных способностей [90].
Белки р21, р27 и р57, относящиеся к Cip/Kip семейству, связываются с CDK2
и контролируют прогрессию через S фазу [91]. Ингибирование CKI часто
приводит
к
нарушению
контроля
пролиферации
и
опухолевой
трансформации [92-94].
Важную роль в регуляции протеолитических процессов во время
клеточного цикла играет Комплекс стимулирующий анафазу (Anaphase
promoting complex, АРС), который представляет собой убиквитин-лигазу,
фермент катализирующий реакцию присоединения множественных копий
белка убиквитина к боковым цепям лизина в молекуле белка-мишени [95,
96]. Полиубиквитинированние часто является сигналом к деградации белка,
которое происходит в 26S протеасоме [97]. АРС присутствует в клетке на
протяжении всего цикла, однако активность комплекса варьирует. АРС
активируется в середине митоза, а ингибирование АРС происходит в конце
G1 фазы [98, 99].
18
Некоторые химические соединения, ионизирующее и УФ излучение,
ингибиторы репликации ДНК, а также ошибки при репликации или
репарации ДНК приводят к нарушению структуры ДНК и остановке
клеточного
цикла.
Главную
роль
в
этом
процессе
играют
2
серин/треониновые протеин киназы – АТМ (ataxia telangiectasia mutated) и
ATR (ATM-Rad3-related protein). АТМ активируется в ответ на появление
двуцепочечных
разрывов
ДНК,
образующиеся
под
воздействием
ионизирующего облучения. ATR активирует под действием УФ-облучения
или при нарушениях репликации ДНК. ATM и ATR прикрепляются к сайту
повреждения ДНК и фосфорилируют различные белки, в том числе Chk1 и
Chk2, которые приводят к остановке клеточного цикла в G1 фазе, препятствуя
удвоению ДНК, или в G2 фазе, блокируя вход в митоз [100-103].
Инициация пролиферации. Сигнальные молекулы, стимулирующие
деление клетки, называются митогенами. К наиболее распространенным
митогенам относятся факторы роста (ФР; эпидермальный ФР (EGF), ФР
фибробластов (FGF), ФР тромбоцитов (PDGF), инсулиноподобный фактор
роста (IGF) и др.). Факторы роста связываются со специфическими
рецепторами
на
поверхности
клетки,
приводя
к
их
активации.
Активированные рецепторы индуцируют внутриклеточные сигнальные
каскады митоген-активируемых протеинкиназ (mitogen-activated protein
kinases, МАРК). Существует 4 вида МАРК: ERK1/2, JNK, p38 и ERK5.
Каскад ERK1/2 активируется в ответ на пролиферативные стимулы,
например взаимодействие ФР с рецептором на поверхности мембраны.
Каскады JNK, p38 и ERK5 активируются в основном при стрессе. ERK1/2
представляют собой консервативные серин/треониновые протеинкиназы,
способные
фосфорилировать
различные
белки-мишени
в
цитопламе,
мембранах и ядре, и, таким образом, регулировать большое разнообразие
внутриклеточных процессов [104, 105]. Показано, что активация ERK1/2
необходима для пролиферации клеток. Активированные ERK1/2 киназы
19
принимают участие в синтезе пиримидинов, ремоделировании хроматина,
синтезе новых рибосом, активации факторов трансляции и транскрипции, а
также в регуляции G1/S и G2/M переходов между фазами клеточного цикла.
Ингибирование ERK1/2 приводило к остановке пролиферации и накоплению
клеток в одной из фаз клеточного цикла. Финальным шагом ERK1/2 киназ
является активация факторов транскрипции (Myc, Elk-1, Sap-1, TIF-IA, и др.),
которые индуцируют экспрессию генов, запускающих события клеточного
цикла [106-109].
G1 фаза. В G1 фазе происходит активный рост новообразованной
дочерней клетки, проверяется целостность и равномерность распределения
хромосом после митоза. Первым под действием митотического сигнала
активируется экспрессия циклинов D (в частности D1), которые образуют
комплексы с CDK 4 или CDK 6 [110]. Главная роль комплекса циклин
D1/CDK4/6 заключается в фосфорилировании белка ретинобластомы
(retinoblastoma tumor suppressor protein,
рRb) и
активация
фактора
транскрипции E2F. В отсутствии митотической стимуляции E2F связан с pRb
и поэтому не активен. Фосфорилирование pRb приводит к конформационным
изменениям в молекуле pRb и освобождению E2F [111]. E2F связывается со
специфической
последовательностью
ДНК
и
активирует
экспрессию
большого количества разнообразных генов необходимых для входа в S фазу,
среди них циклины Е и А, ДНК полимераза, белок-ингибитор раннего митоза
(early mitotic inhibitor, Emi1) и др. [112]. В конце G1 фазы циклин D1
разрушается, что приводит к ингибированию связанных с ним CDK.
Разрушение циклина D1 происходит с помощью киназы гликогенсинтетазы
(GSK-3β), которая фосфорилирует циклин D1 по Thr286, или с помощью
Mirk/dyrk киназы, которая фосфорилирует циклин D1 по Thr288. В обоих
случаях фосфорилирование влечет за собой деградацию циклина в
протеасомах [113, 114]. Ингибирование экспрессии циклина D1 препятствует
20
переходу клеток в S фазу. В то время как эктопическая экспрессия циклина
D1 ускоряет прогрессию через G1 фазу [115].
Интересно отметить, что для перехода из G1 фазы в S, также необходима
активация ERK1/2 с последующей транслокацией протеинкиназы в ядро.
Показано,
что
ERK1/2
индуцирует
экспрессию
циклина
D1,
предположительно, через активацию экспрессии генов семейства Fos и Myc.
Экспрессия Fos запускается с помощью ERK-активируемого фактора
транскрипции Elk. Фосфорилирование Myc по Ser62 с помощью ERK1/2
увеличивает стабильность Myc, который способен напрямую индуцировать
экспрессию циклина D1 [106].
В конце G1 фазы находится т.н. точка «Старт» (Start или Restriction point)
- контрольная точка, в которой оценивается готовность клетки и
благоприятность внешних условий (наличие питательных веществ, факторов
роста и др.) к переходу в S фазу и удвоению ДНК. Прошедшая через «Старт»
клетка – запрограммирована на репликацию и больше не зависима от
внешних стимулов.
К концу G1 фазы возрастает количество циклина Е, который образует
комплекс с CDK2. Фосфатаза Cdc25A дефосфорилирует CDK2 по p-Tyr15 и
p-Thr14,
активируя
комплекс
циклин
Е/CDK2,
необходимый
для
продвижения клетки из G1 в S [116]. Как только клетки входят в S фазу
циклин Е деградирует и CDK2 соединяется с циклином А [81, 110]. Циклин
А не накапливается в клетке вплоть до поздней G1 фазы из-за
убиквитинирования под действием АРС. Циклины D и Е нечувствительны к
действию АРС. Перед входом в S фазу Emi1, экспрессия которого
запускается с помощью E2F, ингибирует АРС, способствуя стабилизации
циклина А и активации СDK2. [117].
S фаза. Основным событием S фазы является удвоение ДНК
(репликация) и хроматина. Репликация может начинаться только в
21
определенных местах – точках начала репликации (origins of replication, OR),
которые разбросаны по всей ДНК. Подготовка к репликации начинает еще в
конце митоза – начале G1 фазы, когда в точках начала репликации
собираются т.н. пререпликационные комплексы (pre-RC),
состоящие из
большого количества белков необходимых для инициации репликации. Эта
стадия
часто
называется
лицензированием
(licensing)
точек
начала
репликации, т.к. синтез ДНК может происходить только в OR содержащих
pre-RC. В S фазе активный комплекс циклин А/CDK2 запускает сборку
преинициирующих
комплексов
вокруг
компонентов
pre-RC.
Преинициирующие комплексы раскручивают спираль ДНК подготавливая
место посадки ДНК, полимеразы и других ферментов репликации. Сразу
после репликации OR комплекс pre-RC разбирается под действием циклин
А/CDK2. Сборка новых pre-RC в S фазе невозможна из-за присутствия
активных СDK, что препятствует множественной репликации [118, 119].
Репликация хромосом состоит из репликации ДНК и репликации хроматина.
Основную массу хроматина составляют белки гистоны. Циклин А/CDK2
индуцирует
синтез
гистонов,
поставляя
материал
для
упаковки
новосинтезированной ДНК. К концу S фазы каждая хромосома состоит из
двух пар идентичных сестринских хроматид. Каждая пара сестринских
хроматид связана между собой комплексами белков, когезинами, которые
регулируют процесс разделения сестринских хроматид при митозе [120].
G2 фаза. Прохождение клетки через G2 фазу и вход в митоз
регулируется комплексом циклина В/CDK1 [121]. На сегодняшний день
семейство циклинов В состоит из 5 белков – циклины В1, В2, В3, В4 и В5, из
которых В1 является наиболее охарактеризованным [122].
Промотор
циклина В1 содержит сайты связывания для множества транскрипционных
факторов, в том числе B-Myb, NF-Y, USF, p53, p21, Ap-1, Ap-2, Ets-1 и др.
[123]. Экспрессия гена циклина В1 наблюдается на протяжении всего
клеточного цикла, однако в G2 уровень циклина В1 в 50 раз больше, чем в G1.
22
Наивысшего уровня циклин В1 достигает в конце G2 фазы – начале митоза
[124]. В середине митоза уровень циклина В1 резко снижается за счет работы
АРС и остается низким до поздней S фазы, когда происходит ингибирование
АРС с помощью Emi1 и комплекса циклин А/CDK2 [117, 125]. Усиление
экспрессии циклина В1 приводит к его накоплению в цитоплазме, достигнув
определенной концентрации циклин В связывается с CDK1. Образовавшийся
комплекс циклин В1/CDK1 перемещается в ядро [126]. Транслокация циклин
В1/CDK1 в ядро возможна только при фосфорилировании 5 серинов в сайте
удерживающем циклин В1 в цитоплазме (cytoplasmic retention site, CRS):
Ser116, Ser26, Ser128, Ser133 и Ser147 [126]. Показано, что ингибирование
ERK1/2 препятствует фосфорилированию CRS, что приводит к удерживанию
комплекса циклин В1/CDK1 в цитозоле [127]. Yang et al. предполагают, что
CRS циклина В1 является частью последовательности для экспорта белка в
ядро (nuclear export sequences, NES), с помощью которой циклин В1
взаимодействует с экспортирующим ядерным рецептором (chromosome
region maintenance 1, CRM1) [128]. Однако комплекс остается неактивным,
потому что протеинкиназы Wee1 и Myt1 фосфорилируют CDK1 по Thr14 и
Tyr15, ингибируя активность CDK1. Wee1 находится в ядре, а Myt1 – на
цитоплазматической стороне мембраны эндоплазматического ретикулума
[129-131]. Интересно отметить, что активация ERK1/2 снижает активность
Myt1 через активацию RSK, непосредственного субстрата ERK1/2, который
фосфорилирует и ингибирует Myt1, приводя к остановке клеточного цикла в
G2/M [132]. Для активации комплекса циклин В/CDK1 необходима фосфатаза
Cdc25С, которая дефосфорилирует CDK1, убирая ингибирующие фосфаты
[133, 134]. Активированный циклин В/CDK1 запускает события раннего
митоза [129]. Параллельно с активацией циклин В/CDK1 происходит
ингибирование Wee1 и Myt1. В течение интерфазы Cdc25C-associated protein
kinase (C-TAK1) фосфорилируют Cdc25С по Ser216, что способствует его
связыванию с белком 14-3-3 [135-137], который удерживает Cdc25С в
цитоплазме, препятствуя перемещению фосфатазы в ядро и активации
23
циклин В/CDK1 [138, 139]. Активирующаяся в ответ на повреждение ДНК
Chk1
киназа
тоже
способна
фосфорилировать
Cdc25С,
приводя
к
ингибированию фосфатазы и остановке прогрессии клеточного цикла [138,
140, 141].
Митоз.
Основная
задача
митоза
–
равномерное
распределение
содержимого материнской клетки между двумя дочерними. Митоз состоит из
нескольких подфаз (профаза, прометафаза, метафаза, анафаза, телофаза) и
заканчивается цитокинезом, делением клетки надвое. События раннего
митоза (профаза, прометафаза, метафаза) запускаются активированным во
время G2 фазы комплексом циклин В/CDK1. Циклин В/CDK1 фосфорилирует
субъединицы белка конденсина, это стимулирует свертывающую активность
конденсина
и
инициирует
конденсацию
хромосом.
Параллельно
активируется сборка митотического веретена деления. Фосфорилирование
белков, входящих в состав комплексов ядерных пор и ламины, приводит к
разрушению ядерной оболочки. В конце метафазы циклин В/CDK1
активирует АРС. Клетки не входят в анафазу (не происходит разделения
хроматид) до тех пор, пока все хромосомы не прикрепятся к веретену
деления. Неприкрепленные хроматиды блокируют разделение хроматид. Это
происходит, вероятно, за счет того, что неприкрепленные кинетохоры
посылают сигнал АРС, блокирующий его активность [142]. Активность АРС
регулируется с помощью двух дополнительных белков Cdc20 и Cdh1,
которые
выполняют
функцию
субстрат-специфических
связывающих
доменов. Циклин В/CDK1 фосфорилирует АРС, приводя к образованию
комплекса АРС/Cdc20 и усилению активности АРС. АРС/Cdc20 ингибирует
АРС/Cdh1 за счет фосфорилирования Cdh1. АРС/Cdc20 убиквитинирует
белок секурин, что ведет к его деградации и активации протеолитического
фермента, сепаразы, разрушающей комплексы когезинов, инициируя
разделение хромосом и их расхождение к полюсам деления. Помимо участия
в расхождении хромосом, АРС инициирует деградацию всех циклинов,
24
приводя к инактивации всех CDK и дефосфорилированию их мишеней. Эти
изменения необходимы для завершения митоза – разрушения веретена
деления и цитокинеза. Деградация циклина В приводит к инактивации
комплекса циклин В/CDK1, а, следовательно, и стимула активирующего
АРС/Cdc20. Снижение АРС/Cdc20 в конце митоза способствует увеличению
активности АРС/Cdh1. АРС/Cdh1 также как и АРС/Cdc20 убиквитинирует
циклины приводя к их деградации [98]. В результате период времени от
анафазы до поздней G1 является периодом инактивации CDK. Этот период
необходим, так как сдерживает какое то время клетку от вступления в новый
клеточный цикл. Некоторые клетки никогда не входят в клеточный цикл
оставаясь в т.н. фазе покоя - G0, экспрессия генов циклинов и CDK в них
подавлена [80].
Подводя
итог
вышесказанному,
важно
отметить
следующее:
пролиферация представляет собой последовательность переходов от G1 фазы
клеточного цикла к S, G2 и митозу. События каждой фазы запускаются путем
фосфорилирования определенных белков с помощью циклин-зависимых
киназ. Активность циклин-зависимых киназ регулируется с помощью
синтеза/деградации их функциональных субъединиц, циклинов, а также
фосфорилирования/дефосфорилирования самих киназ. На сегодняшний день
в литературе накоплено множество данных о взаимосвязи между состоянием
редокс-статуса клетки и функционированием некоторых белков-регуляторов
клеточного цикла, что позволяет предположить существование редоксрегуляции клеточного цикла.
1.2.2. Редокс-регуляция клеточного цикла
Впервые существование редокс-регуляции клеточного цикла было
упомянуто в работе Rapkine. Он наблюдал колебания уровня растворимых в
трихлоруксусной кислоте тиолов по мере прогрессии клеточного цикла.
Концентрация тиолов падала в течение подготовки к делению и возрастала
по мере формирования митотического аппарата [143]. Позже Kawamura
25
наблюдал усиление окраски тиоловых групп (-SH) белков по мере сборки
веретена деления в яйцах морского ежа находящихся в профазе.
Окрашивание оставалось интенсивным в метафазе, постепенно снижалось по
мере продвижения клеток по анафазе и было почти незаметным в телофазе
[144]. Mauro et al., используя синхронизированные клетки HeLa, наблюдали
снижение концентрации несвязанных с белками -SH групп в G1 фазе с
последующим увеличением концентрации к концу S фазы. Концентрация
восстановленных тиоловых групп в составе белков, наоборот, была
максимальной в G1 и постепенно снижалась по мере прогрессии через S фазу
[145]. Tu et al. продемонстрировали взаимосвязь между экспрессией генов и
интенсивностью дыхательных процессов. Экспрессия генов, кодирующих
рибосомальные белки, факторы инициации трансляции и других регуляторов
синтеза белка, происходила во время фазы активного дыхания, что,
возможно, связано с потреблением большого количества энергии во время
синтеза белка. Репликация ДНК и прогрессия клеточного цикла, наоборот,
происходили в условиях пониженной дыхательной активности, что,
вероятно, способствовало снижению окислительного повреждения ДНК под
действием АФК, образующихся в большом количестве в процессе дыхания
[146]. Существование взаимосвязи между редокс-статусом и синтезом белка
было подтверждено в работе Jonas et al. При исследовании синтеза ДНК по
интенсивности включения синтетического аналога тимина - 5-бром-2дезоксиуридина (БДУ) было обнаружено, что при окисленном состоянии
редокс-статуса скорость синтеза ДНК минимальна и значительно возрастает
при смещении редокс-статуса в более восстановленное состояние [147].
Рисунок 1.2. Изменения активности
MnСОД и уровня АФК по мере
прогрессии клеточного цикла.
26
Проведенные в нескольких независимых лабораториях исследования
выявили, что по мере прогрессии клеточного цикла от G0/G1 к митозу
происходит увеличение уровня АФК. Концентрация АФК, измеренная по
флуоресценции
редокс-чувствительного
красителя
DCFH2-DA,
была
максимальна в поздней S фазе, а также в G2+M по сравнению с G1 [26].
Параллельно с повышением АФК, увеличивался уровень основного редоксбуфера клетки – глутатиона (GSH) [148] – и достигал максимума в G2 и M
фазах по сравнению с G1, что, вероятно, являлось ответной реакцией на рост
АФК
[47,
149].
Интересно
отметить,
что
активность
основного
антиоксидантного фермента клетки - MnСОД – была максимальна в G1 фазе
и постепенно снижалась по мере прогрессии через S и G2 фазы что,
возможно, и являлось причиной роста АФК (см. Рис. 1.3) [27, 148, 150]. Более
детальное исследование изменения уровня О2•- и Н2О2 по мере прогрессии
клеточного цикла выявило, что О2•- повышен в G1 фазе, а уровень Н2О2
увеличивается в G2. Поскольку MnСОД играет важную роль в регуляции
соотношение между О2•- и Н2О2, то было сделано предположение, что
MnСОД выполняет роль переключателя пролиферативных процессов.
Повышение активности MnСОД приводило к снижению уровня О2•-,
увеличению уровня Н2О2 и усилению пролиферации. Снижение активности
MnСОД сопровождалось ростом уровня О2•-, понижением уровня Н2О2 и
замедлением пролиферации [27, 151]. Изменения внутриклеточного редоксстатуса при прогрессии клеточного цикла позволяют предположить
существование т.н. редокс-цикла внутри клеточного цикла и тесно с ним
взаимосвязанного. Причем, смещение редокс-статуса в более окисленное
состояние сопровождается активацией пролиферации, а смещение редокс в
более восстановленное состояние приводит к замедлению пролиферации [25,
152].
Молекулярные
механизмы
редокс-регуляции.
С
помощью
комбинированного in vitro/биоинформатического анализа выявлено, что 92 из
27
1634 исследованных белков-регуляторов клеточного цикла содержат в своей
структуре участки, способные модифицироваться в ответ на
изменения
редокс-статуса клетки. К редокс-чувствительным группам были отнесены
тиольные группы цистеина и метионина (–SH), дисульфидные связи (-S-S-),
ионы переходных металлов (Fe2+, Zn2+, Cu2+ и др), сопряженные системы
связей в белках-переносчиках электронов дыхательной цепи (Рис. 1.3).
Окисление тиоловых групп с образованием дисульфидных связей под
действием
Н2О2
часто
сопряжено
с
внутримолекулярными
конформационными изменениями, приводящими к активации/инактивации
молекулы (Рис. 1.3. А, Б). Изменение степени окисления металловкофакторов киназ и фосфатаз под действием
О2-• часто приводит к
ослаблению связей, удерживающих металл в комплексе с белком,
диссоциации металла из комплекса и нарушению редокс-регуляции (Рис. 1.3.
В, Г) [29, 149].
Показано, что взаимодействие некоторых митогенов (EGF, PDGF и др.)
с их рецепторами на поверхности мембран сопровождается образованием
небольшого количества Н2О2 [153, 154]. Добавление Н2О2 в отсутствии EGF
или PDGF индуцировало
факторов
роста.
внутриклеточный сигнал сходный с сигналом
Каталаза
и
пероксиредоксин
ингибировали
Н2О2–
индуцированный сигналинг [154-156]. Показано, что присутствие Н2О2
необходимо для фосфорилирования и активации МАР-киназы ERK1/2 [155,
157]. Интересно отметить, что молекула малой ГТФазы Ras, активатора
ERK1/2, содержит редокс-чувствительные цистеины [158]. Модификации
цистеинов в молекуле Ras под действием Н2О2 может быть одним из
механизмов редокс-регуляции ERK1/2 [159]. Ингибирование образования
Н2О2 с помощью NAC или GSH, а также усиление экспрессии MnСОД
препятствовало активации ERK1/2 и дальнейшей передачи сигнала от
рецепторов факторов роста к ядру [28, 160].
28
Рисунок 1.3. Примеры редокс-регулируемых модификаций в молекулах
белков. Из [149] с изменениями. (А) Обратимое глутатионилирование
остатка цистеина. (Б) Образование дисульфидной связи в молекуле
тиоредоксина.
сопряжённой
(В)
Взаимодействие
циклической
системой
электрона
флавина
с
–
изоаллоксазиновой
кофактора
белка
электронно-транспортной цепи. (Г) Окисленная иона железа в составе
гемма.
(Д)
Диссоциация
окисленного
металлсвязывающего домена белка.
29
переходного
металла
(Х)
из
В нескольких независимых лабораториях было показано, что ДНКсвязывающий домен некоторых факторов транксрипции (р53, NF-kB, AP-1, cMyb, Ets, Sp-1, Egr-1 и др.) содержит консервативные цистеины, замещение
или удаление которых приводит к нарушению редокс-регуляции и
изменению активности/функции белка (см. [161] и ссылки в нем). Например,
замещение консервативных цистеинов в молекуле опухолевого супрессора
р53
приводит
к
снижению
его
ДНК-связывающих
способностей.
Неспособный связываться с ДНК белок не может выполнять свои функции
фактора транскрипции и опухолевого супрессора, что часто приводит к
трансформации клетки и чрезмерной пролиферации [162, 163]. Сходным
образом замещение цистеинов в молекулах NF-kB и АР-1 и нарушение их
редокс-регуляции способствует абберантной пролиферации и развитию
опухолей [164, 165].
Показано, что промотор циклина D1, важного регулятора прогрессии
клетки через G1 фазу, содержит сайты связывания редок-регулируемых
факторов транскрипции, таких как NF-kB, AP-1, Sp-1 и др, то есть экспрессия
циклина D1 зависит от состояния внутриклеточного редокс-статуса [166]. В
условиях окислительного стресса происходит глутатионилирование c-Jun,
одной из субъединиц АР-1, по Cys269, который находится в сайте
связывания
ДНК.
Глутатионилирование
ДНК-связывающего
домена
ингибирует активность АР-1 и репрессирует экспрессию циклина D1. В
опухолевых клетках часто происходит мутация Cys269 и его замена на серин,
что приводит к потере редокс-регуляции и абберантной пролиферации [167].
Чувствительность к состоянию редокс-статуса была также показана для cMyb и NF-Y, регулирующим транскрипцию циклинов В1 и А. Фактор
транскрипции b-Myb содержит семь редокс-чувствительных цистеинов.
Смещение окислительно-восстановительного равновесия в более окисленное
состояние с помощью окислителя диамида значительно снижало активность
b-Myb, приводя к нарушению связывания транскрипционного фактора с
30
ДНК. Интересно отметить, что повышенный уровень b-Myb часто
встречается в опухолевых клетках. Как отмечалось выше, большинство
опухолевых клеток характеризуется повышенным содержанием АФК, что
возможно и приводит к нарушению регуляции пролиферации с помощью bmyb [168]. Фактор транскрипции NF-Y на 30% существует в виде неактивных
димеров. Добавление восстановителя, дитиотреитола, к NF-Y способствовало
усилению связывания NF-Y с ДНК. Замещение Cys85 и Cys89 в молекуле
NF-Y на серины приводило к тому, что NF-Y присутствовал только в форме
мономеров и его активность не зависела от дитиотреитола [169].
Рисунок 1.3. Редокс-регуляция клеточного цикла. Из [152] с изменениями,
см. пояснения в тексте.
Повышение уровня GSH при обработке мышиных фибробластов,
находящихся в ранней G1 фазе, с помощью NAC приводило к нарушению
прогрессии клеточного цикла, увеличению количества клеток в G1 фазе и
снижению количества клеток в S фазе. Нарушению прогрессии клеточного
цикла предшествовало уменьшение уровня циклина D1, увеличение уровня
р27, ингибитора Cdk4/6, и дефосфорилирование рRb, что указывало на
зависимость уровня циклина D1, р27 и рRb от состояния редокс-статуса.
После удаления NAC из среды наблюдали кратковременный скачок
31
прооксидантного уровня (Н2О2) и возобновление прогрессии клеточного
цикла [170]. Полученные данные указывали на необходимость присутствия
небольших количеств Н2О2 для перехода клеток из G1 в S фазу клеточного
цикла.
Подобно действию NAC, усиление экспрессии каталазы или GPx,
катализаторов разложения Н2О2, приводило к снижению внутриклеточного
уровня Н2О2 и остановке клеточного цикла в G1 фазе [63, 171, 172].
Обработка Her1 фибробластов с помощью Н2О2, наоборот, повышала уровень
циклина D1, что предположительно было результатом ингибирования
деградации циклина D1 [173]. Несмотря на то, что повышенный уровень GSH
ингибировал прогрессию клеточного цикла, полное удаление тиолов из
среды также препятствовало переходу клеток в S фазу. Удаление тиолов из
среды
культивирования
лимфоцитов,
препятствовало
экспрессии
и
фосфорилированию рRb под действием IL-2. Добавление GSH, NAC и 2меркаптоэтанола обращало этот эффект [174]. Из полученных данных можно
сделать вывод о том, что хотя небольшое увеличение уровня АФК
необходимо для активации рRb, чрезмерное повышение прооксидантного
уровня приводит к нарушению клеточного цикла.
Дальнейшее исследование роли GSH и АФК в регуляции клеточного
цикла выявило, что снижению экспрессии циклина D1 в клетках,
обработанных NAC, предшествовало повышение уровня О2•-. Инкубация
клеток с Tiron, ловушкой для О2•-, препятствовало нарушению прогрессии
клеточного цикла под действием NAC, указывая на то, что О2•- может
оказывать ингибирующее действие на экспрессию циклина D1 [175]. Однако,
снижение уровня О2•- с помощью темпола, препятствовало накоплению
циклина А, регулятора G1/S перехода, и прогрессии через S фазу, приводя к
остановке клеточного цикла в поздней G1 фазе. Удаление темпола из среды
способствовало восстановлению прогрессии клеточного цикла. Эти данные
указывают на необходимость присутствия О2•- для перехода клетки из G1 в S
32
фазу. Повышенная экспрессия Emi1, ингибитора комплекса APC/Cdh1,
отменяла эффект темпола. Клетки экспрессирующие Emi1, демонстрировали
уровень циклина А сравнимый с контролем и отсутствие блока в G1 фазе. К
сходным результатам приводило применение ингибиторов 26S протеасомы.
Как было отмечено выше убиквитинирование циклина А с помощью
комплекса APC/Cdh1 в течение G1 фазы препятствует переходу в S фазу.
Исходя из имеющихся данных можно предположить, что О2•- играет важную
роль в ингибировании APC/Cdh1 и поэтому его присутствие необходимо для
перехода в S фазу. Таким образом, было показано, что повышение уровня
АФК при прогрессии из G1 в S необходимо для ингибирования деградации
циклина А под действием АРС [176]. Отсюда следует, что присутствие О2•- в
начале G1 фазы ингибирует экспрессию циклина D1 и приводит к остановке
клеточного цикла. Однако в конце G1 фазы, О2•- необходим для прогрессии из
G1 в S. Кажущаяся несогласованность является лишь еще одним
доказательством существования редокс-цикла внутри клеточного цикла, а
также подчеркивает сложность и важность редокс-модификаций для
регуляции пролиферации.
Еще один фермент S фазы, топоизомераза II, играет важную роль в
поддержании целостности ДНК, путем распутывания переплетенных в
процессе репликации сестринских хроматид и способствуя релаксации ДНК.
Goswami et al показали, что уровень мРНК топоизомеразы варьирует в
зависимости от фазы клеточного цикла достигая максимума в S фазе.
Дальнейшие исследования выявили, что экспрессия топоизомеразы II
регулируется за счет взаимодействия 3`-UTR последовательности мРНК с
редокс-чувствительными белками [32, 57].
Фосфатаза Cdc25С, важный регулятор прогрессии клеточного цикла
через G2 фазу, содержит в активном центре цистеин (Cys377) и поэтому
чувствителен к изменениям редокс-статуса. Образование связи между Cys377
и Cys330 приводит к усилению связывания Cdc25С с белком 14-3-3, что
33
препятствует перемещению Cdc25С в ядро и активации комплекса циклин
В1/Cdk1 (см. Рис. 1.4) [138, 177]. В независимом исследовании было
показано, что обработка клеток Н2О2 приводит к инактивации Cdc25C, в то
время как белок мутантный по Cys377 и Cys330 был нечувствителен к
действию Н2О2. [177, 178]. Как было отмечено выше, уровень GSH
возрастает по мере приближения к митозу [148], это вероятно способствует
переходу Cdc25C в более стабильное состояние и активации циклин В/Cdk1.
Рисунок
1.4.
Редокс-регуляция
активности Cdc25C фосфатазы.
Из [177] c изменениями. См.
пояснения в тескте.
Chang et al. показали, что в G2 фазе активная CDK1 фосфорилирует
пероксиредоксин I , внутриклеточный фермент катализирующий деградацию
Н2О2, ингибируя его активность. Накопление Н2О2, в результате снижения
активности
пероксиредоксина
I,
представляется
необходимым
для
прогрессии через G2 фазу в М [179]. Как было отмечено выше, активность
MnСОД снижается по мере прогрессии клеточного цикла от G1 к М фазе,
способствуя повышению уровня АФК. Повышение экспрессии MnСОД в
клетках карцином усиливало формирование индуцированного радиацией G2
блока, указывая на то, что высокий уровень MnСОД препятствует
прогрессии
клеток
через
G2
фазу
[180].
Другой
внутриклеточный
антиоксидант, витамин С, также был способен индуцировать G2 блок в
клетках карциномы HeLa и глиобластомы T98G человека. Индукция G2 блока
под действием витамина С сопровождалась усилением экспрессии циклина
34
В1 и снижением уровня активного Cdc25С, активатора комплекса циклин
В1/CDK1 [181].
Присутствие редокс-чувствительных цистеинов в молекулах убиквитинактивирующего (Е1) и убиквитин-коньюгирующего (Е2) предполагают
существование редокс-регуляции процессов деградации белка. Повышение
уровня восстановленного глутатиона (GSH) ингибировало активность Е1 и
Е2 [182], а также 20S субъединицу протеасомы, препятствуя протеолизу
белка [183]. Н2О2, наоборот, стимулировал процессы убиквитинирования, за
счет усиления экспрессии E2 и убиквитин-лигазы (Е3) [184].
Резюмируя сказанное выше, важно подчеркнуть следующее: прогрессия
клеточного цикла сопровождается не только изменениями уровня циклинов и
активности CDK, но и колебаниями соотношения про- и антиоксидантов
внутри клетки (окислительно-восстановительного баланса). Исходя из этого,
было предположено существование т.н. редокс-цикла внутри клеточного
цикла и тесно с ним взаимосвязанного. Пертурбации внутриклеточного
окислительно-восстановительного баланса ведут к нарушениям прогрессии
клеточного цикла, указывая на возможность регуляции пролиферации через
модуляцию редокс-статуса клетки.
РАЗДЕЛ 1.3. Современное состояние знаний о противоопухолевом
эффекте короткоцепочечных пептидов
1.3.1. Карнозин и его производные. Общая характеристика
Карнозин представляет собой природный короткоцепочечный пептид,
состоящий из двух аминокислот – β-аланина и L-гистидина. В организме
человека карнозин представлен во многих тканях (мышцы, мозг, печень,
ткани глаза, желудок, почки, легочная ткань), достигая наиболее высокой
концентрации в скелетных мышцах (~ 20 мM) и в обонятельных луковицах
головного мозга (~ 2.5 мM) [1, 2].
35
Карнозин синтезируется с помощью фермента карнозин-синтетазы [3-6],
которая катализирует образование пептидной связи между β-аланином и Lгистидином, используя энергию АТФ и ионы Mg2+:
β-аланин + L-гистидин + АТФ = карнозин + Pi + АДФ [7]
Карнозин-синтетаза относится к семейству ATP-grasp ферментов,
катализирующих
АТФ-зависимое
присоединение
карбоксила
одной
молекулы к амино- или тиоловой группе другой с образованием АДФ и
органического фосфата (Pi) [185]. Ген карнозин-синтетазы располагается в
11q13 хромосоме человека и экспрессируется главным образом в мозге и
мышцах [7]. Bauer et al. показали, что карнозин и его производные
синтезируется в основном клетками глии. Интересно, что опухолевые клетки,
глиомы С6, тоже активно синтезировали карнозин и родственные соединения
[186]. Синтез карнозина в нейронах обнаружен не был, однако нейроны
были способны поглощать карнозин из среды и метаболизировать его [187190]. Интересно отметить, что усиление синтеза карнозина сопровождалось
дифференцировкой глиальных клеток, что оценивалось по усилению
иммуноокрашивания
антителами
к
маркерам
дифференциации
[189].
Сходный эффект наблюдали при обработке скелетных мышц новорожденных
цыплят. Усиление синтеза карнозина замедляло скорость деления клеток и
способствовало превращению миобластов в миотубулы [191, 192].
В организме человека существует два фермента, способных расщеплять
карнозин на составные аминокислоты: сывороточная (CN1) [193] и
тканевая/цитозольная (CN2) карнозиназы [194, 195]. CN1 экспрессируется
главным
образом
в
мозге,
и
в
меньшей
степени
в
печени.
Иммуногистохимическое исследование выявило присутствие CN1 в цитозоле
пирамидальных нейронов гиппокампа, а также в больших и малых нейронах
коры больших полушарий. Цитозольная фракция клеток, секретирующих
CN1, не деградировала карнозин, указывая на то, что CN1 относится к
секретируемым белкам и активен только после секреции [9]. В отличие от
36
CN1, CN2 экспрессируется повсеместно в тканях человека и является
цитозольным ферментом. Больше всего этого фермента содержится в почках
и печени, в меньшем количестве обнаружен в мозге, селезенке и
поджелудочной железе, следовые количества – в легких, семенниках и
яичниках, отсутствует в сердце [9]. Ферменты характеризуются разными рНоптимумами работы. CN1 демонстрирует наибольшую активность при рН 7,5
– 8,5, CN2 характеризуется более узким оптимумом работы рН с максимумом
около рН 9,5. Таким образом, при физиологических pH карнозин
гидролизуется преимущественно с помощью CN1 [9]. Интересно отметить,
что
экспрессия
CN1
отсутствует
в
пренатальном
периоде
и
у
новорожденных, что указывает на усиление экспрессии CN1 с возрастом [9,
196]. Кроме того, у пожилых людей обнаружен более низкий уровень
гомокарнозина в сыворотке крови по сравнению с молодым поколением
[197].
У карнозина существует несколько природных производных, в том
числе: N-ацетил-карнозин (N-ацетил-β-аланил-L-гистидин), анзерин (βаланил-1-метил-L-гистидин) и гомокарнозин (у-амино-бутирил-L-гистидин)
(см.
Рис.
1.5).
Считается,
что
β-аланил-содержащие
дипептиды
преимущественно располагаются в скелетных мышцах, в то время как
дипептиды содержащие γ-амино-масленную кислоту (ГАМК) типичны для
центральной нервной системы [7]. Ацетилированная форма карнозина
присутствует в сердечной мышце и в мозге [198]. Предполагается, что
образование ацетилкарнозина происходит за счет ацетилирования карнозина,
однако информация о ферментах, катализирующих данную реакцию пока
отсутствует. Гомокарнозин (0,3-1,5 мМ [199]) синтезируется в мозге из
ГАМК и L-гистидина с помощью карнозин-синтетазы. Однако скорость
синтеза гомокарнозина при прочих равных условиях гораздо медленнее, чем
для карнозина [5, 7]. Синтез анзерина (до 40 мМ в мышцах птиц [200])
происходит в мышцах позвоночных животных путем метилирования
37
карнозина с помощью метилтрансферазы [201]. Анзерин не обнаружен в
организме человека. Расщепление производных карнозина осуществляет
сывороточная
карнозиназа
(CN1),
при
этом
скорость
гидролиза
гомокарнозина составляет 11% от скорости гидролиза карнозина или
анзерина [202].
Рисунок 1.5. Структура карнозина и его производных. Из [203]
изменениями.
В организме человека карнозин выполняет множество функций, среди
которых:
pH-буфер
в
мышцах
[10],
хелатор
металлов
переменной
валентности (Fe, Cu, Zn, Co) [11-13, 204, 205], нейротрансмиттер в
обонятельных луковицах [2, 6], антиоксидант [15-18, 206, 207], ингибитор
опухолевого роста [20, 21, 23, 208-210].
1.3.2. Антиоксидантные свойства карнозина и его производных
Карнозин
эффективно
препятствовал
окислению
2,5-
бис(гидроксиметил)фурана (BHMF) и N,N-диметил-4-нитрозоанилин (RNO)
под действием света в растворе, содержащем фотосенсибилизатор [211, 212].
BHMF и RNO представляют собой ловушки синглетного кислорода (1О2),
ингибирование окисления ловушек с помощью карнозина указывает на
способность карнозина взаимодействовать с
38
1
О2. Кроме того, карнозин
снижал интенсивность хемилюминесценции, индуцируемой синглетным
кислородом, образующимся в смеси Н2О2+NaClO, подтверждая способность
тушить 1О2 [213]. Интересно отметить, что при эквимолярных концентрациях
эффективность тушения
1
О2 карнозином была выше, чем у гистидина,
известной ловушки для 1О2 [211, 212, 214]. Более высокая эффективность
карнозина по сравнению с гистидином, возможно, связана с особенностями
внутримолекулярных взаимодействий (влияние β-аланина), что приводит к
большей реакционной способности гистидина в молекуле карнозина.
Методом синхронной регистрации светопоглощения при радиолизе
водного раствора карнозина было выявлено образование комплекса между
супероксидом и карнозином с частичным переносом заряда. Образование
комплекса приводило к снижению константы скорости дисмутации О2-• и
повышению его стабильности в водном растворе [14]. Способность
карнозина взаимодействовать с супероксид анионом была подтверждена в
независимой
работе
восстановлению
образованного
эффективности
Klebanov
et
нитро-голубого
в
смеси
тушения
al,
где
тетразолия
карнозин
под
ксантин+ксантиноксидаза
О2-•,
препятствовал
действием
Сравнение
[17].
образующегося
О2-•
в
смеси
глутатион+пероксидаза+люминол, выявило, что карнозин и гистидин
демонстрировали примерно одинаковую эффективность, в то время как βаланин был неактивен, что указывает на определяющую роль гистидина при
взаимодействии карнозина с супероксидом [215].
С помощью метода электронного парамагнитного резонанса (ЭПР) было
продемонстрировано, что добавление карнозина к смеси реакции Фентона
приводит к формированию продукта способного конкурировать со спиновой
ловушкой для OH• - 5,5-диметилпирролин-N-оксидом (DMPO) [16, 216].
Гистидин и гомокарнозин взаимодействовали с OH• менее эффективно, чем
карнозин. Образование комплексов OH• с β-аланином и ГАМК обнаружено
не было. Интересно отметить, что эффективность связывания OH• в смеси β39
аланин+гистидин была ниже, чем в присутствии карнозина, что еще раз
подтверждает важную роль внутримолекулярных взаимодействий для
антиоксидантного эффекта карнозина [16].
В ряде работ были продемонстрированы способности карнозина
взаимодействовать с продуктами ПОЛ, препятствуя распространению
окислительного повреждения. Карнозин сдерживал накопление малонового
альдегида,
образующегося
в
результате
окисления
фрагментов
саркоплазматического ретикулума, и способствовал сохранению функций
мембран [18]. Карнозин также снижал количество пероксильных радикалов,
образующихся в липосомах печени в результате инициации ПОЛ с помощью
азосоединений [15]. С использованием внеклеточных систем Zhou и Decker
наглядно продемонстрировали взаимодействие карнозина с ненасыщенными
альдегидами
(транс-2-гексеналь,
транс-2-ноненаль),
а
также
4-
гидроксиноненалем – опасным продуктом повреждающим ДНК [19, 217].
Гистидин и имидазол также демонстрировали защитное действие, в то время
как β-аланин и ГАМК не оказывали какого либо эффекта [15, 19].
Одним из проявлений антиоксидантных свойств карнозина является его
радиомодифицирующий эффект. Повреждающее действие ионизирующего
излучения
связано,
главным
образом,
с
развитием
мощнейшего
окислительного стресса в результате радиолиза воды. Пероральное введение
мышам карнозина в течение 20 суток перед облучением способствовало
повышению
выживаемости
животных
[218].
Радиомодифицирующее
действие карнозина было подтверждено с помощью метода эндогенных
селезеночных колоний. Было обнаружено увеличение эффективности
образования колоний гематопоэтическими стволовыми клетками из костного
мозга мышей, которым перед облучением вводили карнозин, по сравнению с
контрольными животными [219, 220].
40
1.3.3. Эффект карнозина и его производных на пролиферацию
нормальных и опухолевых клеток
Продолжительное
культивирование
нормальных
человеческих
фибробластов с карнозином (10 - 50 мМ) приводило к удлинению
продолжительности жизни клеток, что выражалось в увеличении количества
популяционных удвоений, т.н. предела Хейфлика [221]. Кроме того,
отмечали задержку развития старческого фенотипа в виде усиления
зернистости и потери вытянутой фибробластоподобной формы [22].
Добавление карнозина к клеткам долгое время культивируемым на среде без
карнозина приводило к обращению старческого фенотипа и способствовало
увеличению продолжительности их жизни в сравнении с контролем.
Удаление карнозина из среды нивелировало описанный эффект [222].
Карнозин
также
способствовал
увеличению
эффективности
посева
фибробластов. При посеве клеток в низких разведениях, в чашках
инкубируемых с карнозином образовывалось больше колоний, чем в
контрольных, что указывает на активацию пролиферативных процессов
фибробластов
под
действием
карнозина
[222].
Позже
Shao
et
al.
продемонстрировали замедление скорости укорачивания теломер и снижение
количества дефектов в ДНК теломер под действием карнозина [223].
Укорачивание теломер представляется одним из основных факторов
ограничивающий количество клеточных делений [224], замедление этого
процесса может быть одним из механизмов удлинения предела Хейфлика и
задержки формирования старческого фенотипа с помощью карнозина.
В 1986 году, японские ученые Nagai и Suda впервые описали эффект
карнозина на опухолевый клетки, который в корне отличался от действия
карнозина на нормальные клетки. Подкожные инъекции карнозина мышам
линии
ddY,
которым
предварительно
вживляли
клетки
саркомы,
способствовали снижению интенсивности пролиферации опухолевых клеток
и увеличивали выживаемость животных [20]. В независимом исследовании
41
Renner et al. на мышах с ксенографами HER2/neu NIH3T3 фибробластов
показали,
что
существенно
ежедневные
подавляют
внутрибрюшинные
пролиферацию
инъекции
злокачественных
карнозина
клеток
и
опухолевый рост. Снижение скорости пролиферации опухолевых клеток под
действием карнозина сопровождалось снижением синтеза АФК и активности
лактатдегидрогеназы (ЛДГ). Кроме того, в опухолях мышей, которым делали
инъекции карнозина карнозина было обнаружено меньшее количество
митозов, чем у контрольных животных [21]. Сходные изменения наблюдали
в первичной культуре клеток мультиформной глиобластомы (Glioblastoma
multiforme). Обработка клеток карнозином (20-50 мМ) в течение 4 дней
приводила к уменьшению внутриклеточного уровня АТФ и ЛДГ, а также к
снижению синтеза ДНК [208]. Ингибирование митохондриального дыхания с
помощью KCN в клетках обработанных карнозином не влияло на выработку
АТФ или выживаемость клеток. Обработка клеток глиобластомы оксаматом
– ингибитором ЛДГ – приводила к резкому снижению концентрации АТФ,
при этом карнозин приводил к дальнейшему снижению концентрации АТФ.
Исходя из полученных данных авторами был сделан вывод о том, что
карнозин индуцирует изменения на уровне гликолиза, которые приводят к
ингибированию клеточной пролиферации [225]. Holliday и McFarland
наглядно продемонстрировали избирательность ингибирующего эффекта
карнозина на рост опухолевых клеток [23, 226]. Добавление карнозина к
смеси опухолевых клеток (HeLa) и нормальных человеческих фибробластов
(MRC-5) приводило к выборочному уничтожению опухолевых HeLa клеток и
способствовало удлинению продолжительности жизни фибробластов [23].
Интересно
отметить,
что
действие
карнозина
на
две
активно
пролиферирующие культуры – эмбриональные стволовые (ЭС) клетки мыши
и иммортальные клетки эмбриональной терато-карциномы (ЭК) мыши также
было различно. Карнозин препятствовал росту злокачественных ЭК-клеток,
не затрагивая роста ЭС-клеток [226]. Полученные данные указывали на то,
что ни степень дифференцировки, ни скорость пролиферации клеток не
42
являются определяющими факторами избирательного действия карнозина на
опухолевые клетки.
Количественный анализ экспрессии белков в клетках глиобластомы в
контроле и после обработки карнозином выявил изменения в экспрессии 31
белка под действием карнозина, в том числе: Von Hippel–Lindau binding
protein 1 (VBP1), BCL2-associated athanogene 2 (BAG2), GrpE-like protein
chaperone (GrpEL), transaldolase 1 (TALDO), uroporphyrinogen decarboxylase
(UROD) и Obg-like ATPase 1 (OLA1) [227]. Интересно отметить, что VBP1,
BAG2 и GrpEL участвуют в регуляции активности Hypoxia-inducible factor 1α
(HIF-1α) [227-230], а BAG2 и GrpEL вовлечены в регуляцию активности
белков теплового шока (Heat shock protein 70, Hsp70) [231]. Оверэкспрессия
HIF-1α и Hsp70 часто способствует злокачественной трансформации [232,
233]. Приведенные данные указывают на возможное участие регуляторных
каскадов HIF-1α и Hsp70 в антипролиферативном эффекте карнозина.
В нашей лаборатории было показано, что карнозин замедляет рост
уровня фосфо-ERK1/2 и JNK в гранулярных клетках мозжечка в условиях
окислительного
стресса,
индуцированного
активацией
глутаматных
рецепторов [234]. Как было отмечено выше ERK1/2 представляет собой
редокс-чувствительную
МАР-киназу,
регулирующую
множество
внутриклеточных функций, в том числе и пролиферативные процессы. Было
показано, что ингибирование образования Н2О2 препятствует активации
ERK1/2 и развитию пролиферативного ответа [235]. Таким образом,
понижение уровня АФК под действием карнозина представляется одним из
механизмов подавления активации ЕRK1/2 [234, 236]. Повышенный уровень
ERK1/2
часто
Ингибирование
встречается
роста
при
ERK1/2
онкологических
может
быть
заболеваниях
одним
из
[105].
механизмов
антипролиферативного эффекта карнозина.
Исследование противоопухолевого эффекта производных карнозина
(анзерина, гомокарнозина и D-карнозина) выявило, что только анзерин
43
способен ингибировать рост трансформированных клеток. Также было
обнаружено, при равных концентрациях (20 мМ) β-аланин не оказывал
какого либо влияния на опухолевые клетки, в то время как гистидин убивал
все клетки (нормальные и опухолевые) [23]. Полученные данные явно
указывают
на
определяющую
роль
гистидина
в
проявлении
противоопухолевого эффекта карнозина.
1.3.4. Пинеалон. Общая характеристика и свойства
В настоящее время установлена роль регуляторных короткоцепочечных
пептидов в формировании адаптационного ответа организма на стресс и
нарушения гомеостаза [237]. Будучи эндогенными компонентами живой
клетки, пептидные биорегуляторы обладают разнообразным биологическим
действием, они эффективны в низких дозах, не вызывают побочных
эффектов [238]. Однако их терапевтическое применение ограничено
проницаемостью через гемато-энцефалический барьер (ГЭБ) и относительно
быстрой скоростью распада. Преодолеть эти проблемы можно путем синтеза
короткоцепочечных
аналогов
нейропептидов,
сохраняющих
их
специфическую активность [239-243].
Пинеалон представляет собой синтетический трипептид состоящий из
трех аминокислот глутаминовой кислоты, аспарагиновой кислоты и аргинина
(Glu-Asp-Arg), синтезированный на основе анализа экстракта коры головного
мозга крупного рогатого скота (Рис. 1.6). Последовательность Glu-Asp-Arg
была выбрана как наиболее часто встречающаяся в "активных участках"
наиболее
функционально-значимых
в
своей
группе
полипептидов,
содержащихся в животных экстрактах.
Пинеалон демонстрирует эффективные антиоксидантные свойства.
Пинеалон
усиливал
устойчивость
экспериментальных
животных
к
пренатальной и острой сублетальной гипобарической гипоксии. Введение
пинеалона крысам чувствительным к гипоксии усиливало активность
антиоксидантных ферментов – СОД и GPx. В культуре гранулярных клеток
44
мозжечка
пинеалон
снижал
уровень
АФК
и
клеточную
гибель,
индуцированные активацией глутаматных рецепторов NMDA-класса [244,
245]. На модели пренатальной гипергомоцистеинемии было показано, что
инъекции пинеалона самкам улучшают когнитивные способности потомства
и способствуют развитию устойчивости к окислительному стрессу [246].
Кроме
того,
пинеалон
препятствовал
увеличению
уровня
АФК
в
гранулярных клетках мозжечка крысы под действием гомоцистеина (ГЦ) и
затормаживал активацию ERK1/2 [247]. Недавно были получены данные о
возможном участии пинеалона в эпигенетической регуляции. Пинеалон
проникал в ядро клетки, а также взаимодействовал с некоторыми
промоторными последовательностями, в частности с одноцепочечной
oligo(dGC). Интересно, что предпочтительным местом связывания пинеалона
была
последовательность
CNG,
которая
также
является
местом
метилирования ДНК [248, 249]. Исходя из способностей пинеалона
модулировать внутриклеточный уровень АФК и связываться с ДНК можно
предположить, что пинеалон также способен участвовать в регуляции
пролиферации.
Рисунок 1.6. Химическая
структура
молекулы
пинеалона.
Подводя итог всему выше сказанному, можно заключить, что
антипролиферативный эффект карнозина известен давно, однако его
молекулярный механизм до сих пор непонятен. Понимание механизма
действия карнозина помогло бы расширить область применения природного
дипептида карнозин на практике, например в терапии опухолевых
заболеваний. На сегодняшний день накоплено множество сведений об
45
участии
про-
пролиферации.
и
антиоксидантов в
Поскольку,
регуляции
карнозин
процессов
демонстрирует
клеточной
эффективные
антиоксидантные свойства, было сделано предположение о том, что
ингибирующий эффект карнозина на пролиферацию опухолевых клеток
является следствием его антиоксидантной активности. Сравнительный
анализ действия карнозина и его производных на пролиферацию опухолевых
клеток помог бы определить функциональную нагрузку отдельных частей
молекулы
при
антипролиферативном
эффекте
и
пути
улучшения
эффективности антипролиферативных свойств карнозина.
ГЛАВА 2. МЕТОДЫ ИССЛЕДОВАНИЯ
2.1. Культуры клеток
В
работе
были
использованы
следующие
клеточные
линии:
феохромоцитома крысы (РС-12); карцинома горла и рта (FaDu, Cal27) и
молочной железы (MB231) человека; глиобластома человека (U-118-MG).
Клетки PC-12 культивировали в среде RPMI 1640 с 25 мМ HEPES и 24 мМ
бикарбоната натрия (ПанЭко, Россия), с добавлением 2 мМ глутамина
(ПанЭко, Россия), 20 мкг/мл гентамицина (ПанЭко, Россия) и 10%
эмбриональной телячьей сыворотки (ПанЭко, Россия). Клетки FaDu и Cal27
культивировали в среде DMEM (Gibco, США) с добавлением 10%
эмбриональной телячьей сыворотки (HyClone, США) и 100 ед/мл ПенСтреп
(Gibco, США). Клетки MB231 инкубировали в среде RPMI 1640 (Gibco,
США) с добавлением 10% эмбриональной телячьей сыворотки (HyClone,
США)
и
100
ед/мл
ПенСтреп
(Gibco,
США).
Клетки
U-118-MG
культивировали в смеси DMEM:F12 (1:1) (Gibco, США) с добавлением 15
мМ HEPES (Gibco, США), 1 мМ пирувата натрия (Gibco, США), 10 мкг/мл
инсулина (Sigma Aldrich, США), 5 нг/мл фактора роста фибробластов (Sigma
Aldrich, США), 15% эмбриональной телячьей сыворотки (HyClone, США) и
46
100 ед/мл ПенСтреп (Gibco, США). Клетки содержали в СО2-инкубаторе
(ShelLab, США) в присутствии 5% СО2, 98% влажности и 37˚С.
2.2. Исследуемые соединения
Карнозин (чистота 99%) был любезно предоставлен «Hamari Chem.,
Ltd», Осака, Япония. Гомокарнозин (чистота 99%) и анзерин (чистота 99%)
были приобретены, соответственно, в «Hamari Chem., Ltd» и «Yaizu
Suisankagaku Industry Co.,Ltd.» (чистота 99%). N-ацетилкарнозин был
синтезирован
рутинным
путем
в
Лаборатории
клинической
и
экспериментальной нейрохимии ФГБУ «НЦН» РАМН (чистота 98,7%,
определена с помощью HPLC). L-гистидин-β-аланин был синтезирован
рутинным путем в Исследовательском Институте Химического Разнообразия
(чистота 98%, определена с помощью HPLC). Пинеалон был предоставлен
Научно-производственным центром ревитализации и здоровья.
2.3. Исследование клеточной пролиферации
2.3.1. Время удвоения популяции
Время удвоения популяции (Тd) – это период времени, за который
происходит увеличение количества клеток в два раза. Для вычисления Тd
клетки высаживали в чашки Петри в небольших разведениях. Каждые два
дня клетки снимали с помощью трипсина (Gibco, США), считали их
количество с помощью Z1 Coulter Counter (Beckman Coulter, США) и строили
кривые роста (Рис. 2.1). Время удвоения популяции (Тd) рассчитывали на
экспоненциальном участке роста по формуле:
Тd=0.693t/ln(Nt/N0),
где t – время (дни), N0 – начальное количество клеток, Nt – количество клеток
ко дню t. Nt вычисляли по уравнению экспоненциальной линии тренда (Рис.
2.1).
47
Рисунок 2.1. Пример кривой роста с
экспоненциальной
уравнением
линией
линии
вычисления
тренда
тренда
времени
и
для
удвоения
популяции. x – время (д), y – количество
клеток ко дню х.
2.3.2. Эффективность посева и выживаемость клеток
Выживаемость клеток определяли по их способности формировать
колонии. Клетки рассеивали в низких разведениях в 60 мм чашки Петри, по
истечении 10 дней клетки фиксировали 2-4 мин в 70% этаноле, разведенном
на фосфатном буфере, окрашивали 10 мин с помощью раствора содержащего
0.05% бриллиантового синего G-250, 50% метанола, 5% уксусной кислоты,
45% воды. Далее подсчитывали количество колоний состоящих из 50 и более
клеток и вычисляли процент клеток образовавших колонии, эффективность
посева (ЭП), по формуле:
ЭП = (количество колоний/количество посаженных клеток) х 100.
Выживаемость рассчитывали как процентное соотношение ЭП в
клетках,
обработанных
карнозином
или
подвергнутых
действию
ионизирующего излучения, к ЭП клеток в контроле.
2.4. Проточная цитометрия
В данной работе все измерения проводили на проточном цитометре
FACSCalibur (BD, США), оснащенном ионным аргоновым лазером с длинной
волны 488 нм и двумя светофильтрами: 585/42 нм для красной
флуоресценции (PI) и 530/30 нм для зеленой флуоресценции (ФИТЦ, DCF).
48
2.4.1. Измерение уровня АФК
Уровень внутриклеточных АФК измеряли с помощью флуоресцентного
красителя 2,7-дихлордигидрофлуоресцеин-диацетата (DCFН2-DA) (Рис. 2.2).
Рисунок 2.2. Реакция превращения DCFH2-DA в DCF (из [250] с
изменениями). См. пояснения в тексте.
DCFН2-DA
представляет
собой
липофильное
соединение,
легко
проникающее через мембрану живых клеток. Внутриклеточные эстеразы
отщепляют ацетильные группы от DCFН2-DA, превращая его в 2,7дихлордигидрофлуоресцеин (DCFН2), для которого мембрана живой клетки
уже непроницаема. Под действием внутриклеточных АФК (в основном Н2О2)
происходит окисление DCFН2 с образованием флуоресцирующего продукта
2,7-дихлорфлуоресцеина (DCF, λex=504 нм, λem=529) [250]. Для измерения
уровня АФК клетки инкубировали с 100 мкМ DCFН2-DA (Biotium, США) в
течение 30 мин в темноте (37оС) и затем анализировали на проточном
49
цитометре. Данные обрабатывали в программе CellQuest Pro (BD, США) и
рассчитывали среднее значение интенсивности флуоресценции.
2.4.2. Определение доли мертвых клеток
Долю
мертвых
флуоресцентного
клеток
красителя
определяли
йодида
по
пропидия
интенсивности
(PI)
(Рис.
свечения
2.3.А).
PI
количественно связывается нуклеиновыми кислотами путем интеркаляции
между основаниями двойной цепи ДНК или РНК в соотношении: 1 молекула
красителя на 4-5 пар оснований [251, 252]. После связывания с нуклеиновой
кислотой флуоресценция PI усиливается в 20 - 30 раз и максимум испускания
смещается на 15 нм в УФ-сторону (максимум поглощения (λex) 535 нм,
максимум испускания (λem) – 617 нм) [253].
Рисунок 2.3. Флуоресцентные красители использованные в работе.
(А) Йодид пропидия (PI). (Б) 5-бромдезоксиуридин (БДУ).
Для определения доли мертвых клеток клетки инкубировали с 1 мкМ PI
(Invitrogen, Germany) в течение 3 мин в темноте при комнатной температуре
(tкомн) и затем анализировали на проточном цитометре. Данные обрабатывали
в программе Cell Quest Pro (BD, США) и рассчитывали среднее значение
интенсивности флуоресценции в Microsoft Exel (Microsoft, США).
2.4.3. Анализ клеточного цикла
50
Распределение
клеток
по
интенсивности
свечения
PI
фазам
(Рис.
клеточного
цикла
2.3.А).
связывается
PI
измеряли
с
по
ДНК
пропорционально его количеству, то есть, чем выше содержание ДНК, тем
интенсивнее флуоресценция PI. Количество ДНК в разных фазах клеточного
цикла неодинаково. G0 и G1 фазы характеризуются диплоидным набором
хромосом – 2n, где n – это количество хромосом, а 2 обозначает, что каждая
хромосома содержит только две хроматиды. Во время S фазы происходит
удвоение хроматид в каждой хромосоме, которое завершается к началу G2
фазы, поэтому набор хромосом клеток в G2 фазе составляет 4n. Клетки,
содержащие >2n, но <4n хромосом, относятся к S фазе (Рис. 2.4). Иногда G1
пику
предшествует
sub-G1
пик,
который
отражает
количество
апоптотических клеток. Фрагментация ДНК под действием эндонуклеаз при
апоптозе приводит к образованию большого количества коротких ДНК
фрагментов. Часть ДНК фрагментов теряется при подготовке проб, приводя к
снижению внутриклеточного количества ДНК, которое в апоптотических
клетках составляет <2n, что отражается в появлении sub-G1 пика.
Рисунок 2.4. Пример анализа клеточного
цикла
согласно
содержанию
ДНК.
См.
пояснения в тексте.
Для анализа клеточного цикла клетки фиксировали в 70% этаноле в течение
12 ч при - 4оС. Фиксированные клетки отмывали от этанола и инкубировали
30 мин с 1 мг/мл РНКазы (Invitrogen, Германия), затем 60 мин с 35 мкг/мл PI
51
(Invitrogen, Германия) в темноте при tкомн. Данные обрабатывали с помощью
программы ModFit LTTM (BD, США).
2.4.4. Двухпараметрический анализ клеточного цикла
Для двухпараметрического анализа клеточного цикла был использован
маркер клеток в S фазе – 5-бромдезоксиуридин (БДУ) (Рис. 2.3.Б) [170, 254].
БДУ представляет собой аналог нуклеотида тимидина и включается в ДНК
во время репликации, то есть в S фазе. Клетки инкубировали 30 мин с 5бромдезоксиуридином (БДУ) (37оС) и фиксировали в 70% этаноле в течение
12 ч при - 4оС. Фиксированные клетки инкубировали 30 мин в 0.4 мг/мл
пепсина, приготовленном на 2 N HCl, и нейтрализовали в 0.1 M боратном
буфере. Пробы центрифугировали (1500 об/мин, 5 мин при 4оС), осадок
инкубировали 1 ч с мышиными антителами к БДУ (1:10, BD, США) и 1 ч с
антимышиными
козьими
коньюгированными
инкубировали
флуоресцеин
антителами
с РНКазой
и
(1:10,
PI
(см.
BD,
изотиоцианат
США).
предыдущий
(ФИТЦ)-
Далее
клетки
пункт).
Данные
обрабатывали в программе FlowJo v8.8.7.
2.5. Иммуноблоттинг
Для выделения белков клетки разрушали с помощью ультразвука в
лизирующем буфере, содержащем фосфатный буфер (pH 7.8,) ингибитор
фосфатаз (PhosSTOP, Roche, США), коктейль ингибиторов протеаз (Sigma,
США), 2% NP-40 и ДНКазу (0,01 ед/мкл, Zimo Research Corp., США). Лизаты
центрифугировали, для Иммуноблоттинга использовали супернатант.
Белки разделяли в 12% полиакриламидном геле в присутствии
додецилсульфата натрия по Леммли [255] и переносили с помощью
полусухого электротранспорта на нитроцеллюлозную мембрану (BioRad,
США). Места неспецифического связывания 1 ч блокировали в 5% молоке.
Мембраны инкубировали с антителами против MnСОД (1:1000, Millipore,
США), циклина B1 (1:1000, BD, США), НАДФН (1:500, BD, США) и актина
52
(1:1000, Millipore, США). В качестве вторичных антител были использованы:
меченные пероксидазой хрена антимышиные овечьи антитела (1:5000, GE
Healthcare, США) и антикроличьи ослиные антитела (1:10,000, GE Healthcare,
США). Иммунореактивные полоски визуализировали с помощью набора
Pierce ECL 2 Western Blotting Substrate (Thermo Scientific, США) согласно
инструкции разработчика и детектировали хемилюминисценцию с помощью
Typhoon
FLA
7000
(General
Electric,
США).
Насыщенность
полос
анализировали в программе ImageJ (NIH, США). Уровень актина и НАДФН
использовали для коррекции загрузки белка.
2.6. Определение активности MnСОД
Белки выделяли по методу, описанному в предыдущем разделе (2.5), и
разделяли с помощью электрофореза в 12,5% полиакриламидном геле без
додецилсульфата по методу предложенному Weydert et al. [66, 256]. Гель
инкубировали 20 мин при tкомн в окрашивающей смеси, содержащей 2,43 мМ
нитросиний тетразолий, 2,8×10−5 M рибофлавин и 28 мМ ТЕМЕД, и
проявляли на свету до появления прозрачных полос. Метод основан на том,
что на свету рибофлавин образует супероксид, который превращает
нитросиний тетразолий из желтого в темно синий, что окрашивает гель.
Поскольку MnСОД катализирует реакцию дисмутации супероксида, то
MnСОД-содержащие полоски становятся прозрачными. Проявленный гель
сканировали с помощью Epson Perfection 4990 PHOTO (Epson, США) и
анализировали насыщенность полос в программе ImageJ (NIH, США).
2.7. Определение активности каталазы
Белок выделяли по методу, описанному выше (Раздел 2.5). Активность
каталазы определяли биохимическим путем на спектрофотометре по
скорости деградации пероксида водорода по методу, предложенному Aebi и
соавторами [257]. Принцип метода основан на том, что активность каталазы
рассчитывается исходя из скорости распада Н2О2. В кювете смешивали
53
известные количества образца и Н2О2 и измеряли оптическую плотность при
240 нМ. Поскольку каталаза разрушает Н2О2, то чем выше была активность
каталазы в образце, тем быстрее снижалась концентрация Н2О2 в кювете.
2.8. Полимеразная цепная реакция (ПЦР) в реальном времени
Клетки лизировали в тризоле и затем выделяли РНК с помощью набора
«Direct-zolTM RNA MiniPrep Kit» согласно инструкции производителя (Zimo
Research Corp., США). Комплементарную ДНК (кДНК) синтезировали с
помощью набора «High Capacity cDNA Reverse Transcription Kit» (Applied
Biosystems, США). Количественную ПЦР в режиме реального времени (45
циклов) проводили на приборе StepOne™ System (Applied Biosystems, США)
с использованием красителя SYBR Green и праймеров. Последовательности
праймеров представленных в Таблице 1. Данные анализировали в программе
StepOne™ Software v2.2 (Applied Biosystems, США) и Microsoft Excel
(Microsoft, США). Результаты представлены в виде относительных значений
экспрессии (2−ΔΔCt), где Ct - значение порогового цикла реакции.
2.9. Статистическая обработка результатов
Результаты измерений, проведенных в 3-5 параллельных пробах,
представлены в виде «среднее значение ± стандартное отклонение».
Статистическая
значимость
определяли
с
помощью
одномерного
дисперсионного анализа с последующим тестом на наименьшую значимую
разность
и
тестом
на
взвешенное
среднее
Тьюки.
Данные
тесты
используются для сравнения и определения разницы между и в пределах
групп данных в зависимости от значений среднего и среднеквадратических
ошибок для каждой переменной. Гомогенность дисперсии бралась в пределах
доверительного интервала в 95%. Результаты со значениями P<0.05
принимались как статистически значимые.
Таблица 1. Последовательности праймеров для ПЦР в реальном времени.
54
Ген
Последовательность (5’  3’)
Gene Bank No.
CCNB1
(циклин В1)
NM_031966.3
ACTB
(актин В)
NM_001101.3
CRNS1
(карнозинсинтетаза)
NM_001166222.1
CNDP1
(карнозиназа)
NM_032649
MnСОД
NM_000636.2
Размер
ампликона
(п.о.)
Forward:
TAGCACTGAAAATTCTGGATAATGGTGA
Reverse:
TTGATTTACCATGACTACATTCTTAGCCAG
Forward:
TCACCATTGGCAATGAGCGGTT
Reverse:
AGTTTCGTGGATGCCACAGGACT
Forward:
AAGCTGGAGGAGGAGGAGAGTGTC
Reverse:
CCTTGCTCAGCAGTGGCCTATCA
Forward:
CAGCAATCACTTACGGAACCCG
Resverse:
CCGAGAAGAGCAACCAGATCAGC
Forward:
TTGGCCAAGGGAGATGTTAC
Reverse:
AGTCACGTTTGATGGCTTCC
125
89
154
133
157
ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ
РАЗДЕЛ 3.1. Изучение характера действия карнозина и его
производных на опухолевые клетки
Антипролиферативный
эффект
карнозина
на
опухолевые
и
трансформированные клетки был продемонстрирован на ряде различных
моделей [20, 21, 23, 208], однако механизм регуляции клеточной
пролиферации с помощью карнозина до сих пор остается до конца не
исследованным.
3.1.1. Карнозин снижает количество клеток РС-12 в культуре
Для изучения влияния карнозина на пролиферацию опухолевых клеток,
была выбрана культура клеток феохромоцитомы крысы РС-12. Клетки
обрабатывали карнозином (10 - 50 мМ) в течение 48 ч и затем считали
количество клеток в каждой пробе с помощью камеры Горяева.
55
Рисунок 3.1.1. Карнозин снижает количество клеток РС-12 в
культуре. Клетки обрабатывали карнозином (10 - 50 мМ) в течение 48 ч. (А)
Общее количество клеток подсчитывали в камере Горяева. Звездочка
обозначает статистически значимое отличие от количества клеток в
контроле; n=3, p<0.05. (В) Процент погибших клеток определяли с помощью
проточного цитометра по количеству клеток меченных PI. Звездочка
обозначает
статистически
значимое
отличие
от
количества
некротических клеток в контроле; n=3, p<0.05.
На Рис. 3.1.1.А. представлены результаты подсчета количества клеток в
контроле и пробах обработанных карнозином. Как следует из Рис. 3.1.1.А,
инкубация с карнозином приводила к дозо-зависимому снижению количества
клеток РС-12. Количество клеток в пробах обработанных 10 мМ карнозина
составляло 69% от контроля, 25 мМ – 52%, 50 мМ – 45%. Уменьшение
количества клеток происходит в результате их гибели или при замедлении
пролиферации. Для того чтобы выяснить, усиливает ли карнозин гибель
клеток РС-12 клетки обрабатывали карнозином (10 – 50 мМ) в течение 48 ч,
окрашивали маркером погибших клеток, PI, и анализировали интенсивность
флуоресценции PI на проточном цитометре. Из Рис. 3.1.1.Б. видно, что
достоверных различий в количестве погибших клеток в контроле и пробах,
56
обработанных карнозином, обнаружено не было (Рис. I.1.Б). Исходя из
полученных данных, был сделан вывод о том, что снижение общего
количества клеток РС-12 под действием карнозина не связано с гибелью
клеток
и,
предположительно,
является
результатом
замедления
пролиферации.
3.1.2. Карнозин снижает уровень АФК в клетках культуры РС-12
Рисунок
3.1.2.
снижает
уровень
клетках
РС-12.
Карнозин
АФК
в
Клетки
инкубировали с 50 мМ карнозина
в течение 0,5 - 48 ч. Уровень
АФК измеряли на проточном
цитометре
по
степени
окисления DCFH2-DA. Звездочка
обозначает
статистически
значимое отличие от уровня
АФК в контроле; n=3, p<0.05.
Быстро пролиферирующие клетки часто характеризуются повышенным
содержанием АФК. Понижение уровня АФК в этих клетках с помощью
антиоксидантов приводит к снижению скорости пролиферации [26, 66, 149].
Принимая во внимание способность карнозина взаимодействовать с
некоторыми видами АФК и снижать их реакционную способность [15-19]
можно предположить, что замедление клеточной пролиферации под
действием карнозина является результатом его антиоксидантного эффекта.
Для того чтобы выяснить, сопровождается ли снижение количества клеток
РС-12 под действием карнозина изменениями уровня АФК, клетки РС-12
обрабатывали карнозином (50 мМ) в течение 0,5 - 48 ч. Уровень АФК
измеряли на проточном цитометре по степени окисления флуоресцентного
красителя DCFH2-DA, результаты измерения представлены на Рис. 3.1.2. Как
57
следует из Рис. 3.1.2, уже через 30 мин инкубации уровень АФК в пробах с
карнозином снижался на 50% по сравнению с контролем.
Пониженный
уровень АФК поддерживался на протяжении 24 ч и возвращался к
контрольному уровню через 48 ч. Поскольку снижение уровня АФК по
времени предшествовало снижению количества клеток (Рис. 3.1.1.Б), можно
предположить, что индуцированное карнозином замедление пролиферации
клеток РС-12 является результатом его антиоксидантного эффекта.
3.1.3. Карнозин и его производные индуцируют накопление клеток
РС-12 в S и G2/М фазах клеточного цикла
Пролиферация - это процесс увеличения количества клеток путем
деления. Период времени от образования новой клетки до ее деления на две
называется клеточным циклом. Клеточный цикл представляет собой
совокупность последовательных строго организованных переходов от G1
фазы к S, к G2 и М (митоз). Нарушение прогрессии клеточного цикла ведет к
его остановке (блоку) и препятствует дальнейшей пролиферации [81]. Для
того чтобы выяснить, связано ли индуцируемое карнозином снижение
количества клеток РС-12 с изменениями в прогрессии клеточного цикла,
клетки РС-12 обрабатывали карнозином (10 - 50 мМ) в течение 48 ч. По
истечении периода инкубации клетки фиксировали, окрашивали PI и с
помощью проточного цитометра измеряли количество клеток в G0/G1, S и
G2/М фазах по интенсивности флуоресценции PI. На Рис. 3.1.3.А.
представлен пример распределения клеток по фазам клеточного цикла в
контроле и после инкубации с 50 мМ карнозина. Результаты анализа
процентного распределения клеток по фазам клеточного цикла представлены
на Рис. 3.1.3.Б.
58
Рисунок 3.1.3. Карнозин индуцирует накопление клеток РС-12 в S и
G2/М-фазах клеточного цикла. Клетки инкубировали с карнозином (5 - 50
мМ) в течение 48 ч. Содержание ДНК измеряли на проточном цитометре
по интенсивности флуоресценции PI. (А) Пример распределения клеток по
фазам клеточного цикла в контроле и после инкубации с 50 мМ карнозина.
(Б) Процентное распределение клеток по фазам клеточного цикла в
контроле
и
после
обработки
карнозином.
Звездочка
обозначает
статистически значимое отличие от количества клеток в контроле; n=3,
p<0.05.
Как следует из Рис. 3.1.3.Б,
карнозин дозо-зависимо увеличивал
количество клеток в S и G2/M фазах клеточного цикла. Параллельно
происходило снижение количества клеток в G0/G1 фазе. Достоверно
отличимый от контроля результат был получен при концентрациях 25 - 50
мМ карнозина. В пробах, обработанных 50 мМ карнозина, число S и G2/M
клеток возрастало, соответственно, до 15% и 22%, по сравнению с 12% и 17%
в контроле. Количество G0/G1 клеток при этом снижалось до 62% по
сравнению с 71% в контроле. Важно отметить, что увеличения количества
апоптотических клеток под действием карнозина выявлено не было
(отсутствует sub-G1 пик, Рис. 3.1.3.А). Это еще раз подтверждает способность
59
карнозина воздействовать на процессы клеточной пролиферации, а не
гибели. Исходя из полученных данных, был сделан вывод о том, что
снижение количества клеток РС-12 под действием карнозина происходит в
результате замедления прогрессии клеточного цикла и накопления клеток в S
и G2/М фазах клеточного цикла.
У карнозина есть несколько природных производных, среди которых
наиболее изученными являются ацетил-карнозин (N-ацетил-β-аланил-Lгистидин) и анзерин (у-амино-бутирил-L-гистидин). Изучение структурнофункциональных взаимосвязей между карнозином и его производными в
отношении изменения прогрессии клеточного цикла клеток РС-12 может
помочь оценить степень вовлеченности отдельных частей молекулы в
исследуемый эффект карнозина. Для того чтобы сравнить, изменения в
прогрессии клеточного цикла под действием карнозина и его производных,
клетки обрабатывали 50 мМ карнозина, анзерина или ацетил-карнозина в
течение 48 ч и анализировали распределение клеток по фазам клеточного
цикла согласно содержанию ДНК (Рис. 3.1.4). Как видно из Рис. 3.1.4.А, все
исследованные вещества индуцировали накопление клеток в S и G2/М фазах,
однако наиболее выраженный эффект демонстрировал анзерин. В пробах
обработанных анзерином количество S и G2/М клеток возрастало,
соответственно, на 79% и 65%. А количество G0/G1 клеток уменьшалось на
21%. Наименее выраженный эффект демонстрировал ацетил-карнозин.
Основываясь на полученных данных, было сделано заключение о том, что
метилирование карнозина способствует усилению ингибирующего эффекта
на прогрессию клеточного цикла, в то время как ацетилирование карнозина
этот эффект ослабляет.
60
Рисунок 3.1.4. Анзерин и L-гистидин-β-аланин замедляют прогрессию
клеточного
цикла
эффективнее,
чем
карнозин.
Клетки
РС-12
инкубировали с карнозином и его производными в течение 48 ч. Содержание
ДНК измеряли на проточном цитометре по интенсивности флуоресценции
PI. Процентное распределение клеток по фазам клеточного цикла в
контроле и после инкубации с 50 мМ карнозина, анзерина, ацетил-карнозина
(А) или 1 - 10 мМ L-гистидин-β-аланина (Б). Звездочка обозначает
статистически значимое отличие от количества клеток в контроле; n=3,
p<0.05.
Синтетическое
производное
карнозина
L-гистидин-β-аланин,
представляющий собой последовательность аминокислот карнозина в
обратном порядке (т.н. «Карнозин наоборот») эффективнее, чем карнозин
индуцировал накопление клеток в S и G2/М фазах клеточного цикла (Рис.
3.1.4.Б). Клетки обрабатывали L-гистидин-β-аланином в концентрации 1 - 10
мМ в течении 48 ч, затем с помощью проточного цитометра изучали
распределение клеток по фазам клеточного цикла согласно содержанию
ДНК. Достоверно отличимый от контроля результат наблюдали при
концентрации 5 – 10 мМ, то есть в 5 раз ниже, чем для карнозина. Причем,
61
под действием 10 мМ L-гистидин-β-аланина количество S и G2/М клеток
возрастало на 80% и 60% соответственно, что превышало значения,
полученные под действием 50 мМ карнозина. В концентрации выше 10 мМ
L-гистидин-β-аланин проявлял токсическое действие, поскольку приводил к
гибели более 90% клеток. Таким образом, L-гистидин-β-аланин замедлял
прогрессию клеточного цикла эффективнее, чем карнозин, однако обладал
сильным цитотоксическим эффектом.
3.1.4. Изучение воздействия синтетического трипептида пинеалона
на клеточный цикл
Пинеалон представляет собой синтетический трипептид (Glu-Asp-Arg),
синтезированный на основе анализа экстракта коры головного мозга
крупного рогатого скота и проявляющий эффективные антиоксидантные
свойства [244-246]. Для изучения эффекта пинеалона на внутриклеточный
уровень АФК клетки РС-12 обрабатывали пинеалоном (50 – 500 нМ) в
течение 1 ч, а затем индуцировали окислительный стресс добавлением 1 мМ
пероксида водорода (Н2О2) на 20 мин. Уровень АФК измеряли с помощью
проточного цитометра по степени окисления флуоресцентного красителя
DCFH2-DA. Процент погибших клеток определяли по количеству клеток
окрашенных PI. Результаты измерения внутриклеточного уровня АФК и
процента погибших клеток представлены на Рис. 3.1.5. Как видно из Рис.
3.1.5.А. обработка клеток РС-12 пинеалоном 50 - 500 нМ приводила к
снижению внутриклеточного уровня АФК на 40% по сравнению с контролем.
Добавление Н2О2 индуцировало рост АФК. Уровень АФК в пробах
обработанных 1 мМ Н2О2 в 5 раз превышал значение в контроле. Инкубация
клеток с пинеалоном частично препятствовала увеличению уровня АФК под
действием Н2О2. Клетки, обработанные пинеалоном (50 - 500 нМ) перед
добавлением Н2О2, демонстрировали в 2 раза меньший уровень АФК, чем
клетки обработанные только Н2О2. Параллельно с повышением уровня АФК
под действием Н2О2 происходило увеличение клеточной гибели. В пробах
62
обработанных Н2О2 количество погибших клеток составляло 42,5% по
сравнению с 5% в контроле. Пинеалон (50 – 500 нМ) снижал количество
погибших клеток до 32,5 – 20% (Рис. 3.1.5.Б). Таким образом, было
продемонстрировано, что пинеалон снижает внутриклеточный уровень АФК,
предотвращает развитие окислительного стресса индуцированного действием
Н2О2 и защищает клетки РС-12 от гибели.
Рисунок 3.1.5. Пинеалон снижает уровень АФК в клетках РС-12 и
уменьшает клеточную гибель. Клетки обрабатывали пинеалоном (50 – 500
нМ), через 1 час добавляли 1 мМ пероксида водорода (Н2О2), инкубировали 20
мин и анализировали на проточном цитометре. (А) Уровень АФК в контроле
и в клетках обработанных пинеалоном и Н2О2 измеренный по степени
окисления флуоресцентного красителя DCFH2-DA. (Б) Процент погибших
клеток определенный по количеству клеток окрашенных PI. Звездочки
обозначают статистически значимое отличие от количества клеток в
контроле (*) или в присутствии 1 мМ Н2О2 (**); n=3, p<0.05.
Для того чтобы выяснить, способен ли пинеалон ввиду своих
антиоксидантных свойств модифицировать прогрессию клеточного цикла
клетки РС-12 обрабатывали пинеалоном (50 - 500 нМ) в течение 24 ч и с
63
помощью проточного цитометра анализировали распределение клеток по
фазам клеточного цикла согласно содержанию ДНК.
Рисунок
3.1.6.
Пинеалон
индуцирует накопление клеток в
S и G2/М фазах клеточного цикла.
Клетки обрабатывали пинеалоном
(50 - 500 нМ) в течение 24 часов.
Распределение клеток по фазам
клеточного цикла анализировали на
проточном
цитометре
по
интенсивности флуоресценции PI.
(А) Пример распределения клеток
по фазам клеточного цикла в
контроле
пинеалоном.
и
после
(В)
обработки
Процентное
распределение клеток по фазам
клеточного
обозначает
цикла.
Звездочка
статистически
значимое отличие от количества
клеток в контроле; n=3, p<0.05.
На Рис. 3.1.6.А. представлен пример распределения клеток по фазам
клеточного цикла в контроле и после обработки пинеалоном 100 нМ.
Процентное распределение клеток между G0/G1, S и G2/М фазами в контроле
и в пробах обработанных пинеалоном (50 – 500 нМ) показано на Рис. 3.1.6.Б.
Как следует из Рис. 3.1.6.Б, пинеалон приводил к дозо-зависимому
увеличению количества клеток в S и G2/М фазах и снижению количества
клеток в G0/G1 фазе. Распределение в контроле составляло: G0/G1 - 70%, S 14%, G2/М - 16%. Достоверно отличимый от контроля результат был получен
в клетках,
обработанных 100 нМ и 500 нМ пинеалона и составлял,
64
соответственно: G0/G1 - 55%, S - 21%, G2/М -24% и G0/G1 - 50%, S - 24%,
G2/М
-
26%.
Существенного
влияния
пинеалона
на
количество
апоптотических клеток выявлено не было (Рис. 3.1.6.Б). Исходя из
полученных, данных был сделано предположение о том, что пинеалон
проявляет антиоксидантные свойства в клетках РС-12, а также индуцирует
накопление клеток в G2/М фазе клеточного цикла.
Заключение I: Ингибирующее действие карнозина на пролиферацию
клеток феохромоцитомы крысы РС-12 сопровождалось модификацией
клеточного цикла и накоплением клеток в S и G2/М фазах. Метилирование
карнозина приводило к усилению формирования G2-блока, а ацетилирование
молекулы этот эффект ослабляло. L-гистидин-β-аланин (т.н. “карнозин
наоборот”) демонстрировал в 5 раз большую эффективность по сравнению с
карнозином,
однако
обладал
сильным
цитотоксическим
эффектом.
Синтетический трипептид пениалон также демонстрировал антиоксидантные
свойства и индуцировал накопление клеток в S и G2/М фазах. Однако
концентрации пинеалона были на несколько порядков ниже, чем для
карнозина. Поскольку изменениям в прогрессии клеточного цикла под
действием карнозина предшествовало снижение внутриклеточного уровня
АФК,
было
предположено,
что
существует
взаимосвязь
между
антипролиферативным и антиоксидантным эффектами карнозина.
РАЗДЕЛ 3.2. Изучение механизма регуляции клеточного цикла под
действием карнозина
Исследования механизма антипролиферативного эффекта карнозина
были продолжены с использованием культур опухолевых клеток человека,
так как именно они представляют собой первостепенную важность и имеют
перспективу применения полученных данных на практике.
65
3.2.1.
Карнозин избирательно ингибирует пролиферацию клеток
глиобластомы
Для
изучения
характера
влияния
карнозина
на
пролиферацию
опухолевых клеток человека были выбраны четыре клеточные культуры:
карцинома горла и рта (FaDu, Cal27), карцинома молочной железы (MB231),
глиобластома (U-118-MG). Клетки всех четырех культур обрабатывали
карнозином (40 мМ) и оставляли инкубироваться. Каждые два дня в течение
6 дней клетки подсчитывали и вычисляли время удвоения популяции (Td).
Результаты действия карнозина (40 мМ) на пролиферацию исследуемых
линий опухолевых клеток представлены на Рис. 3.2.1. Как следует из Рис.
3.2.1. карнозин приводил к увеличению Td всех исследованных клеточных
линий. Для интактных клеток Td составляло: 18 ч (FaDu), 16 ч (Cal27), 22 ч
(MB231) и 24 ч (U-118-MG). После инкубации с карнозином Td возрастало
до: 19 ч (FaDu), 18 ч (Cal27), 26 ч (MB231) и 32 ч (U-118-MG). Увеличение Td
под действием карнозина свидетельствовало о замедлении процессов
клеточной пролиферации. Наибольшее увеличение Td было отмечено в
клетках глиобластомы (Рис. 3.2.1).
Рисунок
3.2.1.
избирательно
Карнозин
ингибирует
пролиферацию клеток глиобластомы.
Клетки обрабатывали карнозином (40
мМ) Время удвоения популяций (Td)
вычисляли
по
формуле:
Td=0.693t/ln(Nt/N0), где t – время (дни),
N0 – начальное количество клеток, Nt –
количество клеток ко дню t.
66
Различия в эффективности действия карнозина на опухолевые клетки
могут быть связаны с различиями в экспрессии внутриклеточных ферментов,
отвечающих за синтез и разрушение карнозина. В организме человека
карнозин синтезируется с помощь фермента карнозинсинтетазы из β-аланина
и L-гистидина с использованием энергии молекулы АТФ [6, 258]. Гидролиз
карнозина на исходные аминокислоты осуществляется в основном с
помощью
сывороточной
карнозиназы
[9,
195].
Рисунок 3.2.2. Избирательность действия карнозина сочеталась с
различиями в уровнях мРНК карнозин-синтезирующих (А) и карнозинразрушающих (Б) ферментов в исследуемых клеточных культурах.
Результаты
ПЦР
в
реальном
времени.
Звездочка
обозначает
статистически значимое отличие от уровня мРНК в клетках U-118-MG;
n=3, p<0.05.
На Рис 3.2.2. представлены результаты измерения экспрессии генов
карнозин-синтетазы и карнозиназы в исследуемых клеточных линиях, с
помощью метода ПЦР в реальном времени. Из Рис. 3.2.2. видно, что в
клетках U-118-MG уровень мРНК карнозин-синтазы был в 3,5 - 5 раз ниже,
чем в клетках карцином (Рис. 3.2.2.А), а уровень мРНК карнозиназы,
наоборот, был 4 - 6 раз выше (Рис. 3.2.2.Б). На основании этих данных можно
предположить, что уровень эндогенного карнозина в клетках глиобластомы
67
изначально ниже, чем в клетках карцином. Изначально низкий уровень
карнозина в клетках глиобластомы, вероятно, обуславливает их большую
чувствительность к антипролиферативному эффекту карнозина, в то время
как высокий уровень карнозина в клетках карцином способствует развитию в
них толерантности рост-ингибирующему действию карнозина. Поскольку
наиболее выраженный антипролиферативный эффект карнозина был получен
на клетках глиобластомы человека U-118-MG, эти клетки были использованы
в дальнейших исследованиях.
Для
более
подробного
изучения
антипролифативного
действия
карнозина, клетки U-118-MG инкубировали в среде, в которую добавляли 20100 мМ карнозина и измеряли Td. На Рис. 3.2.3. представлены результаты
подробного
анализа
влияния
карнозина
на
пролиферацию
клеток
глиобластомы. Было выяснено, что карнозин приводит к дозо-зависимому
увеличению Td клеток U-118-MG, что согласовывалось с полученными ранее
данными (Рис. 3.2.1). Td в контроле составляло 35 ч, в присутствии 50 мМ
карнозина Td снижалось до 66 ч. Пролиферация была полностью подавлена в
пробах обработанных 80 мМ и 100 мМ карнозина (Рис. 3.2.3.А).
Ингибирующий эффект карнозина на пролиферацию клеток U-118-MG
был подтвержден результатами измерения способностей клеток формировать
колонии, то есть делиться. Результаты анализа выживаемости представлены
на Рис. 3.2.3.Б. Из полученных дынных видно, что инкубация клеток
глиобластомы с карнозином (50 - 100 мМ) в течение 24 ч приводила к
снижению
их
выживаемости.
Выживаемость
клеток
U-118-MG,
обработанных 100 мМ карнозина, снижалась до 60% по сравнению с
контролем (Рис. 3.2.3.Б).
68
Рисунок 3.2.3. Карнозин дозо-зависимо подавляет пролиферацию клеток
глиобластомы. (А) Кривые роста клеток U-118-MG в контроле и при
добавлении к среде культивирования 20 – 100 мМ карнозина. Td
рассчитывали,
как
описано
на
Рис.
3.2.1.
Звездочка
обозначает
статистически значимое отличие от количества клеток в контроле; n=3,
p<0.05. (Б) Выживаемость клеток оценивали по способности формировать
колонии. Звездочка обозначает статистически значимое отличие от
выживаемости в контроле; n=3, p<0.05.
Исходя из полученных данных, был сделан вывод о том, что карнозин
оказывает ингибирующее действие на пролиферацию клеток глиобластомы
(U-118-MG), карциномы горла и рта (FaDu, Cal27) и молочной железы
(MB231). Наиболее выраженный эффект наблюдали в клетках глиобластомы.
Избирательность действия карнозина может быть связана с пониженным
уровнем экспрессии карнозин-синтетазы и повышенным уровнем экспрессии
карнозиназы в клетках глиобластомы по сравнению с клетками карцином.
3.2.2. Карнозин снижает уровень АФК и индуцирует экспрессию
MnСОД
АФК
принимают
активное
участие
в
регуляции
клеточной
пролиферации. Изменения внутриклеточного уровня АФК часто приводит к
нарушениям пролиферативных процессов [24, 25, 67, 174]. Карнозин
69
демонстрирует эффективные антиоксидантные свойства, то есть способен
влиять на внутриклеточный уровень АФК [15, 207, 215, 259]. Для того чтобы
выяснить,
связано
ли
замедление
пролиферации
глиобластомы
под
действием карнозина с изменениями внутриклеточного уровня АФК, клетки
обрабатывали карнозином (50 - 100 мМ) в течение 24 ч и измеряли уровень
АФК
с
помощью
проточного
цитометра
по
степени
окисления
флуоресцентного красителя DCFH2-DA.
Рисунок 3.2.4. Карнозин снижает
уровень
АФК
в
клетках
U-118-MG.
Клетки обрабатывали карнозином (50 100 мМ) в течение 24 ч. Уровень АФК
измеряли, как
с описано на Рис. I.2.
Результаты представлены в виде среднего
значения флуоресценции, рассчитанного
относительно
обозначает
контроля.
статистически
Звездочка
значимое
отличие от уровня АФК в контроле; n=3,
p<0.05.
На Рис. 3.2.4. показано влияние карнозина на уровень АФК в клетках U118-MG. Как следует из Рис. 3.2.4, карнозин приводил к дозо-зависимому
понижению уровня АФК в клетках U-118-MG. Клетки, обработанные 50 –
100 мМ карнозина, содержали на 15 – 20% меньше АФК, чем клетки в
контроле.
Уровень внутриклеточных АФК контролируется антиоксидантной
системой клетки. Снижение уровня АФК возможно как в результате прямого
эффекта карнозина, так и при активации антиоксидантных ферментов под
действием карнозина. На сегодняшний день прямой антиоксидантный
эффект карнозина установлен и хорошо описан в литературе [14, 16, 18, 19].
Для изучения действия карнозина на антиоксидантные ферменты клеток U70
118-MG были выбраны два основных антиоксидантных фермента –
митохондриальная супероксиддисмутаза (MnСОД) и каталаза. Клетки
обрабатывали карнозином (50 – 100 мМ) в течение 24 ч, затем измеряли
активность и экспрессию MnСОД и каталазы.
Рисунок 3.2.5. Карнозин индуцирует экспрессию MnСОД в клетках
U-118-MG. Клетки обрабатывали карнозином (25 - 100 мМ) в течение 24 ч.
(А) Активность MnСОД, измеренная с помощью метода белкового
электрофореза в неденатурирующем геле. (Б, В) Уровень белка MnСОД
измеряли методом иммуноблоттинга, актин использовали для нормирования
количества белка. (Г) Уровень мРНК MnСОД, измеренный с помощью
метода ПЦР в реальном времени. Звездочка обозначает статистически
значимое отличие от уровня мРНК MnСОД в контроле; n=3, p<0.05.
На Рис. 3.2.5.А. представлены результаты измерения активности
MnСОД с помощью метода электрофореза в неденатурирующем геле. В
данной работе было впервые показано, что инкубация клеток глиобластомы с
71
карнозином усиливает активность MnСОД. Активность MnСОД в клетках
обработанных карнозином (50 - 100 мМ) была в 3,3 - 3,6 раз выше, чем в
контроле (Рис. 3.2.5.А). Отсутствие изменений в активности цитозольной
супероксиддисмутазы (CuZnСОД) (Рис. 3.2.5.А) позволяет предположить,
что антипролиферативный эффект карнозина связан со снижением уровня
АФК, генерируемых в митохондриях. С помощью метода иммуноблоттинга
было выявлено, что повышение активности MnСОД сопровождалось
увеличением уровня белка MnСОД. Клетки обработанные карнозином (50 и
100 мМ) содержали в 1,4 - 1,6 раз больше белка MnСОД, чем клетки в
контроле (Рис. 3.2.5.Б). Исследование временной зависимости увеличения
уровня MnСОД под действием карнозина выявило, что добавление карнозина
в концентрации 50 мМ индуцирует увеличение уровня белка MnСОД через
16 ч (Рис. 3.2.5.В). Измерение уровня мРНК MnСОД методом ПЦР в
реальном времени показало, что увеличение количества белка MnСОД
сопровождалось увеличением мРНК MnСОД. Уровень мРНК MnСОД в
клетках обработанных 50 и 100 мМ карнозина был в 1,5 - 2,5 раза выше, чем
в контроле (Рис. 3.2.5.Г).
На Рис. 3.2.6. представлены результаты исследования действия
карнозина на активность и экспрессию каталазы. Активность каталазы
измеряли с помощью биохимического метода на спектрофотометре. Уровень
белка определяли с помощью метода иммуноблоттинга. Активность каталазы
в контроле составляла 4 мк ед/мг. Клетки обработанные 50 мМ карнозина не
демонстрировали каких-либо изменений активности каталазы по сравнению
с контролем. В то время как в клетках обработанных 100 мМ карнозина
активность каталазы снижалась до 1,5 мк ед/мг (Рис. 3.2.6.А). Снижение
активности
каталазы
сопровождалось
соответствующим
уменьшением
уровня белка. В клетках обработанных 100 мМ карнозина уровень белка
каталазы составлял 60% от контрольного уровня (Рис. 3.2.6).
Снижение
активности каталазы часто приводит к росту прооксидантного уровня,
72
главным образом Н2О2. Поскольку роста Н2О2 под действием карнозина не
происходило, было предположено, что исходное содержание каталазы в
клетках U-118-MG настолько мало, что снижение ее активности не оказывает
значительного влияния на антиоксидантный эффект карнозина.
Рисунок 3.2.6. Карнозин ингибирует экспрессию каталазы в клетках
U-118-MG. Клетки обрабатывали карнозином (50 - 100 мМ) в течение 24 ч.
(А) Активность каталазы измеряли с помощью биохимического метода.
Звездочка обозначает статистически значимое отличие от активности
каталазы в контроле; n=3, p<0.05. (Б) Уровень белка каталазы измеряли
методом
иммуноблоттинга,
актин
использовали
для
нормирования
количества белка.
Исходя из полученных данных, был сделан вывод о том, что карнозин
проявляет антиоксидантные свойства в клетках глиобластомы U-118-MG.
Карнозин снижал внутриклеточный уровень АФК и усиливал активность и
экспрессию антиоксидантного фермента MnСОД.
3.2.3.
Карнозин индуцирует G2 блок и усиливает экспрессию
циклина В1
Для того чтобы выяснить, является ли антипролиферативный эффект
карнозина результатом изменений в прогрессии клеточного цикла, клетки
73
U-118-MG обрабатывали карнозином (20 – 100 мМ) в течение 24 ч и
измеряли
количество
клеток
в
G 1,
S
и
G2
фазах
с
двухпараметрического
помощью
анализа.
Рисунок 3.2.7. Карнозин индуцирует G2 блок в клетках U-118-MG.
Клетки инкубировали с карнозином (20 – 100 мМ) в течение 24 ч, метили
БДУ и измеряли количество БДУ-положительных (S фаза) и БДУотрицательных (G1 и G2 фазы) клеток с помощью проточного цитометра.
(А) Пример распределения клеток U-118-MG по фазам клеточного цикла. (Б)
Процентное распределение клеток по фазам клеточного цикла в контроле и
после инкубации с карнозином. Звездочка обозначает статистически
значимое отличие от количества клеток в контроле; n=3, p<0.05.
На Рис. 3.2.7.А. представлен типичный пример распределения клеток U118-MG по фазам клеточного цикла в контроле и после инкубации с
карнозином. Как видно из Рис. 3.2.7.Б. инкубация с карнозином (20 - 100 мМ)
приводила к дозо-зависимому увеличению количества клеток в G2 фазе и
сопровождалась уменьшением числа клеток в S фазе. Распределение в
контроле составляло: G1 - 39%, S - 44% и G2 - 17% клеток. Карнозин в
концентрации от 20 до 50 мМ не приводил к значительным изменениям в
распределении клеток. Достоверно отличимый от контроля результат был
получен в пробах обработанных карнозином в концентрации 80 - 100 мМ.
74
Количество клеток в G2 фазе увеличивалось до 39% относительно 17% в
контроле, количество клеток в S фазе уменьшалось до 22% относительно
44% в контроле (Рис. 3.2.7.Б). Таким образом, было показано, что инкубация
клеток U-118-MG с карнозином приводит к формированию G2 блока в
прогрессии клеточного цикла. Исходя из полученных данных, был сделан
вывод о том, что карнозин ингибирует пролиферацию клеток глиобластомы
за счет модификации прогрессии клеточного цикла через G2 фазу.
Прохождение клетки через фазы клеточного цикла регулируется
последовательной
экспрессией
циклинов.
Циклин
В1
специфически
экспрессируется во время G2 фазы [81]. Было показано, что индукция G2
блока в присутствии некоторых антиоксидантов, например, витамина С,
сопровождается усилением экспрессии циклина В1 [181]. Для того чтобы
определить, сопровождается ли индуцированное карнозином накопление
клеток в G2 фазе с изменениями экспрессии циклина В1, клетки U-118-MG
обрабатывали 50 и 100 мМ карнозина в течение 24 ч и измеряли уровень
белка и мРНК циклина В1. Результаты иммуноблоттинга и ПЦР в реальном
времени представлены на Рис. 3.2.8. Было показано, что инкубация с
карнозином (50 и 100 мМ) индуцирует увеличение уровня белка циклина В1
в 2,5 – 4 раза (Рис. 3.2.8.А). Интересно отметить, что увеличение уровня
белка циклина В1 по времени совпадало с ростом уровня MnСОД и
происходило спустя 16 часов после добавления 50 мМ карнозина (Рис. 3.2.8.Б
и 3.2.5.В). Данное наблюдение позволяет предположить существование
взаимосвязи между антипролиферативным и антиоксидантным эффектами
карнозина. Повышение уровня белка циклина В1 было сопряжено с
небольшим увеличением уровня мРНК. В клетках обработанных 50 и 100 мМ
карнозина уровень мРНК циклина В1 в 1,25 - 2 раза превышал значение в
контроле (Рис. 3.2.8.В). Исходя из полученных данных, можно сделать вывод
о том, что антипролиферативный эффект карнозина является следствием
75
активации экспрессии циклина В1 и остановки клеток в G2 фазе клеточного
цикла.
Рисунок 3.2.8. Карнозин усиливает экспрессию циклина B1 в клетках
U-118-MG. Клетки инкубировали с карнозином (50 - 100 мМ) в течение 24 ч.
(А, Б) Уровень белка циклина В1 измеряли методом иммуноблоттинга,
актин и НАДФН использовали для нормирования количества белка. (В)
Уровень мРНК циклина В1 измеряли с помощью метода ПЦР в реальном
времени. Звездочка обозначает статистически значимое отличие от уровня
мРНК циклина В1 в контроле; n=3, p<0.05.
Заключение II: Карнозин ингибировал пролиферацию опухолевых
клеток человека, что согласовывалось с данными, полученными на клетках
РС-12. Наиболее выраженный ингибирующий эффект карнозина наблюдали
в культуре клеток глиобластомы, что возможно было связано с изначально
низким уровнем эндогенного карнозина в этих клетках. В данной работе
было впервые показано, что замедление пролиферации клеток глиобластомы
под действием карнозина сопровождается снижением внутриклеточного
уровня АФК, усилением экспрессии MnСОД и циклина В1, а также
накоплением клеток в G2 фазе клеточного цикла. Полученные данные
76
подкрепляют наше предположение о том, что карнозин ингибирует рост
опухолевых клеток за счет усиления антиоксидантной защиты клетки и
модификации клеточного цикла.
РАЗДЕЛ 3.3. Сравнение антипролиферативного эффекта карнозина
с действием его производных
У карнозина существует несколько природных производных, среди них:
ацетил-карнозин
(N-ацетил-β-аланил-L-гистидин),
метил-L-гистидин),
оценки
гомокарнозин
вовлеченности
анзерин
(β-аланил-3-
(у-амино-бутирил-L-гистидин).
отдельных
групп
молекулы
Для
карнозина
в
антипролиферативный эффект, действие карнозина сравнивали с эффектом
его производных. К среде культивирования клеток U-118-MG добавляли
исследуемые соединения в концентрации 40 мМ и оставляли на инкубацию.
Каждые два дня в течение 6 дней клетки считали и вычисляли Td, результаты
подсчета представлены на Рис. 3.3.1.
Рисунок
ингибирует
3.3.1.
Анзерин
пролиферацию
клеток
глиобластомы
U-118-MG
эффективнее, чем другие производные
карнозина. К среде культивирования
добавляли дипептиды в концентрации
40 мМ и оставляли инкубироваться. Td
рассчитывали как описано на Рис 3.2.1.
Звездочка обозначает статистически
значимое отличие от Td в контроле;
n=3, p<0.05.
Как следует из Рис. 3.3.1. все исследованные дипептиды приводили к
удлинению
Td,
однако
в
разной
степени,
что
свидетельствует
о
существовании взаимосвязи между структурой дипептида и эффективностью
77
ингибирования
пролиферации.
Ацетил-карнозин
обладал
наименее
выраженным эффектом, увеличивая Td клеток глиобластомы лишь на 3 ч по
сравнению с контролем. Td клеток обработанных гомокарнозином и
карнозином было примерно одинаковым и превышало контрольное значение
на 6 - 7,5 ч. Анзерин ингибировал пролиферацию сильнее, чем остальные
соединения. Td клеток обработанных анзерином было на 12 ч длиннее по
сравнению с контролем. Полученные результаты свидетельствуют о
существовании взаимосвязи между структурой дипептида и эффективностью
ингибирования пролиферации. Метилирование молекулы карнозина в
положении 1N имидазольного кольца (анзерин) повышает эффективность
действия молекулы на процессы клеточной пролиферации. Ацетилирование
молекулы
по
свободной
β-аминогруппе карнозина (ацетил-карнозин)
приводит к снижению ее эффективности.
Для того чтобы выяснить, связано ли антипролиферативное действие
анзерина
с
изменениями
в
прогрессии
клеточного
цикла,
клетки
обрабатывали 50 – 100 мМ анзерина в течение 24 ч, метили БДУ и измеряли
распределение клеток по фазам клеточного цикла на проточном цитометре.
На Рис. 3.3.2. продемонстрировано действие 50 – 100 мМ анзерина на
прогрессию клеточного цикла клеток U-118-MG. Пример распределения
клеток по фазам клеточного цикла в контроле и после инкубации с
анзерином показан на Рис. 3.3.2.А. результаты анализа процентного
распределения представлены на Рис. 3.3.2.Б. Как следует из Рис. 3.3.2.Б,
инкубация с анзерином приводила к перераспределению клеток по фазам
клеточного цикла. Распределение в контроле составляло: 38% - G1 фаза, 50%
- S фаза и 12% - G2 фаза, в пробах обработанных 100 мМ анзерина: 48% - G1
фаза, 27% - S фаза и 25% - G2 фаза. Клетки, обработанные 50 мМ анзерина,
не демонстрировали каких либо отличий прогрессии клеточного цикла по
сравнению с контролем. Кроме того, было отмечено достоверное увеличение
количества клеток в G1 фазе, с 38% в контроле до 48% в присутствии 100 мМ
78
анзерина, что, возможно, является причиной более сильного эффекта
анзерина по сравнению с карнозином. Исходя из полученных данных, был
сделан вывод о том, что характер действия анзерина на клеточный цикл
сходен с эффектом карнозина. Дополнительное понижение клеток в G1 фазе
под действием анзерина, возможно, является причиной более сильного
эффекта анзерина по сравнению с карнозином.
Рисунок 3.3.2. Анзерин индуцирует G2 блок в клетках U-118-MG.
Клетки обрабатывали анзерином (50 - 100 мМ) в течение 24 ч, метили БДУ
и
анализировали
с
помощью
проточного
цитометра.
(А)
Пример
распределения БДУ-положительных (S-фаза) и БДУ-отрицательных (G1 и G2
фазы) клеток в контроле и после инкубации с анзерином (100 мМ). (Б)
Процентное распределение клеток по фазам клеточного цикла. Звездочка
обозначает статистически значимое отличие от количества клеток в
контроле; n=3, p<0.05.
На Рис. 3.3.3. показано влияние гомокарнозина на прогрессию
клеточного
цикла
клеток
глиобластомы.
Клетки
обрабатывали
гомокарнозином (100 мМ) в течение 24 ч и измеряли распределение клеток
по фазам клеточного цикла на проточном цитометре согласно содержанию
ДНК.
Результаты
измерений
представлены
на
Рис.
3.3.3.
Пример
распределения клеток между G0/G1, S и G2/М фазами показан на Рис. 3.3.3.А.
79
Согласно
результатам
анализа
процентного
распределения
клеток
представленным на Рис. 3.3.3.Б, распределение в контроле составляло: 48% G0/G1 фаза, 30,5% - S фаза и 22,5% - G2/М фаза, после инкубации с
гомокарнозином: 40% - G0/G1 фаза, 23% - S фаза и 37% - G2/М фаза. Исходя
из полученных данных, был сделан вывод о том, что гомокарнозин
индуцирует G2 блок в клетках U-118-MG. Ингибирующее действие
гомокарнозина на пролиферацию клеток глиобластомы, вероятно, связано с
изменениями в прогрессии клеточного цикла.
Рисунок 3.3.3. Гомокарнозин индуцирует G2 блок в клетках U-118MG. Клетки обрабатывали 100 мМ гомокарнозина в течение 24 ч.
Содержание ДНК измеряли на проточном цитометре по интенсивности
флуоресценции
PI.
(А)
Пример
распределения
и
(Б)
процентное
распределение клеток по фазам клеточного цикла в контроле и после
инкубации
с
гомокарнозином.
Звездочка
обозначает
статистически
значимое отличие от контроля; n=3, p<0.05.
Заключение III: производные карнозина (ацетил-карнозин, анзерин и
гомокарнозин) оказывают ингибирующее действие на пролиферацию клеток
глиобластомы, однако с разной эффективностью. Метилирование карнозина
повышало его антипролиферативные свойства, ацетилирование молекулы,
наоборот, приводило к снижению эффективности действия карнозина.
80
Снижение
пролиферации
глиобластомы
под
действием
анзерина
и
гомокарнозина, сопровождалось изменениями в прогрессии клеточного
цикла и формированием G2 блока.
РАЗДЕЛ 3.4. Возможности применения карнозина в радиотерапии
На сегодняшний день лучевая терапия - один из наиболее эффективных
способов лечения глиобластомы. Для того чтобы исследовать, последствия
совместного применения карнозина и ионизирующего излучения, клетки
обрабатывали карнозином (100 мМ) в течение 24 ч, облучали (4 Гр) и
рассаживали в низких разведениях чашки Петри для формирования колоний.
На Рис. 3.4.1. показаны результаты совместного действия карнозина и
ионизирующего облучения на гибель клеток глиобластомы. Примеры чашек
Петри с колониями клеток сформированных в контроле, после инкубации с
100 мМ карнозина, облучения (4 Гр) и совместного действия карнозина и
облучения показаны на Рис. 3.4.1.А. Результаты анализа выживаемости
представлены на Рис. 3.4.1.Б. Как следует из Рис. 3.4.1.Б, подсчет количества
колоний и расчет выживаемости показали, что инкубация клеток с 100 мМ
карнозина приводит к снижению выживаемости клеток глиобластомы до 53%
по сравнению с контролем (Рис. VI.Б). Облучение клеток при 4 Гр снижало
выживаемость на 67%. Выживаемость клеток, подвергнутых совместному
действию карнозина и
ионизирующего излучения, составляло 17% от
контроля. Таким образом, было продемонстрировано, что предварительная
инкубация с карнозином снижает выживаемость клеток глиобластомы под
действием ионизирующего излучения.
81
Рисунок 3.4.1. Предварительная инкубация с карнозином усиливает
гибель клеток глиобластомы под действием ионизирующего облучения.
Клетки инкубировали с карнозином (100 мМ) в течение 24 ч, облучали (4 Гр)
и рассеивали в низких разведениях для формирования колоний. (А) Пример
колоний, сформированных в контроле, после обработки карнозином,
облучения или после совместного действия карнозина и облучения. (Б)
Выживаемость рассчитывали, как описано на рисунке 3.2.3.Б. Звездочки
обозначают статистически значимое отличие от выживаемости в
контроле (*) или от проб, облученных при 4 Гр (**); n=3, p<0.05.
ГЛАВА 4. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ
Карнозин представляет собой природный дипептид встречающийся в
высокой концентрации в мышцах и мозге. Антипролиферативный эффект
карнозина на трансформированнные и опухолевые клетки был впервые
описан порядка 30 лет назад. Однако, механизм ингибирующего действия
карнозина на пролиферацию опухолевых клеток до сих пор до конца не
понятен.
Целью
данной
работы
82
было
исследование
механизма
ингибирующего действия карнозина на пролиферацию опухолевых клеток.
На сегодняшний день в литературе накоплено множество данных об участии
про- и антиоксидантов в регуляции клеточной пролиферации. Поскольку,
карнозин демонстрирует эффективные антиоксидантные свойства мы
предположили, что ингибирующий эффект карнозина на пролиферацию
опухолевых клеток является следствием его антиоксидантной активности.
Мы
обнаружили,
что
карнозин
ингибирует
пролиферацию
клеток
феохромоцитомы крысы (РС-12), глиобластомы человека (U-118-MG),
карциномы горла и рта (FaDu, Cal27) и молочной железы (MB231) человека.
Наиболее
эффективно
карнозин
ингибировал
пролиферацию
клеток
глиобластомы человека U-118-MG. В данной работе было впервые показано,
что снижение пролиферации под действием карнозина сопровождается
снижением уровня внутриклеточных АФК, усилением экспрессии MnСОД и
циклина В1, а также накоплением клеток в G2 фазе клеточного цикла.
Метилированное
производное
карнозина,
анзерин,
ингибировал
пролиферацию опухолевых клеток эффективнее, чем карнозин. В работе
впервые было показано, что обработка клеток глиобластомы карнозином
перед облучением приводит к снижению их выживаемости. Полученные
данные позволяют сделать вывод о том, что карнозин ингибирует
пролиферацию опухолевых клеток за счет активации антиоксидантной
системы и модификации клеточного цикла. Метилирование карнозина
приводит к усилению антипролиферирующего эффекта. Усиление гибели
опухолевых
клеток
при
совместном
использовании
карнозина
и
ионизирующего излучения открывает перспективы применения карнозина в
терапии опухолевых заболеваний.
Подсчет общего количества клеток феохромоцитомы крысы РС-12 с
помощью камеры Горяева выявил снижение количества клеток в пробах
обработанных карнозином по сравнению с контролем (Рис. 3.1.1.A).
Уменьшение количества клеток не сопровождалось увеличением количества
83
некротических или апоптотических клеток (Рис. 3.1.1.A, 3.1.3.A), указывая на
то, что снижение количества клеток происходит в результате замедления
пролиферации, а не усиления клеточной гибели. Ингибирующее действие
карнозина на пролиферацию клеток было подтверждено результатами
измерения времени удвоения популяции. Карнозин увеличивал Td четырех
исследованных культур опухолевых клеток человека (карциномы горла и рта
(FaDu, Cal27), карцином молочной железы (MB-231), глиобластомы (U-118MG)).
Наибольшее
удлинение
Td
наблюдали
в
клетках
культуры
глиобластомы (Рис. 3.2.1). Анализ воздействия разных концентраций
карнозина на пролиферацию клеток глиобластомы выявил, что карнозин
дозо-зависимо ингибирует рост клеток глиобластомы. Полученные данные
подтверждались результатами измерения клеточной выживаемости (Рис.
3.2.3). Наши наблюдения согласовывались с результатами предыдущих
работ, демонстрирующими антипролиферативное действие карнозина на
клетки, изолированные из мозга больных мультиформной глиобластомой [21,
208]. Снижение количества клеток глиобластомы под действием карнозина
не
сопровождалось
обработанных
усилением
карнозином,
некроза
процент
или
клеток
апоптоза.
включивших
В
пробах,
БДУ
был
значительно меньше, чем в контроле, что свидетельствовало о замедление
пролиферативных процессов под действием карнозина [208]. Кроме того,
инъекции
карнозина
мышам
с
ксенографами
HER2/neu
NIH3T3
фибробластов снижали количество митозов в опухолях и существенно
подавляли опухолевый рост [21]. Исходя из полученных нами результатов и
данных литературы, был сделан вывод о том, что противоопухолевый эффект
карнозина
обусловлен
ингибирующим
действием
карнозина
на
пролиферацию опухолевых клеток.
Причины повышенной чувствительности клеток глиобластомы к
карнозину до конца не понятны и требуют дальнейшего изучения.
Полученные нами данные позволяют предположить, что одной из причин
84
могут быть различия в уровне эндогенного карнозина в исследованных
клеточных культурах. С помощью метода ПЦР в режиме реального времени
обнаружено, что в клетках глиобластомы уровень мРНК карнозин-синтетазы
ниже, чем в клетках карцином, а уровень мРНК карнозиназы, наоборот, выше
(Рис. 3.2.2). Мы полагаем, что изначально низкий уровень эндогенного
карнозина в клетках глиобластомы вследствие повышенного уровня
карнозиназы и сниженного уровня карнозин-синтетазы, делает клетки U-118MG более чувствительными к добавлению карнозина извне. Клетки
карцином с изначально повышенным уровнем карнозина обладают своего
рода резистентностью. Из данного предположения можно также сделать
вывод о том, что антипролиферативный эффект карнозина обоснован
присутствием молекулы целиком, а не составляющими ее аминокислотами.
Результаты более ранних работ подтверждают данное предположение.
Показано, что β-аланин сам по себе не проявляет неопластического эффекта,
в то время как L-гистидин токсичен для всех типов клеток в концентрации
выше 5 мМ [23, 260].
Измерение уровня АФК на проточном цитометре по степени окисления
DCFH2-DA выявило, что ингибирование пролиферации клеток РС-12 и U118-MG
под
действием
карнозина
сопровождается
снижением
внутриклеточного уровня АФК (Рис. 3.1.2 и 3.2.4). Наши наблюдения
согласуются с опубликованными ранее данными, демонстрирующими
корреляцию
между
снижением
внутриклеточного
уровня
АФК
и
уменьшением количества клеток карциномы толстой кишки человека
HCT116 под действием карнозина [209]. Показано, что внутриклеточный
уровень АФК повышается по мере прогрессии клеток через клеточный цикл,
позволяя предположить, что быстро пролиферирующие клетки находятся в
более окисленном состоянии по сравнению с клетками, делящимися
медленно [32, 33]. Высокий уровень АФК в опухолевых клетках, вероятно,
является одной из причин их активной пролиферации [69]. Исходя из данных
85
литературы и наших результатов, мы предполагаем, что снижение
внутриклеточного уровня АФК в клетках РС-12 и U-118-MG под действием
карнозина, способствует замедлению пролиферации клеток глиобластомы.
Интересно отметить, что усиление экспрессии карнозиназы (CN1) в
клетках
нейробластомы человека
SH-SY5Y приводило
к снижению
защитного действия карнозина от цитотоксического эффекта известного
индуктора окислительного стресса, малонового диальдегида [9]. Таким
образом,
прослеживается
параллель
между
ослаблением
антипролиферативного эффекта и антиоксидантных свойств карнозина при
усилении экспрессии карнозиназы, указывая на существование взаимосвязи
между способностью карнозина снижать уровень АФК и ингибировать
пролиферацию опухолевых клеток.
При дальнейшем исследовании действия карнозина на антиоксидантную
систему клеток глиобластомы было обнаружено, что карнозин изменяет
активность, основных ферментов антиоксидантной системы клетки, MnСОД
и каталазы. С помощью метода электорофореза в неденатурирующем геле
было выявлено усиление активности MnСОД в клетках глиобластомы
обработанных
карнозином
(Рис.
3.2.5.А).
С
помощью
методов
иммуноблоттинга и ПЦР в реальном времени было установлено, что
усиление активности MnСОД сопровождается повышением уровня белка и
мРНК MnСОД (Рис. 3.2.5.Б-Г). MnСОД представляет собой антиоксидантный
фермент, локализованый в митохондриях и катализирующий реакцию
дисмутации супероксида в пероксид водорода [50]. Ранее мы показали, что
прогрессия клеточного цикла зависит от активности MnСОД: повышение
активности MnСОД ингибировало клеточный рост, в то время как понижение
активности MnСОД усиливало пролиферацию [27, 151, 261]. Более того, в
нескольких
исследованиях
было
продемонстрировано
значительное
снижение активности MnСОД в опухолевых клетках, что совпадало с
повышенным внутриклеточным уровнем АФК и активной пролиферацией.
86
Усиление экспрессии MnСОД ингибировало пролиферацию многих линий
опухолевых клеток, в том числе клеток глиобастомы человека U-118 [30, 74,
75, 256, 262, 263]. В нашей работе, увеличение активности MnСОД при
инкубации
клеток
глиобластомы
с
карнозином
сопровождалось
значительным удлинением времени удвоения популяции. Следовательно,
можно
предположить,
что
антипролиферативный
эффект
карнозина
обусловлен его способностью усиливать экспрессию MnСОД и приводить к
снижению уровня АФК.
Измерение активности цитозольной формы СОД (CuZnСОД) в контроле
и после инкубации с карнозином не выявило каких-либо различий.
Поскольку
MnСОД
представляет
собой
антиоксидантный
фермент
расположенный в матриксе митохондрий, исходя из полученных данных
можно предположить, что антипролиферативный эффект карнозина является
результатом изменения уровня АФК, генерируемых в митохондриях.
Интересно отметить работу Renner et al., которые показали, что
уменьшение количества клеток глиобластомы в культуре под действием
карнозина сопровождается снижением внутриклеточного количества АТФ и
активности ЛДГ, что, по мнению авторов, являлось причиной замедления
пролиферации опухолевых клеток [21, 208]. Ингибирование окислительного
фосфорилирования с помощью KCN не влияло на выработку АТФ или
выживаемость клеток глиобластомы, исходя из этого было предположено,
что карнозин работает на уровне гликолиза, а не окислительного
фосфорилирования [225]. Недавно Sarsour et al. продемонстрировали
существование взаимосвязи между гликолизом и активностью MnСОД.
Понижение активности MnСОД сопровождалось усилением интенсивности
поглощения
глюкозы,
а
усиление
активности
MnСОД,
наоборот
ингибировало гликолитические процессы [27]. Таким образом, можно
предположить, что обнаруженное нами повышение активности MnСОД под
действием карнозина является одним из механизмов ингибирующего
87
действия карнозина на гликолиз, приводя к замедлению пролиферации
опухолевых клеток.
Измерение активности каталазы в пробах обработанных карнозином
выявило снижение ее активности в клетках глиобластомы обработанных
карнозином по сравнению с контролем (Рис. 3.2.6). Снижение активности
каталазы сопровождалось понижением уровня белка. Каталаза является
важным участником антиоксидантной системы клетки, который катализирует
реакцию разложения Н2О2 до воды и молекулярного кислорода. Таким
образом, снижение активности каталазы должно приводить к повышению
концентрации Н2О2, однако в нашей работе этого не наблюдалось. Более
того, уровень АФК, наоборот, снижался. Возможно, это происходило потому,
что изначальная активность каталазы была невелика (4 мк ед/мг). В то время
как средняя активность каталазы в нормальных клетках на несколько
порядков выше (примерно 5 ед/мг белка) [148]. Понижение активности
каталазы в клетках глиобластомы с 4 до 2 мк ед/мг, вероятно, не вносило
значительного вклада в повышение уровня Н2О2. Кроме того, снижение
уровня АФК может объясняться включением компенсаторных механизмов,
например усилением активности GPx, пероксиредоксинов и т.п.
Исследование влияния карнозина на прогрессию клеточного цикла
клеток РС-12 и U-118-MG выявило, что замедление пролиферации под
действием карнозина сопровождается увеличением количества клеток в G2
фазе (Рис. 3.2.7). На сегодняшний день накоплен большой объем
экспериментальных данных, указывающий на важность роли АФК в
регуляции прогрессии клеточного цикла. Показано, что по мере прогрессии
клеточного цикла от G1 к митозу происходит увеличение уровня АФК и
снижение активности MnСОД. Концентрация АФК максимальна в поздней S
фазе и в G2/M [26]. Активность MnСОД, наоборот, была максимальна в G1
фазе и постепенно снижалась по мере прогрессии через S, G2 и М фазы [27,
148, 150]. Повышение экспрессии MnСОД усиливало формирование G2 блока
88
индуцированное действием радиации в клетках карциномы [180]. Исходя из
полученных нами результатов и данных литературы, мы предполагаем, что
индуцированное карнозином снижение АФК и увеличение активности
MnСОД
приводят
к
нарушению
внутриклеточного
редокс-баланса,
необходимого для прогрессии через G2 фазу (повышенный уровень АФК и
низкая активность MnСОД). В результате не происходит активации редоксзависимых регуляторов G2 фазы, что приводит к нарушению прогрессии
клеточного цикла через G2 фазу.
В нашей лаборатории было также показано, что карнозин замедляет рост
уровня активной формы МАР-киназы ERK1/2 в условиях окислительного
стресса индуцированного активацией глутаматных рецепторов [234, 236].
Активация ERK1/2 необходима для пролиферации клеток, ингибирование
ERK1/2 приводило к остановке пролиферации и накоплению клеток в одной
из фаз клеточного цикла [106]. Есть данные о том, что активность ERK1/2
изменяется в зависимости от состояния редокс. Например, усиление
экспрессия MnСОД подавляло активацию ERK1/2 в клетках глиобластомы
человека U87, указывая на возможность регуляции активности ERK1/2 с
помощью антиоксидантов [28, 160]. Несмотря на то, что для проверки данной
гипотезы,
необходимо
проведение
множества
дополнительных
экспериментов, мы полагаем, что ингибирование ERK1/2 при активации
MnСОД и снижении уровня АФК под действием карнозина, может быть
одним из механизмов его антипролифативного эффекта.
Увеличение
количества
G2
клеток
сопровождалось
усилением
экспрессии циклина В1. Циклин В1 представляет собой функциональную
субъединицу комплекса циклин В1/CDK1, который регулирует прогрессию
клетки через G2 фазу (Рис. 3.2.8) [131]. Экспрессия циклина В1 усиливается в
поздней S-фазе, достигает максимума в G2, и резко снижается в середине
митоза. В G1-фазе циклин В1 не детектируется [81]. Таким образом,
увеличение уровня циклина В1 в пробах обработанных карнозином может
89
быть следствием повышенного содержания клеток в G2-фазе. С другой
стороны, карнозин может напрямую активировать экспрессию циклина В1
независимо
от
индукции
G2-блока.
Дополнительные
исследования
необходимы для изучения механизма активации экспрессии циклина В1 в
ответ на действие карнозина.
Мы полагаем, что индукция G2 блока под действием карнозина может
быть также опосредована через фосфатазу Cdc25C, которая является редоксчувствительным ферментом и играет важную роль в регуляции работы
комплекса циклин В1/CDK1 [138, 177]. Thomas et al. показали, что
низкомолекулярный антиоксидант витамин С индуцирует G2 блок в клетках
HeLa и T98G. При более подробном исследовании механизма данного
явления было выявлено, что витамин С препятствует перемещению Cdc25C в
ядро, а следовательно и активации комплекса циклин В1/CDK1 [181]. В
результате, несмотря на наличие комплекса циклин В1/CDK1 в клетке
прогрессии клеточного цикла не происходило. Нами также было замечено,
что рост уровня циклина В1 начинался одновременно с ростом уровня белка
MnСОД, подтверждая наше предположение о том, что увеличение
активности MnСОД приводит к изменениям в прогрессии клеточного цикла и
формированию G2 блока. Исходя из наших данных, сопоставленных с
данными литературы, был сделан вывод о том, что индуцированные
карнозином
изменения
в
соотношении
внутриклеточных
про-
и
антиоксидантов индуцирует G2 блок и увеличивают уровень циклина В1.
У карнозина существует несколько природных производных, среди них:
ацетил-карнозин
(N-ацетил-β-аланил-L-гистидин),
анзерин
(β-аланил-3-
метил-L-гистидин), гомокарнозин (у-амино-бутирил-L-гистидин). Изучение
структурно-функциональных особенностей карнозина и его производных в
отношении подавления пролиферации опухолевых клеток может помочь
оценить степень вовлеченности отдельных частей молекулы в исследуемый
эффект карнозина. Исследование антипролиферативых свойств производных
90
карнозина выявило, что все исследованные производные карнозина
ингибировали пролиферацию опухолевых клеток. Эффективность действия
исследованных дипептидов возрастала в следующем порядке: ацетилкарнозин < карнозин ≤ гомокарнозин < анзерин (Рис. 3.1.4.А, 3.3.1, 3.3.2,
3.3.3). Анализ распределения клеток по фазам клеточного цикла в контроле и
пробах обработанных дипептидами показал, что все исследованные вещества
индуцируют накопление клеток в G2 фазе клеточного цикла. Клетки U-118MG
обработанные
анзерином
также
демонстрирововали
небольшое
увеличение количества клеток в G1 фазе, что, возможно, было причиной
более сильного антипролиферативного эффекта анзерина. Исходя из
полученных данных, был сделан вывод о том, что ацетилирование карнозина
снижает
его
антипролиферативные
способности,
в
то
время
как
метилирование, наоборот, усиливает антипролиферативный эффект.
Характер
влияния заместителей
антипролиферативные
заместителей
на
свойства
был
антиоксидантную
в молекуле карнозина на его
сходен
с
активность
характером
карнозина.
влияния
Согласно
эффективности защиты суперскрученной ДНК от перекисного окисления
липидов индуцированного в смеси Фентона дипептиды располагались
следующим образом: гистидин < ацетил-карнозин < гомокарнозин ≤
карнозин ≤ анзерин [15, 264]. Совпадение принципов изменения силы
антиоксидантного и антипролиферативного эффектов еще раз указывает на
сопряженность
между
антиоксидантным
и
антипролиферативным
-
L-гистидин-β-аланин,
свойствами карнозина.
Синтетический
аналог
карнозина
представляющий собой т.н. «карнозина наоборот» также индуцировал
накопление клеток в G2 фазе клеточного цикла и ингибировал пролиферацию
опухолевых
клеток
(Рис.
3.1.4.Б).
Причем,
диапазон
эффективных
концентраций для антипролиферативного эффекта L-гистидин-β-аланина был
в 10 раз ниже (5 – 10 мМ), чем для карнозина (50 - 100 мМ). Однако, при
91
концентрации выше 10 мМ L-гистидин-β-аланин приводил к интенсивной
гибели опухолевых клеток. Токсичность «карнозина наоборот» может быть
связана с положением L-гистидина на первом месте. Известно, что в
концентрации выше 5 мМ гистидин обладает цитотоксическими действием.
Добавление β-аланина к молекуле гистидина в молекуле карнозина,
вероятно, способствует снижению токсичности гистидина. Было показано,
что токсичность гистидина связана с присутствием ионов железа, удаление
ионов
железа
из
среды
снижало
токсический
эффект
гистидина.
Имидазольное кольцо в молекуле гистидина способно хелатировать железо,
отдавая протон от азота 1N. Металлы в металлоферментах часто
координируются с помощью гистидина через незащищенный азот в
имидазоле.
Предполагается,
«хелатируемое
железо»,
что
железо
гистидин
способен
слабосвязанное
с
отнимать
т.н.
внутриклеточными
ферментами, и делать его более доступным для окисления под действием
АФК [265, 266]. Перемещение L-гистидина на первое место в молекуле
«карнозина наоборот» делает имидазольное кольцо более открытым, и,
следовательно, более доступным для взаимодействий, что, вероятно,
является причиной цитотоксичности высоких концентраций L-гистидин-βаланина.
Инкубация с синтетическим трипептидом пинеалоном приводила к
снижению внутриклеточного уровня АФК в клетках РС-12 по сравнению с
необработанным контролем (Рис. 3.1.5.А). Наши результаты согласовывались
с полученными ранее данными об антиоксидантных свойствах пинеалона,
продемонстрированных на модели гиперборической гипоксии [244-246].
Кроме того, на клетках РС-12 мы показали, что пинеалон обладает защитным
антиоксидантным действием. Пинеалон частично препятствовал росту
внутрикелточного уровня АФК индуцированного действием Н2О2 и снижал
уровень клеточной гибели (Рис. 3.1.5). Анализ клеточного цикла выявил, что
подобно карнозину, инкубация с пинеалоном приводит к увеличению
92
количества S и G2/М клеток по сравнению с контролем (Рис. 3.1.6). Однако,
для достижения сходного эффекта пинеалон требовался в концентрациях на
несколько порядков ниже, чем карнозин (нМ – для пинеалона, мМ – для
карнозина). Ранее в нашей лаборатории было показано, что пинеалон
препятствует
росту
ERK1/2
в
гранулярных
клетках
мозжечка
индуцированное действием уабаина [234]. Поскольку активация ERK1/2
необходима для прогрессии клеточного цикла, снижение активности ERK1/2
под действием пинеалона может быть одним из механизмов индукции G 2
блока в его присутствии. Кроме того, аминокислотный состав пинеалона и
карнозина различается, указывая на то, что действие исследуемых
короткоцепочечных пептидов на клеточный цикл, видимо, обосновано не
присутствием конкретной аминокислоты, а скорее всего антиоксидантными
свойствами веществ.
Глиобластома – это наиболее частая и агрессивная форма опухоли
головного мозга [269]. На сегодняшний день лечение глиобластомы носит
скорее паллиативный характер и продлевает жизнь больного максимум на 2
года [270]. Одним из наиболее эффективных способов лечения глиобластомы
является лучевая терапия, применение которой ограничено повреждающим
действием на нормальные ткани. Соединения, способные усиливать гибель
опухолевых клеток, предохраняя при этом нормальные ткани, представляют
собой одно из наиболее актуальных направлений исследований.
С помощью колониеформирующего метода было продемонстрировано,
что предварительная инкубация клеток глиобластомы с карнозином приводит
к снижению выживаемости клеток после действия ионизирующего излучения
по сравнению с контролем (Рис. 3.4.1). Ранее было показано, что обработка
нормальных клеток карнозином снижает последствия повреждающего
действия радиации. Введение мышам карнозина в течение нескольких дней
перед облучением способствовало повышению выживаемости животных и
сопровождалось увеличением эффективности образования селезеночных
93
колоний гематопоэтическими стволовыми клетками из костного мозга
облученных животных [218-220]. Кроме того, карнозин снижал степень
повреждения плазмиды ДНК и количество разрывов в цепи ДНК,
индуцированные действием ионизирующего излучения [271]. Исходя из
полученных нами данных мы предполагаем, что карнозин способен
избирательно снижать выживаемость опухолевых клеток под действием
ионизирующего
излучения,
защищая
при
этом
нормальные
клетки.
Полученные нами данные могут быть использованы на практике для
разработки протоколов применения карнозина в терапии опухолей головного
мозга.
94
ВЫВОДЫ
1. Исследован характер воздействия карнозина на пролиферацию культур
опухолевых клеток: феохромоцитомы крысы (РС-12), карциномы горла и рта
(FaDu и Cal27),
карциномы молочной железы (MB231) и глиобластомы
человека (U-118-MG). Обнаружено, что карнозин ингибирует пролиферацию
всех исследованных клеточных линий. Наиболее выраженный эффект
проявлялся на клетках глиобластомы человека U-118-MG;
2.
Изучено
влияние
карнозина
на
уровень
АФК
и
активность
антиоксидантных ферментов глиобластомы. Выявлено, что ингибирование
пролиферации
клеток
глиобластомы
под
действием
карнозина
сопровождается снижением уровня АФК и увеличением активности MnСОД;
3. Исследовано воздействие карнозина на клеточный цикл клеток РС-12 и U118-MG.
Установлено,
что
изменения
в
антиоксидантной
системе
сопровождаются накоплением клеток в G2 фазе клеточного цикла и
усилением экспрессии циклина В1;
4. Проведено сравнение антипролиферативного эффекта карнозина с
действием его производных и синтетического трипептида пинеалона.
Выявлено, что метилированное производное карнозина, анзерин, ингибирует
пролиферацию клеток опухолевых клеток эффективнее, чем карнозин;
5. Исследован эффект совместного применения карнозина и ионизирующего
излучения на гибель опухолевых клеток. Обнаружено, что предварительная
инкубация клеток с карнозином снижает выживаемость клеток глиобластомы
под действием ионизирующего излучения.
95
СПИСОК ЛИТЕРАТУРЫ
1.
Mannion, A.F., et al., Carnosine and anserine concentrations in the
quadriceps femoris muscle of healthy humans. Eur J Appl Physiol Occup
Physiol, 1992. 64(1): p. 47-50.
2.
Margolis, F.L., Carnosine in the primary olfactory pathway. Science, 1974.
184(4139): p. 909-11.
3.
Kalyankar, G.D. and A. Meister, Enzymatic synthesis of carnosine and
related beta-alanyl and gamma-aminobutyryl peptides. J Biol Chem, 1959.
234: p. 3210-8.
4.
Stenesh, J.J. and T. Winnick, Carnosine-anserine synthetase of muscle. 4.
Partial purification of the enzyme and further studies of beta-alanyl peptide
synthesis. Biochem J, 1960. 77(3): p. 575-81.
5.
Skaper, S.D., S. Das, and F.D. Marshall, Some properties of a
homocarnosine-carnosine synthetase isolated from rat brain. J Neurochem,
1973. 21(6): p. 1429-45.
6.
Horinishi, H., M. Grillo, and F.L. Margolis, Purification and characterization
of carnosine synthetase from mouse olfactory bulbs. J Neurochem, 1978.
31(4): p. 909-19.
7.
Drozak, J., et al., Molecular identification of carnosine synthase as ATPgrasp domain-containing protein 1 (ATPGD1). J Biol Chem, 2010. 285(13):
p. 9346-56.
8.
Hanson, H.T. and E.L. Smith, Carnosinase; an enzyme of swine kidney. J
Biol Chem, 1949. 179(2): p. 789-801.
9.
Teufel, M., et al., Sequence identification and characterization of human
carnosinase and a closely related non-specific dipeptidase. J Biol Chem,
2003. 278(8): p. 6521-31.
10.
Северин С. Е., К., М.В., Кафтанова, Т.М., Влияние карнозина и
ансерина на работу изолированной мышцы лягушки. Доклад. АН
СССР, 1953. 91: p. 691-694.
96
11.
Viola, E.R., Hartzell, R. C., Villafranca, J. J. , Spectroscopic studies on the
copper(II) complexes of carnosine. Journal of Inorganic Biochemistry, 1979.
10(4): p. 281-292.
12.
Brown, C.E. and W.E. Antholine, Chelation chemistry of carnosine.
Evidence that mixed complexes may occur in vivo. The Journal of Physical
Chemistry, 1979. 83(26): p. 3314-3319.
13.
Vladimirov, Y.A., Studies of the antioxidant activity by measuring
chemiluminescence kinetics. Proc. Int. Symp. On Natural Antioxidants
Molecular Mechanisms and Health Effects, ed. L. Packer, Traber, M.G.,
Xin, W. . 1996, Champang, Illinois.
14.
Pavlov, A.R., et al., [Interactions of carnosine and superoxide radicals in
aqueous solutions]. Biull Eksp Biol Med, 1990. 110(10): p. 391-3.
15.
Kohen, R., et al., Antioxidant activity of carnosine, homocarnosine, and
anserine present in muscle and brain. Proc Natl Acad Sci U S A, 1988.
85(9): p. 3175-9.
16.
Chan, W.K.M., et al., EPR spin-trapping studies of the hydroxyl radical
scavenging activity of carnosine and related dipeptides. J Agric Food Chem,
1994. 42: p. 1407-1410.
17.
Klebanov, G.I., et al., Evidence for a direct interaction of superoxide anion
radical with carnosine. Biochem Mol Biol Int, 1997. 43(1): p. 99-106.
18.
Dupin, A.M., et al., [Carnosine protection of Ca2+ transport against damage
induced by lipid peroxidation]. Biull Eksp Biol Med, 1984. 98(8): p. 186-8.
19.
Zhou, S. and E.A. Decker, Ability of carnosine and other skeletal muscle
components to quench unsaturated aldehydic lipid oxidation products. J
Agric Food Chem, 1999. 47(1): p. 51-5.
20.
Nagai, K. and T. Suda, [Antineoplastic effects of carnosine and beta-alanine-physiological considerations of its antineoplastic effects]. Nihon Seirigaku
Zasshi, 1986. 48(11): p. 741-7.
21.
Renner, C., et al., Carnosine retards tumor growth in vivo in an NIH3T3HER2/neu mouse model. Mol Cancer, 2010. 9: p. 2.
97
22.
McFarland, G.A. and R. Holliday, Retardation of the senescence of cultured
human diploid fibroblasts by carnosine. Exp Cell Res, 1994. 212(2): p. 16775.
23.
Holliday, R. and G.A. McFarland, Inhibition of the growth of transformed
and neoplastic cells by the dipeptide carnosine. Br J Cancer, 1996. 73(8): p.
966-71.
24.
Burhans, W.C. and N.H. Heintz, The cell cycle is a redox cycle: linking
phase-specific targets to cell fate. Free Radic Biol Med, 2009. 47(9): p.
1282-93.
25.
Menon, S.G. and P.C. Goswami, A redox cycle within the cell cycle: ring in
the old with the new. Oncogene, 2007. 26(8): p. 1101-9.
26.
Goswami, P.C., et al., Cell cycle-coupled variation in topoisomerase IIalpha
mRNA is regulated by the 3'-untranslated region. Possible role of redoxsensitive protein binding in mRNA accumulation. J Biol Chem, 2000.
275(49): p. 38384-92.
27.
Sarsour, E.H., et al., Manganese superoxide dismutase regulates a metabolic
switch during the mammalian cell cycle. Cancer Res, 2012. 72(15): p. 380716.
28.
Laurent, A., et al., Controlling tumor growth by modulating endogenous
production of reactive oxygen species. Cancer Res, 2005. 65(3): p. 948-56.
29.
Burdon, R.H., Superoxide and hydrogen peroxide in relation to mammalian
cell proliferation. Free Radic Biol Med, 1995. 18(4): p. 775-94.
30.
Weydert, C.J., et al., Overexpression of manganese or copper-zinc
superoxide dismutase inhibits breast cancer growth. Free Radic Biol Med,
2006. 41(2): p. 226-37.
31.
Cadenas, E. and H. Sies, Oxidative stress: excited oxygen species and
enzyme activity. Adv Enzyme Regul, 1985. 23: p. 217-37.
32.
Chen, Q., et al., Production of reactive oxygen species by mitochondria:
central role of complex III. J Biol Chem, 2003. 278(38): p. 36027-31.
98
33.
Suh, Y.A., et al., Cell transformation by the superoxide-generating oxidase
Mox1. Nature, 1999. 401(6748): p. 79-82.
34.
Corda, S., et al., Rapid reactive oxygen species production by mitochondria
in endothelial cells exposed to tumor necrosis factor-alpha is mediated by
ceramide. Am J Respir Cell Mol Biol, 2001. 24(6): p. 762-8.
35.
Bedard, K. and K.H. Krause, The NOX family of ROS-generating NADPH
oxidases: physiology and pathophysiology. Physiol Rev, 2007. 87(1): p.
245-313.
36.
Thannickal, V.J. and B.L. Fanburg, Reactive oxygen species in cell
signaling. American Journal of Physiology - Lung Cellular and Molecular
Physiology, 2000. 279(6): p. L1005-L1028.
37.
Buettner, G.R., The pecking order of free radicals and antioxidants: lipid
peroxidation, alpha-tocopherol, and ascorbate. Arch Biochem Biophys,
1993. 300(2): p. 535-43.
38.
Gardner, H.W., Oxygen radical chemistry of polyunsaturated fatty acids.
Free Radic Biol Med, 1989. 7(1): p. 65-86.
39.
Laing, M., The Three Forms of Molecular Oxygen. Journal of Chemical
Education, 1989. 66(6): p. 453-55.
40.
Meisel, D., Czapski, G. , One-electron transfer equilibria and redoxpotentials of radicals studied by pulse radiolysis. J. Phys. Chem., 1975. 79:
p. 1503.
41.
Halliwell, B., J.M. Gutteridge, and C.E. Cross, Free radicals, antioxidants,
and human disease: where are we now? J Lab Clin Med, 1992. 119(6): p.
598-620.
42.
Boldyrev, A.A., Significance of reactive oxygen species for neuronal
function., in Free Radicals, Nitric Oxide and Inflammation: Molecular,
Biochemical, and Clinical Aspects, A. Tomasi, Özben, T., Skulachev, V. P.,
Editor. 2003, IOS Press. p. 157-173.
43.
Sena, L.A. and N.S. Chandel, Physiological roles of mitochondrial reactive
oxygen species. Mol Cell, 2012. 48(2): p. 158-67.
99
44.
Brieger, K., et al., Reactive oxygen species: from health to disease. Swiss
Med Wkly, 2012. 142: p. w13659.
45.
Murrell, G.A., M.J. Francis, and L. Bromley, Modulation of fibroblast
proliferation by oxygen free radicals. Biochem J, 1990. 265(3): p. 659-65.
46.
Stirpe, F., et al., Stimulation by xanthine oxidase of 3T3 Swiss fibroblasts
and human lymphocytes. Exp Cell Res, 1991. 192(2): p. 635-8.
47.
Schafer, F.Q. and G.R. Buettner, Redox environment of the cell as viewed
through the redox state of the glutathione disulfide/glutathione couple. Free
Radic Biol Med, 2001. 30(11): p. 1191-212.
48.
Smith, C.V., et al., Compartmentation of glutathione: implications for the
study of toxicity and disease. Toxicol Appl Pharmacol, 1996. 140(1): p. 112.
49.
Kirlin, W.G., et al., Glutathione redox potential in response to differentiation
and enzyme inducers. Free Radic Biol Med, 1999. 27(11-12): p. 1208-18.
50.
McCord, J.M. and I. Fridovich, Superoxide dismutase. An enzymic function
for erythrocuprein (hemocuprein). J Biol Chem, 1969. 244(22): p. 6049-55.
51.
Fridovich, I., Superoxide dismutases. An adaptation to a paramagnetic gas. J
Biol Chem, 1989. 264(14): p. 7761-4.
52.
Folz, R.J. and J.D. Crapo, Extracellular superoxide dismutase (SOD3):
tissue-specific expression, genomic characterization, and computer-assisted
sequence analysis of the human EC SOD gene. Genomics, 1994. 22(1): p.
162-71.
53.
Lebovitz, R.M., et al., Neurodegeneration, myocardial injury, and perinatal
death in mitochondrial superoxide dismutase-deficient mice. Proc Natl Acad
Sci U S A, 1996. 93(18): p. 9782-7.
54.
Li, Y., et al., Dilated cardiomyopathy and neonatal lethality in mutant mice
lacking manganese superoxide dismutase. Nat Genet, 1995. 11(4): p. 37681.
100
55.
Van Remmen, H., et al., Life-long reduction in MnSOD activity results in
increased DNA damage and higher incidence of cancer but does not
accelerate aging. Physiol Genomics, 2003. 16(1): p. 29-37.
56.
Van Remmen, H., et al., Knockout mice heterozygous for Sod2 show
alterations in cardiac mitochondrial function and apoptosis. Am J Physiol
Heart Circ Physiol, 2001. 281(3): p. H1422-32.
57.
Williams, M.D., et al., Increased oxidative damage is correlated to altered
mitochondrial function in heterozygous manganese superoxide dismutase
knockout mice. J Biol Chem, 1998. 273(43): p. 28510-5.
58.
Loew, O., A NEW ENZYME OF GENERAL OCCURRENCE IN
ORGANISMIS. Science, 1900. 11(279): p. 701-2.
59.
Chance, B., H. Sies, and A. Boveris, Hydroperoxide metabolism in
mammalian organs. Physiol Rev, 1979. 59(3): p. 527-605.
60.
Mills, G.C., Hemoglobin catabolism. I. Glutathione peroxidase, an
erythrocyte enzyme which protects hemoglobin from oxidative breakdown. J
Biol Chem, 1957. 229(1): p. 189-97.
61.
Cohen, G. and P. Hochstein, GLUTATHIONE PEROXIDASE: THE
PRIMARY AGENT FOR THE ELIMINATION OF HYDROGEN
PEROXIDE IN ERYTHROCYTES. Biochemistry, 1963. 2: p. 1420-8.
62.
Zanetti,
M.,
Z.S.
Katusic,
and
T.
O'Brien,
Adenoviral-mediated
overexpression of catalase inhibits endothelial cell proliferation. Am J
Physiol Heart Circ Physiol, 2002. 283(6): p. H2620-6.
63.
Preston, T.J., W.J. Muller, and G. Singh, Scavenging of extracellular H2O2
by catalase inhibits the proliferation of HER-2/Neu-transformed rat-1
fibroblasts through the induction of a stress response. J Biol Chem, 2001.
276(12): p. 9558-64.
64.
Nargi, J.L., R.R. Ratan, and D.E. Griffin, p53-independent inhibition of
proliferation and p21(WAF1/Cip1)-modulated induction of cell death by the
antioxidants N-acetylcysteine and vitamin E. Neoplasia, 1999. 1(6): p. 54456.
101
65.
Sato, N., et al., N-Acetyl cysteine (NAC) inhibits proliferation, collagen
gene transcription, and redox stress in rat palatal mucosal cells. Dent Mater,
2009. 25(12): p. 1532-40.
66.
Sarsour, E.H., et al., Manganese superoxide dismutase activity regulates
transitions between quiescent and proliferative growth. Aging Cell, 2008.
7(3): p. 405-17.
67.
Chiu, J. and I.W. Dawes, Redox control of cell proliferation. Trends Cell
Biol, 2012. 22(11): p. 592-601.
68.
Gius, D. and D.R. Spitz, Redox signaling in cancer biology. Antioxid Redox
Signal, 2006. 8(7-8): p. 1249-52.
69.
Gupta, S.C., et al., Upsides and downsides of reactive oxygen species for
cancer: the roles of reactive oxygen species in tumorigenesis, prevention,
and therapy. Antioxid Redox Signal, 2012. 16(11): p. 1295-322.
70.
Cairns, R.A., I.S. Harris, and T.W. Mak, Regulation of cancer cell
metabolism. Nat Rev Cancer, 2011. 11(2): p. 85-95.
71.
Hutter, D.E., B.G. Till, and J.J. Greene, Redox state changes in densitydependent regulation of proliferation. Exp Cell Res, 1997. 232(2): p. 435-8.
72.
Menon, S.G., et al., Differential susceptibility of nonmalignant human breast
epithelial cells and breast cancer cells to thiol antioxidant-induced G(1)delay. Antioxid Redox Signal, 2005. 7(5-6): p. 711-8.
73.
Leung, S.W., et al., Effect of L-buthionine sulfoximine on the radiation
response of human renal carcinoma cell lines. Cancer, 1993. 71(7): p. 227685.
74.
Oberley, L.W. and G.R. Buettner, Role of superoxide dismutase in cancer: a
review. Cancer Res, 1979. 39(4): p. 1141-9.
75.
Zhong, W., et al., Suppression of the malignant phenotype of human glioma
cells by overexpression of manganese superoxide dismutase. Oncogene,
1997. 14(4): p. 481-90.
102
76.
Oberley, L.W., et al., Manganese superoxide dismutase in normal and
transformed human embryonic lung fibroblasts. Free Radic Biol Med, 1989.
6(4): p. 379-84.
77.
Brigelius-Flohe, R. and A. Kipp, Glutathione peroxidases in different stages
of carcinogenesis. Biochim Biophys Acta, 2009. 1790(11): p. 1555-68.
78.
Sagone, A.L., Jr., et al., Effect of catalase on the proliferation of human
lymphocytes to phorbol myristate acetate. J Immunol, 1984. 133(3): p. 148894.
79.
Evans, T., et al., Cyclin: a protein specified by maternal mRNA in sea urchin
eggs that is destroyed at each cleavage division. Cell, 1983. 33(2): p. 38996.
80.
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., Walter, P.,
Molecular Biology Of The Cell. Fifth Edition. 2008: New York: Garland
Science.
81.
Grana, X. and E.P. Reddy, Cell cycle control in mammalian cells: role of
cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and
cyclin-dependent kinase inhibitors (CKIs). Oncogene, 1995. 11(2): p. 211-9.
82.
Coller, H.A., What's taking so long? S-phase entry from quiescence versus
proliferation. Nat Rev Mol Cell Biol, 2007. 8(8): p. 667-70.
83.
Ducommun, B., et al., cdc2 phosphorylation is required for its interaction
with cyclin. EMBO J, 1991. 10(11): p. 3311-9.
84.
Jeffrey, P.D., et al., Mechanism of CDK activation revealed by the structure
of a cyclinA-CDK2 complex. Nature, 1995. 376(6538): p. 313-20.
85.
Diehl, J.A. and C.J. Sherr, A dominant-negative cyclin D1 mutant prevents
nuclear import of cyclin-dependent kinase 4 (CDK4) and its phosphorylation
by CDK-activating kinase. Mol Cell Biol, 1997. 17(12): p. 7362-74.
86.
Porter, L.A. and D.J. Donoghue, Cyclin B1 and CDK1: nuclear localization
and upstream regulators. Prog Cell Cycle Res, 2003. 5: p. 335-47.
103
87.
Lolli, G. and L.N. Johnson, CAK-Cyclin-dependent Activating Kinase: a
key kinase in cell cycle control and a target for drugs? Cell Cycle, 2005.
4(4): p. 572-7.
88.
van den Heuvel, S., Cell-cycle regulation. WormBook, 2005: p. 1-16.
89.
Golias, C.H., A. Charalabopoulos, and K. Charalabopoulos, Cell
proliferation and cell cycle control: a mini review. Int J Clin Pract, 2004.
58(12): p. 1134-41.
90.
Rayess, H., M.B. Wang, and E.S. Srivatsan, Cellular senescence and tumor
suppressor gene p16. Int J Cancer, 2012. 130(8): p. 1715-25.
91.
Sherr, C.J. and J.M. Roberts, CDK inhibitors: positive and negative
regulators of G1-phase progression. Genes Dev, 1999. 13(12): p. 1501-12.
92.
Kim, Y.T. and M. Zhao, Aberrant cell cycle regulation in cervical
carcinoma. Yonsei Med J, 2005. 46(5): p. 597-613.
93.
Caldon, C.E., et al., Cell cycle control in breast cancer cells. J Cell Biochem,
2006. 97(2): p. 261-74.
94.
Nam, E.J. and Y.T. Kim, Alteration of cell-cycle regulation in epithelial
ovarian cancer. Int J Gynecol Cancer, 2008. 18(6): p. 1169-82.
95.
Sudakin, V., et al., The cyclosome, a large complex containing cyclinselective ubiquitin ligase activity, targets cyclins for destruction at the end of
mitosis. Mol Biol Cell, 1995. 6(2): p. 185-97.
96.
Yu, H., et al., Identification of a novel ubiquitin-conjugating enzyme
involved in mitotic cyclin degradation. Curr Biol, 1996. 6(4): p. 455-66.
97.
Hershko, A., Ubiquitin-mediated protein degradation. J Biol Chem, 1988.
263(30): p. 15237-40.
98.
Peters, J.M., The anaphase promoting complex/cyclosome: a machine
designed to destroy. Nat Rev Mol Cell Biol, 2006. 7(9): p. 644-56.
99.
Hershko, A. and A. Ciechanover, The ubiquitin system. Annu Rev Biochem,
1998. 67: p. 425-79.
100. Kastan, M.B. and D.S. Lim, The many substrates and functions of ATM.
Nat Rev Mol Cell Biol, 2000. 1(3): p. 179-86.
104
101. Matsuoka, S., et al., Ataxia telangiectasia-mutated phosphorylates Chk2 in
vivo and in vitro. Proc Natl Acad Sci U S A, 2000. 97(19): p. 10389-94.
102. Hirao, A., et al., DNA damage-induced activation of p53 by the checkpoint
kinase Chk2. Science, 2000. 287(5459): p. 1824-7.
103. Falck, J., et al., The ATM-Chk2-Cdc25A checkpoint pathway guards against
radioresistant DNA synthesis. Nature, 2001. 410(6830): p. 842-7.
104. Robinson, M.J. and M.H. Cobb, Mitogen-activated protein kinase pathways.
Curr Opin Cell Biol, 1997. 9(2): p. 180-6.
105. Roberts, P.J. and C.J. Der, Targeting the Raf-MEK-ERK mitogen-activated
protein kinase cascade for the treatment of cancer. Oncogene, 2007. 26(22):
p. 3291-310.
106. Chambard, J.C., et al., ERK implication in cell cycle regulation. Biochim
Biophys Acta, 2007. 1773(8): p. 1299-310.
107. Mebratu, Y. and Y. Tesfaigzi, How ERK1/2 activation controls cell
proliferation and cell death: Is subcellular localization the answer? Cell
Cycle, 2009. 8(8): p. 1168-75.
108. Pages, G., et al., Mitogen-activated protein kinases p42mapk and p44mapk
are required for fibroblast proliferation. Proc Natl Acad Sci U S A, 1993.
90(18): p. 8319-23.
109. Squires, M.S., P.M. Nixon, and S.J. Cook, Cell-cycle arrest by PD184352
requires inhibition of extracellular signal-regulated kinases (ERK) 1/2 but
not ERK5/BMK1. Biochem J, 2002. 366(Pt 2): p. 673-80.
110. Sherr, C.J., Mammalian G1 cyclins. Cell, 1993. 73(6): p. 1059-65.
111. Ortega, S., M. Malumbres, and M. Barbacid, Cyclin D-dependent kinases,
INK4 inhibitors and cancer. Biochim Biophys Acta, 2002. 1602(1): p. 7387.
112. Ohtsubo, M. and J.M. Roberts, Cyclin-dependent regulation of G1 in
mammalian fibroblasts. Science, 1993. 259(5103): p. 1908-12.
105
113. Diehl, J.A., et al., Glycogen synthase kinase-3beta regulates cyclin D1
proteolysis and subcellular localization. Genes Dev, 1998. 12(22): p. 3499511.
114. Zou, Y., et al., Mirk/dyrk1B kinase destabilizes cyclin D1 by
phosphorylation at threonine 288. J Biol Chem, 2004. 279(26): p. 27790-8.
115. Musgrove, E.A., et al., Cyclin D1 induction in breast cancer cells shortens
G1 and is sufficient for cells arrested in G1 to complete the cell cycle. Proc
Natl Acad Sci U S A, 1994. 91(17): p. 8022-6.
116. Blomberg, I. and I. Hoffmann, Ectopic expression of Cdc25A accelerates the
G(1)/S transition and leads to premature activation of cyclin E- and cyclin
A-dependent kinases. Mol Cell Biol, 1999. 19(9): p. 6183-94.
117. Hsu, J.Y., et al., E2F-dependent accumulation of hEmi1 regulates S phase
entry by inhibiting APC(Cdh1). Nat Cell Biol, 2002. 4(5): p. 358-66.
118. Bell, S.P. and A. Dutta, DNA replication in eukaryotic cells. Annu Rev
Biochem, 2002. 71: p. 333-74.
119. Diffley, J.F., Regulation of early events in chromosome replication. Curr
Biol, 2004. 14(18): p. R778-86.
120. Groth, A., et al., Chromatin challenges during DNA replication and repair.
Cell, 2007. 128(4): p. 721-33.
121. Pines, J. and T. Hunter, Isolation of a human cyclin cDNA: evidence for
cyclin mRNA and protein regulation in the cell cycle and for interaction
with p34cdc2. Cell, 1989. 58(5): p. 833-46.
122. Ito, M., Factors controlling cyclin B expression. Plant Mol Biol, 2000. 43(56): p. 677-90.
123. Trembley, J.H., et al., Genomic organization and promoter characterization
of the rat cyclin B1 gene. Gene, 2000. 255(1): p. 93-104.
124. Kakino, S., et al., Intracellular localization of cyclin B1 during the cell cycle
in glioma cells. Cytometry, 1996. 24(1): p. 49-54.
106
125. Lukas, C., et al., Accumulation of cyclin B1 requires E2F and cyclin-Adependent rearrangement of the anaphase-promoting complex. Nature, 1999.
401(6755): p. 815-8.
126. Li, J., A.N. Meyer, and D.J. Donoghue, Nuclear localization of cyclin B1
mediates its biological activity and is regulated by phosphorylation. Proc
Natl Acad Sci U S A, 1997. 94(2): p. 502-7.
127. Walsh, S., S.S. Margolis, and S. Kornbluth, Phosphorylation of the cyclin b1
cytoplasmic retention sequence by mitogen-activated protein kinase and Plx.
Mol Cancer Res, 2003. 1(4): p. 280-9.
128. Yang, J., et al., Control of cyclin B1 localization through regulated binding
of the nuclear export factor CRM1. Genes Dev, 1998. 12(14): p. 2131-43.
129. Solomon, M.J., T. Lee, and M.W. Kirschner, Role of phosphorylation in
p34cdc2 activation: identification of an activating kinase. Mol Biol Cell,
1992. 3(1): p. 13-27.
130. Sebastian, B., A. Kakizuka, and T. Hunter, Cdc25M2 activation of cyclindependent kinases by dephosphorylation of threonine-14 and tyrosine-15.
Proc Natl Acad Sci U S A, 1993. 90(8): p. 3521-4.
131. Krek, W. and E.A. Nigg, Differential phosphorylation of vertebrate p34cdc2
kinase at the G1/S and G2/M transitions of the cell cycle: identification of
major phosphorylation sites. EMBO J, 1991. 10(2): p. 305-16.
132. Palmer, A., A.C. Gavin, and A.R. Nebreda, A link between MAP kinase and
p34(cdc2)/cyclin B during oocyte maturation: p90(rsk) phosphorylates and
inactivates the p34(cdc2) inhibitory kinase Myt1. EMBO J, 1998. 17(17): p.
5037-47.
133. Strausfeld, U., et al., Dephosphorylation and activation of a p34cdc2/cyclin
B complex in vitro by human CDC25 protein. Nature, 1991. 351(6323): p.
242-5.
134. Honda, R., et al., Dephosphorylation of human p34cdc2 kinase on both Thr14 and Tyr-15 by human cdc25B phosphatase. FEBS Lett, 1993. 318(3): p.
331-4.
107
135. Graves, P.R., et al., The Chk1 protein kinase and the Cdc25C regulatory
pathways are targets of the anticancer agent UCN-01. J Biol Chem, 2000.
275(8): p. 5600-5.
136. Peng, C.Y., et al., C-TAK1 protein kinase phosphorylates human Cdc25C on
serine 216 and promotes 14-3-3 protein binding. Cell Growth Differ, 1998.
9(3): p. 197-208.
137. Matsuoka, S., M. Huang, and S.J. Elledge, Linkage of ATM to cell cycle
regulation by the Chk2 protein kinase. Science, 1998. 282(5395): p. 1893-7.
138. Peng, C.Y., et al., Mitotic and G2 checkpoint control: regulation of 14-3-3
protein binding by phosphorylation of Cdc25C on serine-216. Science, 1997.
277(5331): p. 1501-5.
139. Dalal, S.N., et al., Cytoplasmic localization of human cdc25C during
interphase requires an intact 14-3-3 binding site. Mol Cell Biol, 1999. 19(6):
p. 4465-79.
140. Sanchez, Y., et al., Conservation of the Chk1 checkpoint pathway in
mammals: linkage of DNA damage to Cdk regulation through Cdc25.
Science, 1997. 277(5331): p. 1497-501.
141. Furnari, B., N. Rhind, and P. Russell, Cdc25 mitotic inducer targeted by
chk1 DNA damage checkpoint kinase. Science, 1997. 277(5331): p. 1495-7.
142. Foley, E.A. and T.M. Kapoor, Microtubule attachment and spindle assembly
checkpoint signalling at the kinetochore. Nat Rev Mol Cell Biol, 2013.
14(1): p. 25-37.
143. Rapkine, L., Sur les processus chimiques au cours de la division cellulaire.
Ann. Physiol. Physicochim. Biol. , 1931. 7: p. 382–418.
144. Kawamura, N., Cytochemical and quantitative study of protein-bound
sulfhydryl and disulfide groups in eggs of Arbacia during the first cleavage.
Exp Cell Res, 1960. 20: p. 127-38.
145. Mauro, F., A. Grasso, and L.J. Tolmach, Variations in sulfhydryl, disulfide,
and protein content during synchronous and asynchronous growth of HeLa
cells. Biophys J, 1969. 9(11): p. 1377-97.
108
146. Tu, B.P., et al., Logic of the yeast metabolic cycle: temporal
compartmentalization of cellular processes. Science, 2005. 310(5751): p.
1152-8.
147. Jonas, C.R., et al., Extracellular thiol/disulfide redox state affects
proliferation rate in a human colon carcinoma (Caco2) cell line. Free Radic
Biol Med, 2002. 33(11): p. 1499-506.
148. Li, N. and T.D. Oberley, Modulation of antioxidant enzymes, reactive
oxygen species, and glutathione levels in manganese superoxide dismutaseoverexpressing NIH/3T3 fibroblasts during the cell cycle. J Cell Physiol,
1998. 177(1): p. 148-60.
149. Conour, J.E., W.V. Graham, and H.R. Gaskins, A combined in
vitro/bioinformatic investigation of redox regulatory mechanisms governing
cell cycle progression. Physiol Genomics, 2004. 18(2): p. 196-205.
150. Oberley, T.D., et al., Antioxidant enzyme levels as a function of growth state
in cell culture. Free Radic Biol Med, 1995. 19(1): p. 53-65.
151. Sarsour, E.H., A.L. Kalen, and P. Goswami, Manganese superoxide
dismutase regulates a redox cycle within the cell cycle. Antioxid Redox
Signal, 2013.
152. Sarsour, E.H., et al., Redox control of the cell cycle in health and disease.
Antioxid Redox Signal, 2009. 11(12): p. 2985-3011.
153. Bae, Y.S., et al., Epidermal growth factor (EGF)-induced generation of
hydrogen
peroxide.
Role
in
EGF
receptor-mediated
tyrosine
phosphorylation. J Biol Chem, 1997. 272(1): p. 217-21.
154. Sundaresan, M., et al., Requirement for generation of H2O2 for plateletderived growth factor signal transduction. Science, 1995. 270(5234): p. 2969.
155. DeYulia, G.J., Jr., et al., Hydrogen peroxide generated extracellularly by
receptor-ligand interaction facilitates cell signaling. Proc Natl Acad Sci U S
A, 2005. 102(14): p. 5044-9.
109
156. Krieger-Brauer, H.I. and H. Kather, Antagonistic effects of different
members of the fibroblast and platelet-derived growth factor families on
adipose conversion and NADPH-dependent H2O2 generation in 3T3 L1cells. Biochem J, 1995. 307 ( Pt 2): p. 549-56.
157. Rhee, S.G., Redox signaling: hydrogen peroxide as intracellular messenger.
Exp Mol Med, 1999. 31(2): p. 53-9.
158. Chu, C.T., et al., Oxidative neuronal injury. The dark side of ERK1/2. Eur J
Biochem, 2004. 271(11): p. 2060-6.
159. Nishida, M., et al., Activation mechanism of Gi and Go by reactive oxygen
species. J Biol Chem, 2002. 277(11): p. 9036-42.
160. Li, F., et al., Superoxide mediates direct current electric field-induced
directional migration of glioma cells through the activation of AKT and
ERK. PLoS One, 2013. 8(4): p. e61195.
161. Sun, Y. and L.W. Oberley, Redox regulation of transcriptional activators.
Free Radic Biol Med, 1996. 21(3): p. 335-48.
162. Cho, Y., et al., Crystal structure of a p53 tumor suppressor-DNA complex:
understanding tumorigenic mutations. Science, 1994. 265(5170): p. 346-55.
163. Rainwater, R., et al., Role of cysteine residues in regulation of p53 function.
Mol Cell Biol, 1995. 15(7): p. 3892-903.
164. Toledano, M.B. and W.J. Leonard, Modulation of transcription factor NFkappa B binding activity by oxidation-reduction in vitro. Proc Natl Acad Sci
U S A, 1991. 88(10): p. 4328-32.
165. Abate, C., et al., Redox regulation of fos and jun DNA-binding activity in
vitro. Science, 1990. 249(4973): p. 1157-61.
166. Burch, P.M. and N.H. Heintz, Redox regulation of cell-cycle re-entry: cyclin
D1 as a primary target for the mitogenic effects of reactive oxygen and
nitrogen species. Antioxid Redox Signal, 2005. 7(5-6): p. 741-51.
167. Klatt, P., et al., Redox regulation of c-Jun DNA binding by reversible Sglutathiolation. FASEB J, 1999. 13(12): p. 1481-90.
110
168. Bergholtz, S., et al., The highly conserved DNA-binding domains of A-, Band c-Myb differ with respect to DNA-binding, phosphorylation and redox
properties. Nucleic Acids Res, 2001. 29(17): p. 3546-56.
169. Nakshatri, H., P. Bhat-Nakshatri, and R.A. Currie, Subunit association and
DNA binding activity of the heterotrimeric transcription factor NF-Y is
regulated by cellular redox. J Biol Chem, 1996. 271(46): p. 28784-91.
170. Menon, S.G., et al., Redox regulation of the G1 to S phase transition in the
mouse embryo fibroblast cell cycle. Cancer Res, 2003. 63(9): p. 2109-17.
171. Onumah, O.E., et al., Overexpression of catalase delays G0/G1- to S-phase
transition during cell cycle progression in mouse aortic endothelial cells.
Free Radic Biol Med, 2009. 46(12): p. 1658-67.
172. Wang, H.P., et al., Phospholipid hydroperoxide glutathione peroxidase
induces a delay in G1 of the cell cycle. Free Radic Res, 2003. 37(6): p. 62130.
173. Martinez Munoz, C., et al., The effect of hydrogen peroxide on the cyclin D
expression in fibroblasts. Cell Mol Life Sci, 2001. 58(7): p. 990-6.
174. Yamauchi, A. and E.T. Bloom, Control of cell cycle progression in human
natural
killer
cells
through
redox
regulation
of
expression
and
phosphorylation of retinoblastoma gene product protein. Blood, 1997.
89(11): p. 4092-9.
175. Menon, S.G., et al., Superoxide signaling mediates N-acetyl-L-cysteineinduced G1 arrest: regulatory role of cyclin D1 and manganese superoxide
dismutase. Cancer Res, 2007. 67(13): p. 6392-9.
176. Havens, C.G., et al., Regulation of late G1/S phase transition and APC Cdh1
by reactive oxygen species. Mol Cell Biol, 2006. 26(12): p. 4701-11.
177. Savitsky, P.A. and T. Finkel, Redox regulation of Cdc25C. J Biol Chem,
2002. 277(23): p. 20535-40.
178. Sohn, J. and J. Rudolph, Catalytic and chemical competence of regulation of
cdc25 phosphatase by oxidation/reduction. Biochemistry, 2003. 42(34): p.
10060-70.
111
179. Chang, T.S., et al., Regulation of peroxiredoxin I activity by Cdc2-mediated
phosphorylation. J Biol Chem, 2002. 277(28): p. 25370-6.
180. Kalen, A.L., et al., Mn-superoxide dismutase overexpression enhances G2
accumulation and radioresistance in human oral squamous carcinoma cells.
Antioxid Redox Signal, 2006. 8(7-8): p. 1273-81.
181. Thomas, C.G., et al., Vitamin C transiently arrests cancer cell cycle
progression in S phase and G2/M boundary by modulating the kinetics of
activation and the subcellular localization of Cdc25C phosphatase. J Cell
Physiol, 2005. 205(2): p. 310-8.
182. Obin, M., et al., Redox regulation of ubiquitin-conjugating enzymes:
mechanistic insights using the thiol-specific oxidant diamide. FASEB J,
1998. 12(7): p. 561-9.
183. Demasi, M., G.M. Silva, and L.E. Netto, 20 S proteasome from
Saccharomyces cerevisiae is responsive to redox modifications and is Sglutathionylated. J Biol Chem, 2003. 278(1): p. 679-85.
184. Li, Y.P., et al., Hydrogen peroxide stimulates ubiquitin-conjugating activity
and expression of genes for specific E2 and E3 proteins in skeletal muscle
myotubes. Am J Physiol Cell Physiol, 2003. 285(4): p. C806-12.
185. Galperin, M.Y. and E.V. Koonin, A diverse superfamily of enzymes with
ATP-dependent carboxylate-amine/thiol ligase activity. Protein Sci, 1997.
6(12): p. 2639-43.
186. Bauer, K., et al., Characterization and biosynthesis of omega-aminoacyl
amino acids from rat brain and the C-6 glioma cell line. J Biol Chem, 1979.
254(14): p. 6402-7.
187. Bauer, K., et al., Biosynthesis of carnosine and related peptides by glial cells
in primary culture. J Biol Chem, 1982. 257(7): p. 3593-7.
188. Schulz, M., et al., Peptide uptake by astroglia-rich brain cultures. J
Neurochem, 1987. 49(3): p. 748-55.
112
189. Hoffmann, A.M., A. Bakardjiev, and K. Bauer, Carnosine-synthesis in
cultures of rat glial cells is restricted to oligodendrocytes and carnosine
uptake to astrocytes. Neurosci Lett, 1996. 215(1): p. 29-32.
190. Biffo, S., M. Grillo, and F.L. Margolis, Cellular localization of carnosinelike and anserine-like immunoreactivities in rodent and avian central
nervous system. Neuroscience, 1990. 35(3): p. 637-51.
191. Bakardjiev, A. and K. Bauer, Transport of beta-alanine and biosynthesis of
carnosine by skeletal muscle cells in primary culture. Eur J Biochem, 1994.
225(2): p. 617-23.
192. Bauer, K. and M. Schulz, Biosynthesis of carnosine and related peptides by
skeletal muscle cells in primary culture. Eur J Biochem, 1994. 219(1-2): p.
43-7.
193. Perry, T.L., S. Hansen, and D.L. Love, Serum-carnosinase deficiency in
carnosinaemia. Lancet, 1968. 1(7554): p. 1229-30.
194. Lenney, J.F., et al., Characterization of human tissue carnosinase. Biochem
J, 1985. 228(3): p. 653-60.
195. Lenney, J.F., et al., Human serum carnosinase: characterization, distinction
from cellular carnosinase, and activation by cadmium. Clin Chim Acta,
1982. 123(3): p. 221-31.
196. Bando, K., et al., Fluorometric assay of human serum carnosinase activity in
normal children, adults and patients with myopathy. Ann Clin Biochem,
1984. 21 ( Pt 6): p. 510-4.
197. Perry, T.L., et al., Homocarnosine in human cerebrospinal fluid: an agedependent phenomenon. J Neurochem, 1968. 15(10): p. 1203-6.
198. Sobue, K., H. Konishi, and T. Nakajima, Isolation and identification of Nacetylhomocarnosine and N-acetylcarnosine from brain and muscle. J
Neurochem, 1975. 24(6): p. 1261-2.
199. Kish, S.J., T.L. Perry, and S. Hansen, Regional distribution of
homocarnosine, homocarnosine-carnosine synthetase and homocarnosinase
in human brain. J Neurochem, 1979. 32(6): p. 1629-36.
113
200. Crush, K.G., Carnosine and related substances in animal tissues. Comp
Biochem Physiol, 1970. 34(1): p. 3-30.
201. I.R., M., Enzymatic synthesis of anserine in skeletal muscle by Nmethylation of carnosine. The Journal of Biological Chemistry 1962. 237: p.
1207-1211.
202. Jackson, M.C., C.M. Kucera, and J.F. Lenney, Purification and properties of
human serum carnosinase. Clin Chim Acta, 1991. 196(2-3): p. 193-205.
203. ChemSpider Free chemical structure database, www.chemspider.com
204. Brown, C.E. and W.E. Antholine, Multiple forms of the cobalt(II)-carnosine
complex. Biochem Biophys Res Commun, 1979. 88(2): p. 529-36.
205. Viola, R.E., C.R. Hartzell, and J.J. Villafranca, Copper(II) complexes of
carnosine, glycylglycine, and glycylglycine-imidazole mixtures. Journal of
Inorganic Biochemistry, 1979. 10(4): p. 293-307.
206. Aruoma, O.I., M.J. Laughton, and B. Halliwell, Carnosine, homocarnosine
and anserine: could they act as antioxidants in vivo? Biochem J, 1989.
264(3): p. 863-9.
207. Kang, J.H., Protective effects of carnosine and homocarnosine on ferritin
and hydrogen peroxide-mediated DNA damage. BMB Rep, 2010. 43(10): p.
683-7.
208. Renner, C., Seyffarth, A., Garcia de Arriba, S., Meixensberger, J., Gebhardt,
R., Gaunitz, F., Carnosine Inhibits Growth of Cells Isolated from Human
Glioblastoma Multiforme. International Journal of Peptide Research and
Therapeutics 2008. 14: p. 127-135.
209. Iovine, B., et al., Carnosine inhibits KRAS-mediated HCT116 proliferation
by affecting ATP and ROS production. Cancer Lett, 2012. 315(2): p. 122-8.
210. Rybakova, Y.S. and A.A. Boldyrev, Effect of Carnosine and Related
Compounds on Proliferation of Cultured Rat Pheochromocytoma PC-12
Cells. Bulletin of Experimental Biology and Medicine, 2012. 154(1): p. 136140.
114
211. Dahl, T.A., W.R. Midden, and P.E. Hartman, SOME PREVALENT
BIOMOLECULES AS DEFENSES AGAINST SINGLET OXYGEN
DAMAGE. Photochemistry and Photobiology, 1988. 47(3): p. 357-362.
212. Hartman, P.E., Z. Hartman, and K.T. Ault, Scavenging of singlet molecular
oxygen by imidazole compounds: high and sustained activities of carboxy
terminal histidine dipeptides and exceptional activity of imidazole-4-acetic
acid. Photochem Photobiol, 1990. 51(1): p. 59-66.
213. Швачко,
А.Г.,
Формазюк,
В.Е.,
Сергиенко
В.И.,
Тушение
хемилюминесценции синглетного кислорода в присутствии карнозина.
1990: p. 155-156.
214. Brawn, K. and I. Fridovich, DNA strand scission by enzymically generated
oxygen radicals. Arch Biochem Biophys, 1981. 206(2): p. 414-9.
215. Klebanov, G.I., et al., Effect of carnosine and its components on free-radical
reactions. Membr Cell Biol, 1998. 12(1): p. 89-99.
216. RUBTSOV,
A.,
et
al.,
HYDROXYL
RADICAL-SCAVENGING
ACTIVITY OF CARNOSINE - A SPIN TRAPPING STUDY. Acta
Pharmaceutica Jugoslavika, 1991. 41(4): p. 401-407.
217. Poli, G. and R.J. Schaur, 4-Hydroxynonenal in the pathomechanisms of
oxidative stress. IUBMB Life, 2000. 50(4-5): p. 315-21.
218. Северин С. Е., Б.А.А., Стволинский С. Л., Бордюков, М.М.,
Гончаренко, Е.Н., Деев, Л.И., Малинина, И.Е., Кудряшов, Ю.Е. , О
радиомодифицирующих свойствах карнозина. Радиобиология, 1990.
30(6): p. 765-768.
219. Курелла, Е.Г., Мальцева, В. В., Сеславина, С. Л., Стволинский, С. Л.,
Стимулирующее действие карнозина на гемопоэтические стволовые
клетки. Бюл. эксп. биол. мед, 1991. 7: p. 52-53.
220. Мальцева, В.В., Сергиенко, В. И., Стволинский, С.Л., Влияние
карнозина на активность гемопоэтических стволовых клеток у
облученных животных. Биохимия, 1992. 57(9): p. 1378-1382.
115
221. Hayflick, L., THE LIMITED IN VITRO LIFETIME OF HUMAN
DIPLOID CELL STRAINS. Exp Cell Res, 1965. 37: p. 614-36.
222. McFarland, G.A. and R. Holliday, Further evidence for the rejuvenating
effects of the dipeptide L-carnosine on cultured human diploid fibroblasts.
Exp Gerontol, 1999. 34(1): p. 35-45.
223. Shao, L., Q.H. Li, and Z. Tan, L-carnosine reduces telomere damage and
shortening rate in cultured normal fibroblasts. Biochem Biophys Res
Commun, 2004. 324(2): p. 931-6.
224. Levy, M.Z., et al., Telomere end-replication problem and cell aging. J Mol
Biol, 1992. 225(4): p. 951-60.
225. Renner, C., et al., Carnosine inhibits ATP production in cells from malignant
glioma. Neurol Res, 2010. 32(1): p. 101-5.
226. McFarland, G. and R. Holliday, Differential response of embryonic stem
cells and teratocarcinoma cells to carnosine. In Vitro Cell Dev Biol Anim,
1999. 35(1): p. 15-6.
227. Asperger, A., et al., Identification of factors involved in the anti-tumor
activity of carnosine on glioblastomas using a proteomics approach. Cancer
Invest, 2011. 29(4): p. 272-81.
228. Tsuchiya, H., T. Iseda, and O. Hino, Identification of a novel protein (VBP1) binding to the von Hippel-Lindau (VHL) tumor suppressor gene product.
Cancer Res, 1996. 56(13): p. 2881-5.
229. Luo, W., et al., Hsp70 and CHIP selectively mediate ubiquitination and
degradation of hypoxia-inducible factor (HIF)-1alpha but Not HIF-2alpha. J
Biol Chem, 2010. 285(6): p. 3651-63.
230. Hohfeld, J. and S. Jentsch, GrpE-like regulation of the hsc70 chaperone by
the anti-apoptotic protein BAG-1. EMBO J, 1997. 16(20): p. 6209-16.
231. Borges, J.C., et al., Free human mitochondrial GrpE is a symmetric dimer in
solution. J Biol Chem, 2003. 278(37): p. 35337-44.
232. Graner, M.W., et al., Heat shock protein 70-binding protein 1 is highly
expressed in high-grade gliomas, interacts with multiple heat shock protein
116
70 family members, and specifically binds brain tumor cell surfaces. Cancer
Sci, 2009. 100(10): p. 1870-9.
233. Kizaka-Kondoh, S., et al., The HIF-1-active microenvironment: an
environmental target for cancer therapy. Adv Drug Deliv Rev, 2009. 61(78): p. 623-32.
234. Rybakova, Y., et al., Receptor-mediated oxidative stress in murine cerebellar
neurons is accompanied by phosphorylation of MAP (ERK 1/2) kinase. Curr
Aging Sci, 2012. 5(3): p. 225-30.
235. Dong, J., et al., EGFR-independent activation of p38 MAPK and EGFRdependent activation of ERK1/2 are required for ROS-induced renal cell
death. Am J Physiol Renal Physiol, 2004. 287(5): p. F1049-58.
236. Kulebyakin, K., et al., Carnosine protects neurons against oxidative stress
and modulates the time profile of MAPK cascade signaling. Amino Acids,
2012. 43(1): p. 91-6.
237. Ashmarin, I.P., et al., Natural and hybrid ("chimeric") stable regulatory
glyproline peptides. Pathophysiology, 2005. 11(4): p. 179-185.
238. Gomazkov, O.A., [Regulatory molecular mechanisms of the neurochemical
processes. History and the present time]. Usp Fiziol Nauk, 2003. 34(3): p.
42-54.
239. Anisimov, V.N., et al., Effect of Epitalon on biomarkers of aging, life span
and spontaneous tumor incidence in female Swiss-derived SHR mice.
Biogerontology, 2003. 4(4): p. 193-202.
240. Khavinson, V., et al., Effects of pancragen on the differentiation of
pancreatic cells during their ageing. Bull Exp Biol Med, 2013. 154(4): p.
501-4.
241. Khavinson, V., et al., Tetrapeptide H-Ala-Glu-Asp-Arg-OH stimulates
expression of cytoskeletal and nuclear matrix proteins. Bull Exp Biol Med,
2012. 153(4): p. 559-62.
117
242. Lin'kova, N.S., B.I. Kuznik, and V. Khavinson, [Peptide Ala-Glu-Asp-Gly
and interferon gamma: their role in immune response during aging]. Adv
Gerontol, 2012. 25(3): p. 478-82.
243. Sevostianova, N.N., et al., Immunomodulating effects of Vilon and its
analogue in the culture of human and animal thymus cells. Bull Exp Biol
Med, 2013. 154(4): p. 562-5.
244. Kozina, L.S., [Investigation of antihypoxic properties of short peptides].
Adv Gerontol, 2008. 21(1): p. 61-7.
245. Kozina, L.S., et al., [Biological activity of regulatory peptides in model
experiments in vitro]. Adv Gerontol, 2008. 21(1): p. 68-73.
246. Arutjunyan, A., et al., Pinealon protects the rat offspring from prenatal
hyperhomocysteinemia. Int J Clin Exp Med, 2012. 5(2): p. 179-85.
247. Khavinson, V., et al., Pinealon increases cell viability by suppression of free
radical levels and activating proliferative processes. Rejuvenation Res, 2011.
14(5): p. 535-41.
248. Fedoreyeva, L.I., et al., Penetration of short fluorescence-labeled peptides
into the nucleus in HeLa cells and in vitro specific interaction of the peptides
with deoxyribooligonucleotides and DNA. Biochemistry (Mosc), 2011.
76(11): p. 1210-9.
249. Khavinson, V.K., L.I. Fedoreyeva, and B.F. Vanyushin, Site-Specific
Binding of Short Peptides with DNA Modulated Eukaryotic Endonuclease
Activity. Bulletin of Experimental Biology and Medicine, 2011. 151(1): p.
66-70.
250. Chen, X., et al., 2',7'-Dichlorodihydrofluorescein as a fluorescent probe for
reactive oxygen species measurement: Forty years of application and
controversy. Free Radic Res, 2010. 44(6): p. 587-604.
251. Patel, D.J. and C. Shen, Sugar pucker geometries at the intercalation site of
propidium diiodide into miniature RNA and DNA duplexes in solution. Proc
Natl Acad Sci U S A, 1978. 75(6): p. 2553-7.
118
252. Waring, M.J., Complex formation between ethidium bromide and nucleic
acids. J Mol Biol, 1965. 13(1): p. 269-82.
253. Arndt-Jovin, D.J. and T.M. Jovin, Fluorescence labeling and microscopy of
DNA. Methods Cell Biol, 1989. 30: p. 417-48.
254. Sarsour, E.H., et al., Manganese superoxide dismutase protects the
proliferative capacity of confluent normal human fibroblasts. J Biol Chem,
2005. 280(18): p. 18033-41.
255. Laemmli, U.K., Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature, 1970. 227(5259): p. 680-5.
256. Weydert, C.J., et al., Inhibition of oral cancer cell growth by
adenovirusMnSOD plus BCNU treatment. Free Radic Biol Med, 2003.
34(3): p. 316-29.
257. Aebi, H., Catalase in vitro. Methods Enzymol, 1984. 105: p. 121-6.
258. Harms, W.S. and T. Winnick, Further studies of the biosynthesis of
carnosine and anserine in vertebrates. Biochim Biophys Acta, 1954. 15(4):
p. 480-8.
259. Boldyrev, A.A., et al., The antioxidative properties of carnosine, a natural
histidine containing dipeptide. Biochem Int, 1987. 15(6): p. 1105-13.
260. Gaunitz, F. and A.R. Hipkiss, Carnosine and cancer: a perspective. Amino
Acids, 2012. 43(1): p. 135-42.
261. Chaudhuri, L., et al., Preferential selection of MnSOD transcripts in
proliferating normal and cancer cells. Oncogene, 2012. 31(10): p. 1207-16.
262. Oberley, L.W., Mechanism of the tumor suppressive effect of MnSOD
overexpression. Biomed Pharmacother, 2005. 59(4): p. 143-8.
263. Venkataraman, S., et al., Manganese superoxide dismutase overexpression
inhibits the growth of androgen-independent prostate cancer cells.
Oncogene, 2005. 24(1): p. 77-89.
264. Leinsoo, T.A., H. Abe, and A.A. Boldyrev, [Carnosine and relative
compounds protect double-stranded DNA from oxidative damage]. Zh Evol
Biokhim Fiziol, 2006. 42(5): p. 453-6.
119
265. Rauen, U., S. Klempt, and H. de Groot, Histidine-induced injury to cultured
liver cells, effects of histidine derivatives and of iron chelators. Cell Mol
Life Sci, 2007. 64(2): p. 192-205.
266. THE INTERNET JOURNAL OF VIBRATIONAL SPECTROSCOPY 1(2).
267. Anisimov, V.N., The role of pineal gland in breast cancer development. Crit
Rev Oncol Hematol, 2003. 46(3): p. 221-34.
268. Kossoy, G., et al., Effect of the synthetic pineal peptide epitalon on
spontaneous carcinogenesis in female C3H/He mice. In Vivo, 2006. 20(2):
p. 253-7.
269. Louis, D.N., et al., The 2007 WHO classification of tumours of the central
nervous system. Acta Neuropathol, 2007. 114(2): p. 97-109.
270. Kesari, S., Understanding glioblastoma tumor biology: the potential to
improve current diagnosis and treatments. Semin Oncol, 2011. 38 Suppl 4:
p. S2-10.
271. Fu, H., et al., Free radical scavenging and radioprotective effects of
carnosine and anserine. Radiation Physics and Chemistry, 2009. 78(12): p.
1192-1197.
120
Скачать