Восстановление экспрессии дистрофина в mdx опосредованного пропуска экзона.

advertisement
Восстановление экспрессии дистрофина в
клетках mdx мышей при помощи химеропластопосредованного пропуска экзона.
1. Carmen Bertoni1,
2. Catherine Lau1 and
3. Thomas A. Rando1,2,*
+ Author Affiliations
1.
1


Received December 15, 2002.
Accepted March 18, 2002
Department of Neurology and Neurological Sciences, Stanford University School of Medicine, Stanford,
CA, USA and
2. 2GRECC, VA Palo Alto Health Care System, Palo Alto, CA, USA
В большинстве случаев мутации приводящие к миодистрофии Дюшена представлены большими
делециями, что приводит к сдвигу рамки считывания. В результате в мышцах таких индивидов
отсутствует или значительно снижено содержание дистрофина Любое лечебное воздействие, которое
может восстановить рамку считывания, потенциально способно уменьшить серьезность болезни, позволяя
производить частично функциональный дистрофин, как встречается при мышечной дистрофии Беккера
(МДБ). Один подход к восстановлению рамки считывания должен был бы изменить соединение пре мРНК,
чтобы произвести изменения в структуре. Мы проверили способность РНК/ДНК олигонуклеатидов
(химеропластов) изменить ключевые основы в определенных последовательностях в гене дистрофина,
чтобы вызвать пропуск экзона. Используя клетки mdx мыши как модель болезни, мы показываем, что
химеропласт-опосредованное преобразование в соединении интрон22/экзон 23 вызывает альтернативное
соединение и производство транскриптов. Действительно, множественные формы дистрофина
наблюдались вестерн-блот-анализом, и функциональность продуктов была продемонстрирована
восстановлением экспрессии и локализацией дистрофин-связанного белка, α-дистрогликана, в
дифференцированных клетках. Эти данные демонстрируют, что химеропласты могут вызвать пропуск
экзона, изменяя последовательности места соединения на геномном уровне. Также, у химеропластопосредованного пропуска экзона есть потенциал, который будет использоваться, чтобы преобразовать
тяжелый фенотип МДД в намного более умеренный фенотип МДБ.
Предисловие
Мышечная дистрофия Дюшена (МДД) и Беккера (МДБ) являются болезнями мышц с Х сцепленным
рецессивным типом наследования, вызванными дефектами в гене на 2.5 МБ, который кодирует белок
дистрофин. (1). Больше чем у 80 % пациентов с МДД или МДБ есть большие делеции в гене дистрофина,
дупликации, маленькие делеции, вставки и точечные мутации составляют остальные случаи (2). В общем
тяжелый фенотип МДД вызван мутациями, такими как делеции сдвига рамки считывания и точечные
мутации, вызывающие дефицит дистрофина. Более умеренный фенотип МДБ обычно коррелирует с
делециями, которые сохраняют рамку считывания и производит внутренне измененый, но частично
функциональный, дистрофин(3). Таким образом у любого лечебного воздействия, которое могло
преобразовать мутацию со сдвигом рамки считывания в мутацию без сдвига рамки считывания, есть
потенциал, чтобы преобразовать тяжелый фенотип МДД в более умеренный фенотип МДБ.
Наиболее широко изученные стратегии по восстановлению экспрессии дистрофина у дистрофин
дефицитных мышцей используют вирусную поставку функциональной комплементарнойой ДНК ,
кодирующей дистрофин (4–7). Этот подход был эффективен на моделях животных и дает надежду для
применения у людей. Кроме того этот подход применим к лечению любого типа мутации МДД, не только
делецию сдвига рамки считывания. Однако, вирусные системы доставки сталкиваются с трудностями,
такими как врожденный иммунный ответ против векторов, проблемы, связанные с вирусной интеграцией
в геном, и адекватным регулированием экспрессии поставленного гена. Несколько групп исследователей
изучают возможность использования антисмысловых олигонуклеотидов, чтобы изменить обработку
транскрипта дистрофина, и вызвать пропуск экзона и мутации со сдвигом рамки считывания перевести в
мутации без сдвига рамки считывания (8–12). Эта технология избегает некоторых из препятствий
вирусной опосредованной генотерапии. Однако, этот подход потребовал бы повторенной поставки
олигонуклеотидов, чтобы поддержать экспрессию дистрофина, или возникнет потребность в длительной
экспрессии антисмыслового транскрипта, как могло бы быть достигнуто с вирусной системой доставки
(8). Привлекательная альтернатива антисмысловому пропуску экзона восстановление трансляционной
рамки считывания, которая была бы генной стратегией модификации. Текущие генные стратегии
репарации, которые могли быть применены к этой проблеме, включают технологии, вовлекающие
химерные олигонуклеатиды, одноцепочечные ДНК олигонуклеатиды, и
гомологичные короткие
фрагменты (13,14).
Генная репарация, вовлекающая химерные РНК/ДНК олигонуклеатиды (химеропласты), основана на
активности этих векторов вызвать преобразования пары оснований на геномном уровне (15). Их механизм
действия вовлекает использование врожденной репарации в клетке, направляя замену единственного
основания в определенной последовательности ДНК (16,17). Химеропласт-опосредованная генная
репарация была успешно применена к различным типам клеток, и in vitro и в естественных условиях (18–
25). Хотя прежде всего изучено применение для того, чтобы восстановить точечные мутации, у
химеропласт-опосредованных последовательностей также есть потенциал, чтобы изменить соединение и
таким образом восстановить рамку считывания в гене с мутацией со сдвигом рамки считывании
Хотя прежде всего изучено применение для того, чтобы восстановить точечные мутации, у химеропластопосредованных преобразований последовательностей сайтов сплайсинга также есть потенциал, чтобы
изменить сплайсинг и таким образом восстановить трансляционную рамку считывания в гене с мутацией
со сдвигом рамки считывания.
В этом отчете мы исследовали возможность использования химеропластов, чтобы изменить сплайсинг
гена дистрофина. У образцовой системы, mdx мыши, есть мутация в экзоне 23 гена дистрофина, которая
ведет к отсутствию белка дистрофина. Мы ранее показали, что химеропласты в состоянии исправить эту
точечную мутацию и in vitro и в естественных условиях (20,21). Мы проверили, могла ли мутация
единственного основания в интроне 22/экзон 23 соединении изменить сплайсинг транскрипта дистрофина
с пропуском экзона 23. Предсказанный продукт, в котором экзон 22 непосредственно соединен к экзону
24, произвел бы белок дистрофин почти во всю длину. Хотя у mdx мышей нет делеции сдвига рамки
считывания, они обеспечивают возможность заняться исследованиями того, как устойчивые, одноосновные перестройки геномной ДНК могут использоваться, чтобы переадресовать соединение, которое
было бы применимо к мутациям со сдвигом рамки считывания в гене дистрофина. Мы нашли, что,
изменяя интрон 22/экзон 23 соединения действительно выдают транскрипты в структуре и сокращенные
формы белка дистрофина. Эти исследования расширяют терапевтическое применение химеропластопосредованных замен единственного основания для делеций сдвига
рамки считывания.
Результаты
Планирование химеропласта, названного MDX3 (Рис. 1A), было разработано, чтобы вызвать
преобразование G-T в экзоне 23 места акцептора интрона 22/экзон 23 соединения в гене дистрофина
мыши (Рис. 1B). Изменеие основания, на которое нацелен MDX3, закончилась бы разрушением интрона
22/экзон 23 последовательности и создало бы новый сайт рестрикции в этом положении (Рис. 1B).
Предсказанная последовательность транскрипта в результате соединения экзона 22 с экзоном 24 была бы
в рамке и приводила к синтезу белка на 71 аминокислоту короче чем дистрофин во всю длину. Как
контроль, мы использовали химерный олигонуклеотид, MDX4 (Рис. 1A), разработанный совершенно
комплементарным к интрону 22/экзон 23 и таким образом не имеющий никакой активности и не
вызывающий изменение геномной последовательности
Большая версия изображения
In this page
In a new window
Download as PowerPoint Slide
Рисунок 1
Признаки химеропласт-опосредованной замены одного основания на геномном уровне
Специфичность MDX3 вызвать преобразование G-T в интроне 22/экзоне 23 была оценена, используя
пробу ARMS геномной ДНК. Клетки были поддержаны в культуре в течение по крайней мере 15 дней
после
трансфекции химеропласта. Используя инициаторы ПЦР, разработанные, чтобы усилить
последовательность, имеющую трансверсию G-T, мы наблюдали определенный продукт амплификации
только в клетках, инфицированных вирусом с целевым
химеропластом (Рис. 2A). Клетки,
инфицированные вирусом с контрольным химеропластом или неинфицированными вирусом клетками,
были не в состоянии произвести любой продукт амплификации, используя эти инициаторы.
Большая версия изображения
In this page
In a new window
Download as PowerPoint Slide
Рисунок 2..
Преобразование
G-T
целевым
химеропластом
было
также
подтверждено прямым усвоением продуктов амплификации ПЦР(Рис. 2B). Инфицированные вирусом
клетки были поддержаны в культуре больше 45 дней, затем геномная ДНК была извлечена. Определенные
инициаторы ПЦР использовались, чтобы произвести продукт амплификации 150 bp, которые содержали
интрон 22/экзон 23 соединения , которые были подтверждены прямым отщеплением. После очистки
продукты ПЦР были подвергнуты перевариванию, используя Hinf I эндонуклеазы. Продукты
переваривания в ожидаемом размере ∼50 и 100 bp наблюдались от клеток, инфицированных вирусом с
MDX3 (Рис. 2B), демонстрируя, что нацеленые химеропласты вызвали единственную замену пары
оснований.
Чтобы проанализировать далее признаки генной модификации на геномном уровне, мы непосредственно
упорядочивали продукты ПЦР-амплификации интрона 22/экзон 23 соединения от клеток контроля и
MDX3-инфицированного-вирусом. Преобразование G-T могло быть обнаружено после одного
раундаПЦР- амплификации, и подтверждено после второго раунда амплификации, только в MDX3инфицированных-вирусом клетках (Рис. 2C). Эти результаты были воспроизведены в 10 независимых
экспериментах и были подтверждены анализом последовательности, используя и простые и обратные
инициаторы. Эти результаты подтверждают изменение основания нацеленным химеропластом в
субпопуляции инфицированных вирусом клеток на геномном уровне.
Экспрессия белка дистрофина в химеропласт-леченных mdx мышечных клетках
Восстановление экспрессии дистрофина было оценено спустя 3 недели после трансфекции и 24–96 часов
после индукции дифференцировки как ранее описано (20). Вестерн-блоттинг используя антитела к области
белка дистрофина продемонстрировал по крайней мере два различных белковых продукта, молекулярные
массы которых были меньше чем дистрофин во всю длину (Рис. 3A). Антитела, направленные к Cтерминальной области, подтвердили экспрессию этих двух продуктов, но также и показало наличие
третьего белкового продукта еще более низкой молекулярной массы (Рис. 3A). Основанный на
специфичности антител, большие продукты содержали экзон 31/32 область белка, тогда как меньший
продукт не содержал. Возможно получить только грубое приближение молекулярных масс этих
продуктов. Все белки двигались быстрее чем дистрофин или утрофин, таким образом устанавливая 400
kDa как верхний предел их размеров, и все белки двигались медленнее чем самый высокий маркер
молекулярной массы 200 kDa, таким образом устанавливая более низкий предел. Два более тяжелых белка
(Рис. 3A) молекулярной массы были ближе к 400 kDa концам спектра, и более низкой молекулярной
массы (признанный только антителом против C-терминальной области белка) двигалась ближе к 200
концам kDa. Эта структура белков дистрофина была получена в пяти независимых экспериментах и была
подтверждена иммунопреципитацией. Кроме того эта структура экспрессии присутствовала в культурах
мышечных клеток, полученных из MDX3-инфицированных-вирусом миобластов, которые
поддерживались
в течение 3 месяцев после трансфекции, подтверждая, что эффект
лечения
химеропластом был устойчиво унаследован.
Большая версия изображения
In this page
In a new window
Download as PowerPoint Slide
Рисунок 3.
Мы ранее использовали вестерн-блот-анализ, чтобы количественно
определить уровень экспрессии дистрофина в культурах mdx клеток, инфицированных вирусом с
химеропластом, таким образом обеспечивая меру эффективности конверсии гена (20). В этом текущем
исследовании, однако, наличие многократных связок на вестерн-блоттингах сделало эту меру из
эффективности более трудной. Как альтернативный подход, мы построили стандартную кривую,
используя смесь экстрактов из C57 и mdx мышечных волокон, чтобы определить предел нашей
способности обнаружить белковую экспрессию дистрофина вестерн-блот-анализом. Согласно этим
исследованиям, мог быть обнаружен дистрофин, пока процент клеток с экспрессией дистрофина был
больше чем 1 %. Таким образом мы пришли к заключению, что эффективность замены одного основания
установленая MDX3 химеропластом, была в диапазоне 1-5 %. Этот диапазон подобен тому, что ранее
сообщалось для химеропласта, разработанного, чтобы исправить mdx мутацию (20,21) ), и находится в
диапазоне химеропласт-опосредованного преобразования, показанного другими (19,23,26).
Экспрессия некоторых форм белка дистрофина в субпопуляции MDX3-инфицированных-вирусом клеток
была также подтверждена иммунным окрашиванием. Последовательно с результатами вестерн-блоттинга,
мы наблюдали группы дистрофин-положительных волокон после дифференцирования только в MDX3инфицированных-вирусом клетках (Рис. 3B). Иммунное окрашивание леченных клеток с определенными
для экзона анти-дистрофиновыми антителами подтвердило наличие внутренне измененных форм
дистрофина в мышечных волокнах, полученных из MDX3-инфицированных-вирусом клеток (Рис. 3C),
тогда как культуры мышечной волокон, полученные из неинфицированных вирусом клеток или из MDX4инфицированных-вирусом клеток, не окрашивали положительно ни одним из антител. В культурах
мышечных волокон, полученных из MDX3-инфицированных-вирусом клеток, групп мышечных волокон,
положительно окрашенных антителами против C-терминальной области и экзона 31/32 области
дистрофина, но ни одно из мышечных волокон, окрашенных положительно антителом против экзона 26
(Рис. 3C). Эти данные согласуются с данными о вестерн-блоттинге, указывая, что изменение интрона
22/экзон 23 места соединения заканчивается многократным пропуском экзонов, не только экзона 23 (Рис.
3A). Многократный пропуск экзона, как наблюдали другие исследователи, использующие антисмысловые
олигонуклеатиды, вмешался в интрон 22/экзон 23 соединения (9).
Восстановление экспрессии α-дистрогликана
Как было показано экспрессия α-дистрогликана (α-DG), большого компонента дистрофингликопротеинового комплекса снижено до 80-90% у mdx мышей из-за нехватки дистрофина (27). Мы
использовали иммунное окрашивание, чтобы определить, могли ли белки дистрофина, произведенные
разрушением интрона 22/экзон 23 соединения, восстановить экспрессию α-DG. Иммунное окрашивание
MDX3-инфицированных-вирусом культур, которые дифференцировались в течение 4 дней, подтвердило
локализацию α-DG в мембране сарколеммы в группах мышечных волокон (Рис. 4). Эти результаты ясно
демонстрируют, что по крайней мере один из произведенных белков был функционален, совместим с
функциональными свойствами спроектированных дистрофинов (28).
Большая версия изображения:
In this page
In a new window
Download as PowerPoint Slide
Рисунок 4.
Обнаружение измененных продуктов сплайсинга, вызванных MDX3
Основанное в иммунном окрашивании и иммуноблот-анализе использование определенных для экзона
антител, мы идентифицировали продукты измененного сплайсинга из-за пропуска экзона 23. Мы
использовали анализ RT–PCR, чтобы идентифицировать продукты
измененного сплайсинга, вызванные разрушением интрона 22/экзон 23
места соединения в клетках, которые были поддержаны в культуре
спустя 2 недели после трансфекция химеропласта. Мы проектировали определенные инициаторы,
перекрывающие экзон 22 до экзона 32 из гена дистрофина. Продукты, представляющие транскрипты во
всю длину, были амплифицированны от невылеченных и химеропласт-леченных клеток, используя эти
инициаторы (Рис. 5). Мы были неспособны обнаружить любые альтернативно соединенные транскрипты в
этой области в клетках, инфицированных вирусом с целенаправленным химеропластом (Рис. 5).
Отсутствие альтернативных продуктов соединения было также подтверждено введением дополнительного
шага амплификации RT–PCR, используя внутренние инициаторы (данные, не показанны).
Большая версия изображения:
In this page
In a new window
Download as PowerPoint Slide
Рисунок 5.
Мы поэтому расширяли наше исследование, используя инициаторы, которые охватили участок от экзона 9
до экзона 50 (Рис. 6A), таким образом покрывая почти 50 % всей ДНК дистрофина. Вторая амплификация
ПЦР была выполнена, используя пары инициатора (см. Материалы и Методы и Рис. 6A), расположенный в
области транскрипта ддистрофина, усиленного при первом шаге. Мы наблюдали пять продуктов
(маркировал ‘b’, ‘c’, ‘d’, ‘e’ и ‘f’) в MDX3-инфицированных-вирусом клетках (Рис. 6B и C), и эта структура
также наблюдалась в клетках, которые поддерживались в культуре в течение 3 месяцев после
трансфекции. Ни один из этих продуктов никогда не обнаруживался в неинфицированных вирусом
клетках или клетках, инфицированных вирусом с контрольным химеропластом. Прямое отщепление этих
продуктов показало, что они представляли пять различных разновидностей сайтов сплайсинга, каждый
пропускающий экзон 23 плюс дополнительные экзоны и вверх по течению и вниз по течению интрона
22/экзон 23 соединения, с 26 экзонами (экзоны 12–37) пропускаемый в самом маленьком продукте (Рис.
6C и D). Три из пяти разновидностей сайтов сплайсинга (продукты ‘c’, ‘d’ и ‘f’) были в структуре (Таблица
1). Предсказанные последовательности аминокислот из этих транскриптов в структуре включили бы белки
между 271 и 350 kDa (Таблица 1), совместимые с диапазоном, предложенным вестерн-блот-анализом (Рис.
3A).
Большая версия изображения:
In this page
In a new window
Download as PowerPoint Slide
Рисунок 6.
Primers
Full-length
product size
predicted
Alternate
product size
observed
Product label
(Fig. 6)
Altered splicing
Reading frame
Predicted
protein size
F19–R32
F9–R32
F9–R32
F9–R35in
F9–R43in
2100 bp
3410 bp
3410 bp
3930 bp
5100 bp
600 bp
900 bp
1300 bp
700 bp
1100 bp
b
21/31
11/28
17/31
12/34
11/38
Out-of-frame
In-frame
In-frame
Out-of-frame
In-frame
-
с
d
e
f
331 kDa
346 kDa
—
271 kDa
Таблица 1.
Альтернативный сплайсинг вызваный MDX3
Поскольку меньшие транскрипты избирательно амплифицированны ПЦР, интенсивность связок на гелях
не отражает относительное изобилие транскриптов в клетке (см. Рис. 6B).. Это на первый план выдвигало
факт, что продукт во всю длину всегда одинаково амплифицируются когда внутренние инициаторы в
пределах 1-2 КБ друг от друга (например. F19/R32 в Рис. 6B), использовались в реакции ПЦР. С
внутренними инициаторами, все более и более отдаленными от друг друга (например. F9/R43in или
F9/R50in), только альтернативные транскрипты были усилены. Это не происходило из-за неполного
ретротранскрипции, так как транскрипт во всю длину всегда одинаково усиливался, когда мы
использовали пары инициатора F22/R32 (данные, не показанны). Поэтому, этот тип анализа не
обеспечивает данные, которые точно отражают уровни альтернативных транскриптов относительно
транскрипта во всю длину.
Неожиданное обнаружение многократных разновидностей сайтов сплайсинга, вызванных единственной
изменением основания в соединении, принудило нас исследовать другие сайты сплайсинга, специфично
донорские и акцепторные места для экзонов, которые заключали пропущенные экзоны для мутаций. Мы
не ожидали это по двум главным причинам. Во-первых, не было никакого соответствия между
последовательностями других сайтов сплайсинга и интрон 22/экзон 23 соединением. Таким образом не
было бы никакого гомологичного соединения между MDX3 и ни одним из тех сайтов сплайсинга, которые
могли бы привести к таким изменениям. Во-вторых, MDX4 почти идентичен MDX3 и все же не вызывал
дополнительного соединения. Таким образом это было бы необычно, если бы MDX3 был способен к
стимулированию мутаций на многократных, негомологичных сайтах сплайсинга вдоль гена дистрофина,
тогда как у MDX4, отличающегося только единственным основанием от MDX3, не было никакой
активности вообще в стимулировании мутаций. Однако, основанный на замене структуре соединения,
идентифицированного в MDX3-инфицированных-вирусом клетках (Таблица 1), мы исследовали другие
сайты сплайсинга на мутации. Мы PCR-амплифицировали донорский сайт сплайсинга 5 ′ экзонов и
акцепторной сайт сплайсинга для 3 ′ экзонов для каждого нового соединения отдаленных экзонов друг с
другом. Кроме того, мы упорядочивали и донорские и акцепторные сайты сплайсинга для первого
'пропущенного' экзона или от 5 ′ или от 3 ′ (см. Рис. 7 для примера). Вся амплификация была пройдена в
два раунда перед отщеплением рисунке 2C. Рисунок 7 показывает данные о последовательности для
случая, в котором было добавочное соединение между экзоном 17 и экзоном 31 (продукт ‘d’ от Рис. 6 и
Таблицы 1). Не было никакого признака изменения оснований в последовательности сайтов сплайсинга
или смежных последовательностях ни для одного места, даже после двух раундов амплификации ПЦР.
Идентичный анализ был сделан для продуктов ‘b’, ‘c’, ‘e’ и ‘f’ (Рис. 6 и Таблица 1), ни один из которых не
приводил доказательства мутаций сайтов сплайсинга. Поэтому, единственная мутация,
идентифицированная в гене дистрофина среди этих 25сайтов сплайсинга, была единственной, в интроне
22/экзон 23 соединении. Эти данные предполагают, что мутации в единственных сайтах сплайсинга могут
иметь более широкие эффекты чем пропуск единственного экзона в соединении сложного гена как
дистрофин.
Большая версия изображения:
In this page
In a new window
Download as PowerPoint Slide
Рисунок 7.
Дискуссия
Мы расширили терапевтический потенциал химеропласт- опосредованной замены основания от простой
коррекции точечных мутаций до восстановления рамки считывания. Этот подход может быть применим
для мутаций с изменением рамки считывания (включая большие делеции) У людей этот метод
потенциально должен способствовать преходу фенотипа МДД в более мягкий фенотип МДБ.. Схожий
результат является целью антисмыслового-опосредованного пропуска экзона, что применено к мутациям
гена дистрофина у людей и мышей (8,10–12). Пока антисмысловой-опосредованный пропуск экзона дает
надежду, использование химеропласта для пропуска экзона в гене дистрофина имеет некоторые
приемущества. Во-первых, коррекция с использованием химеропласта происходит на геномном уровне,
что освобождает от необходимости продолжительной доставки олигонуклеатидов или экспрессии
антисмысловой конструкции для поддержания экспрессии дистрофина. Во-вторых, генная коррекция
может быть применима не только к зрелым имофибриллам, (21) но и их предшественникам (20), которые
участвуют в репарации мышц.. Таким образом терапевтическая выгода была бы устойчива не только с
точки зрения исправления на геномном уровне, но также и с точки зрения оборота в ткани, поскольку
клетки предшественника мышцы соединяются с существующими мышечными волокнами или друг с
другом, чтобы сформировать новые мышечные волокна. В настоящее время эффективность основного
преобразования - по крайней мере, порядок величины ниже, чем было бы необходимо для
терапевтического применения, и это остается одним из главных препятствий для этого типа технологии
генотерапии.
Наши результаты демонстрируют, что нацеленный химеропласт(MDX3) способен к стимулированию
преобразования G-T в интрон 22/экзон 23 соединении гена дистрофина (Рис. 1B), и, таким образом,
разрушить соединение экзона 22 к экзону 23. Однако, это геномное преобразование имело более широкие
воздействия на соединении премРНК дистрофина и заканчивалось экспрессией многократных форм
белка, некоторых с большими внутренними делециями. Анализ МРНК подтвердил наличие альтернативно
соединенных транскриптов с числом исключенных экзонов в пределах от 11 - 27 (Рис. 6). Вестерн-блотанализ используя антитела для С- терминальной области дистрофина показывал наличие по крайней мере
трех различных белковых продуктов (Рис. 3A). Иммунное окрашивание используя антитела, определенные
для различных частей дистрофина, подтвердило, что у произведенных белков были внутренние
делеции.(Рис. 3C).
Представленные данные, привели к неожиданному результату- мутация в единственном основании в
одном сайте сплайсинга могла изменить сплайсинг более глобально в пределах гена дистрофина.
Последовательность химеропласта, выбранная для этого эксперимента, не соответствовала никаким
другим геномным последовательностям, таким образом гарантируя специфичность олигонуклеатидов.
Изменение даже единственного основания в химерном олигонуклеатиде резко уменьшает свою склонность
вызвать преобразования (23). Таким образом не было никакой причины ожидать, что химеропласт,
предназначенный к соединению интрона 22/экзона 23, будет предназначаться для негомологичногосайта
сплайсинга. Было показано, что химеропласт, предназначенный для определенных геномных
последовательностей способен к стимулированию одно-основных преобразований в генах, но не имеет
никакой мутационной склонности даже в гене с очень гомологичной последовательностью (24). Таким
образом, хотя мы не можем полностью исключить возможность, что у MDX3 могла быть мутационная
активность в другом месте генома, очень маловероятно, что это вызывает преобразования специфично в
сайтах сплайсинга в гене дистрофина. Однако, чтобы поддержать эти теоретические аргументы, мы
непосредственно упорядочили все поврежденные сайты сплайсинга и нашли признак преобразования
только в предназначенной основании (Рис. 2C и 7). Кроме того, как отмечено ранее, любая гипотеза, что
замена, вызванная MDX3, происходит из-за мутаций большего количества сайтов чем только
единственное основание в интрон 22/экзон 23 соединении, должна была бы принять во внимание факт,
что у MDX4, идентичного MDX3 кроме единственного изменения пары оснований, не было никакой
склонности вызвать дополнительное изменение гена.
Хотя MDX3 мог теоретически иметь эффект на РНК, обрабатывающую непосредственно (например,
активностью антисенсорного типа), возможность, что альтернативные продукты явились результатом
постоянно действующего на обработку РНК химеропласта, исключена нашими долгосрочными
результатами. Клетки распространяются с прериодом удвоения приблизительно 18 часов. Мы видим ту же
самую структуру транскрипта и белковой экспрессии спустя 3 месяца после трансфекции, как мы делаем в
течение 1 недели после трансфекции. В 3-месячном отрезке времени количество химеропласта на клетку
уменьшилось бы фактором 2120 со времени трансфекции, основанной исключительно на разбавлении,
которое будет встречаться во время клеточного деления. Это соответствует 1×1036-кратному сокращению
концентрации химеропласта и даже не принимает во внимание деградацию химеропласта в клетках,
который, вероятно, будет иметь, по крайней мере, такойже эффект на сокращение химеропласта на
клетку, как клеточное деление. Таким образом количество химеропласта в клетке в 3-месячном отрезке
времени было бы настолько бесконечно мало, чтобы быть действительно незначительным. Мы поэтому
приходим к заключению, что ни один из результатов не может быть объяснен введенным химеропластом.
Неясно, почему изменение единственного сайта сплайсинга на геномном уровне заканчивается
экспрессией многократных продуктов, каждый из которых пропускает много экзонов и вверх по течению
и вниз по течению предназначенного сайта сплайсинга. Этот феномен однако наблюдался в клинических
случаях пациентов с МДД, в которых точечные мутации в местах сайтов сплайсинга приводят к пропуску
многократных экзонов в гене дистрофина. (29,30). Изменение специфической интрон/экзонной
последовательности, содержащей регулирующие элементы для построения факторов сплайсинга может
разрывать вторичную структуру необходимую для координации сплайсинга продуктов множественных
экзонов.(31).Конечная м РНК может продемонстрировать пропуск множественных экзонов
расположенных выше и ниже точечной мутации Действительно пропуск смежных экзонов наблюдается
когда процесс сплайсинга разрушен поставкой антисмысловых нуклеатидов. (9).
У mdx мышей и у людей с МДД, есть непосредственный вид мышечных волокон, которые выражают
иммунореактивность дистрофина(то есть по крайней мере части дистрофина) (32). Числа этих так
называемых ‘ревертантных’ волокон увеличиваются с возрастом, и они хорошо установлены, что у форм
белка есть внутренние делеции в пределах от нескольких экзонов до многих экзонов (33). Механизм,
которым это обусловлено, неясен, но соматические мутации были предложены (34). Недавние
исследования показали, что в ревертантных волокнах в пределах единственной группы экспрессируется
та же самая форма дистрофина, предположенно, что они получены из клонального распространения
единственной клетки предшественника мышцы, потомство которой - мышечные волокна локально и
присуждает тем волокнам способность экспрессировать белковые формы дистрофина (33). Хотя
иммуногистохимический анализ указывает, какие экзоны не
экспрессируются, эти исследования не исключают возможность, что
экспрессируются многократные транскрипты. (33 )Наши результаты
предполагают, что ревертантные волокна могли явиться результатом непосредственных, соматических
мутаций в последовательностях сайтов сплайсинга. Такие мутации могли составлять переменную
структуру транскриптов и белков, которые экспрессируются, и появление сокращенных форм
дистрофина, в котором многократные, смежные экзоны не выражены (33).
Системная поставка олигонуклеотидов остается главным препятствием для клинического применения
антисмысловых олигонуклеатидов или химеропласта, чтобы изменить ген (13) Однако, химеропластопосредованное преобразование может привести к производству функциональных форм дистрофина,
ободрительно для терапевтического подхода к лечению МДД. Однако, наши результаты исследования
демонстрируют, что намного больше работы необходимо, чтобы понять механизмы, которые регулируют
генное соединение дистрофина, чтобы быть в состоянии предсказать эффект изменения сайта сплайсинга
такого большого и сложного гена как дистрофин. Понимание механизмов, приводящих к многократному
производству транскриптов, может пролить свет на нормальный процесс формирования ревертантных
волокон, процесс, у которого может также быть терапевтическое применение (35). Ясно, у модификации
соединения премРНК есть большой потенциал как терапевтический подход к лечению МДД, и
многократные технологии продвигают этот новый терапевтический подход.
Материалы и методы
Мыши
Мыши mdx (C57BL/10ScSn-mdx) и контроля C57 (C57BL/10SnJ) были получены из лаборатории
Джексона и были обработаны в соответствии с руководящими принципами Административной Группы по
Лабораторному Уходу за животными Стэнфордского университета.
Синтез химеропласта
Химерные РНК/ДНК олигонуклеатиды синтезировалась как ранее описано (23) и были обеспечены
Valigen Inc. (Newtown, Пенсильвания, США). Олигонуклеатиды были подготовлены с ДНК и 2 ′-O-метил
РНК фосфорамидат мономерами нуклеозидов на Expedite Nucleic Aid Synthesizer (Биосистемы PerSeptive,
Фрэмингэм, Массачусетс, США), очищены HPLC, и определены количественно спектральным анализом.
Больше чем 95 % очищенных олигонуклеатидов были определены во всю длинну. Нацеленный
химеропласт, определяемый как MDX3 (Рис. 1A), был разработан, чтобы вызвать преобразование G-T в
акцепторном сайте сплайсинга экзона 23 из
гена дистрофина, таким образом разрушая его
последовательность (Рис. 1B). Контрольный химеропласт, определяемый как MDX4 (Рис. 1A), отличается
от MDX3 единственным основанием и не имеет никаких несоответствий интрон 22/экзон 23 сайта
сплайсинга. Таким образом у MDX4 должны быть все гомологичные свойства MDX3, но ни одно из его
оснований не заменяет другое в mdx клетках.
Культура клеток и трансфекция
Клетки были получены из мышцы конечности новорожденных mdx и мышей C57 как ранее описано. Для
роста клетки расположили на пластинах , покрытых 5 мкг/мл ламилина (Invitrogen, Карлсбад,
Калифорния, США), и поддержали в питательной среде, состоящей из питательной смеси F10 (Mediatech,
Херндон, Вирджиния, США) подкрепленный с20%-ой эмбриональной бычьей сывороткой (Научная
Омега, Тарзана, Калифорния, США) и пенициллином/стрептомицином (Mediatech). Клеточная
дифференцировка была вызвана, поддерживая клетки в низкой серологической питательной среде
(‘питательная среда дифференцирования’) состоящий из питательной среды модифицированной Далбекко
(Mediatech), подкрепленный с 2%-ой сывороткой лошади (Invitrogen) и пенициллином/стрептомицином.
Миобласты были на шести пластинах (1×105 клетки/хорошо) 12 часов до трансфекции. химеропласта
(10 µg) были обработаны 1 мкл Lipofectamine 2000 (GIBCO/BRL) в течение 30 минут при комнатной
температуре в суммарном объеме 0.5 мл F10 . Комплекс был тогда добавлен к 1.5 мл питательной среды
16 часов. Трансфекция была остановлена, заменяя раствор для трансфекции новой питательной средой.
Вестерн-блот-анализ
Клетки были растворенны в буфере RIPA (50-миллиметровые Тримараны-HCl, pH фактор 7.4, 150-мМ
NaCl, 0.5 % deoxycholate, и 1 % Nonidet P-40) содержащий апротинина (20 мкг/мл), леупептин (20 мкг/мл),
phenylmethylsulfonyl фтористый фенилметилсульфонил (10 мкг/мл), и ортованадат натрия (1 мМ), и
полный белок в экстракте был определен пробой белка Биорадиуса (Биорадиус, Геркулес, Калифорния,
США). Для обнаружения дистрофина 350 мкг полного белка от каждого образца были отделены
электрофорезом (10 миллиампер 15 часов) использование 5%-ых гелей СИСТЕМЫ-ПКОPOLYACRYLAMIDE, и затем перешли (250 миллиампер 7 часов) на нитроклетчаточные мембраны.
Мембраны были исследованы быстро 4°C с антителами, направленными к области фибрил (Mandys-8,
1:400; Сигма) или C-терминальной области (Dys-2, 1:50; Novacastra, Ньюкасл, Великобритания)
дистрофина как ранее описано. Мембраны были заблокированы 5%-ым молоком в PBS 1 час при
комнатной температуре. Пятна были вымыты 0.05 % PBS и затем реагировали с пероксидазой
антимышинными вторичными антителами (Эмершем Фармэсия Байотеч, Пискэтэуэй, Нью-Джерси, США).
Определенное связывающее антитело было обнаружено, используя расширенную хемилюминесцентную
систему (Эмершем).
Проба ARMS и анализ рестрикционной эндонуклеазы
Культивируемые миобласты были ополоснуты дважды в PBS, и геномная ДНК была извлечена, используя
Геномный комплект извлечения ДНК (Промега, Мадисон, Висконсин, США) согласно инструкциям
изготовителя. Для каждой реакции амплификации 500 нанограммов полной ДНК, извлеченной из культур
миобластов, были переварены 2 часа в 37°C с Sal I или NotI, чтобы развернуть супернамотанную
структуру ДНК как ранее описано.
Обозначения и последовательности всех инициаторов PCR перечислены в Таблице 2. Для ARMS (
невосприимчивая амплификационная система мутации) пробы мы использовали передовой инициатор в
интроне 22 [F (интервал) 22] и любой из двух обратных инициаторов. Один, определяемый ‘w’, было
определенным для интрона дикого типа 22/экзон 23 последовательности сайтов сплайсинга и другой,
определял ‘m3’, было определенным для последовательности сайтов сплайсинга после трансверсии G-T в
нуклеотиде 3137 (см. Рис. 1B). Параметры настройки ПЦР и условия реакции были ранее описаны.
Продукты ДНК фракционировались на 2%-ых гелях агарозы в Tris-acetate/EDTA буфере. Продукты ПЦР
были очищены, используя Qiaquick (Qiagen Inc., Валенсия, Калифорния, США), и отщепление ДНК было
выполнено, используя Прикладные Биосистемы, ABI377 автоматизировал секвенсер.
Праймер
Последовательность
Гомологичный регион
F(int)22
w
m3
R23
R32
F22
F22in
R24
R25
R30
R33
R35out
R43out
R50out
F8
F9
F19
R35in
R43in
R50in
AACTCATCAAATATGCGTGTTAGTG
GCTCTTTCAAAGAACTTTGCAGACC
GCTCTTTCAAAGAACTTTGCAGACA
CTGGCATATTTCTGAAGGTGC
GGCTGGTTTTTGGAATAATCG
GACACTTTACCACCAATGCG
GGAGACAATGAGTAGCATCAGG
CAGGGCAGGCCATTCCTCTTTC
CTGCCCACCTTCATTAACAC
GGACCTTTTCAATTTCCTGGGC
CTGCTTTTTCTGTACAATTTGACG
CTGGAGGTGACAGCTATCCAG
CTTTCACCTTTTCCATGGAGG
CCAGTAGTGCTCAGTCCAGGG
GTGGAAATGTTGCCCAGGAC
GTTATGCCTTCACACAGGCTGC
GCAAGATGCCAGCAGATCAGC
CTTGCCCAACACCATTTTCAAAG
CAATCCGACCTGAGATTTGTTGC
GGTTTACAGCCTCCCACTCAG
intron 22
exon 23
exon 23
exon 23
exon 32
exon 22
exon 22
exon 24
exon 25
exon 30
exon 33
exon 35
exon 43
exon 50
exon 8
exon 9
exon 19
exon 35
exon 43
exon 50
In this window
In a new window
1, 2
1
1
2, 4
3, 4
3
4
4
4
4
3
3
3
3
3
4
4
4
4
4
Таблица 2.
ПЦР праймеры
Анализ эндонуклеазы был выполнен на полной геномной ДНК. 200 нанограммов геномной ДНК были
подвергнуты ПЦР амплификации, используя передовой инициатор в интроне 22 [F (интервал) 22] и
обратный инициатор в экзоне 23 (R23). Каждая смесь амплификации содержала 25 пмоль адекватного
инициатора, 10%-ого диметилсульфоксида, 0.5 полимеразы ДНК Владельца U Тэка (Takara, Panvera Corp.,
Мадисон, Висконсин, США), и 5 мМ каждого трифосфата дезоксирибонуклеотида. После начального шага
денатурации 95°C в течение 5 минут, амплификация была выполнена в 35 циклов при 95°C в течение 1
минуты, сопровождаемой 55°C в течение 3 минут, и вытяжение в 72°C для 2 минимальных реакций
Амплификация была закончена дополнительным этапом при 72°C в течение 10 минут. Продукты ПЦР
были загружены на 2%-ом геле агарозы, и ожидаемые 150 bp продуктов амплификации были очищены с
использованием комплекта извлечения геля Qiagen. Из 30 мкл повторно приостановленного продукта ДНК
5 мкл были подвергнуты второму раунду ПЦР с использованием тех же самых условий, ранее описанных
с добавлением 10 mCi [32P] dCTP. Радиоактивные образцы были очищены, используя Amicon Microcon®PCR (Millipore Corporation, Бедфорд, Массачусетс, США) и повторно приостановлены в 50 мкл H20.
Десять микролитров были переварены в течение часа при 37°C с Hinf I рестриктаз и нанесены на 8 %,
неденатурирующий гель акриламида.
Вложенный RT–PCR
Полная РНК была извлечена из культивируемых мышечных волокон, используя РЕАКТИВ ТРИМАРАНА
(Сигма). Для каждой реакции 100 нанограммов РНК обработанны с 1 U дезоксирибонуклеазы I
(GIBCO/BRL) при комнатной температуре и подвергнуты ретротранскрибцииRT–PCR (Qiagen). Обратная
транскрипция и первый этап амплификации были выполнены, используя обратный инициатор в экзоне 33
(R33), соединенный с передовым инициатором в экзоне 22 (F22). Вложенный ПЦР был выполнен на 2 мкл
первой реакции амплификации, используя передовой (внутренний) инициатор в экзоне 22 (F22in) и
обратные инициаторы в экзонах 23 (R23), 24 (R24), 25 (R25), 30 (R30) и 32 (R32).
Чтобы обнаружить альтернативные продукты вне области между экзонами 22 и 32 (см. Рис. 6), ряд
различной обратной транскрипции и первые этапы реакции амплификации были выполнены, используя
обратные инициаторы в экзонах 33 (R33), 35 (R35out), 43 (R43out) и 50 (R50out), соединенный с
передовым инициатором в экзоне 8 (F8). Вложенный ПЦР была выполнена с передовыми инициаторами в
экзонах 9 (F9) и 19 (F19), соединенный с обратными инициаторами в экзонах 32 (R32), 35 (R35in), 43
(R43in) и 50 (R50in). Амплификация была выполнена в 25 циклов при 94°C 30 сек, 55°C в течение 2 минут
и 72°C в течение 2 минут. Продукты ПЦР были удалены из геля агарозы, очищены с использованием
комплекта извлечения геля Qiagen, и упорядочены с использованием автоматизированного секвенсера.
Анализ последовательности сайта сплайсинга
Последовательности гена дистрофина мышей были восстановлены из базы данных генома мыши NCBI.
Геномная ДНК была изолирована как ранее описано от неинфицированных вирусом клеток или клеток,
инфицированных вирусом с MDX3, которые сохранялись в культуре в течение 3 месяцев после
трансфекции. Исследования последовательностей сайтов сплайсинга были выполнены, используя 100
нанограммов геномной ДНК. Интрон 22/экзон 23 сайт сплайсинга был амплифицирован, используя F
(интервал) 22 и инициаторы R23, ранее описанные. Для всех других сайтов сплайсинга полностью
изменены инициаторы, и разработаны, чтобы усилить ∼400 bp, включая целый экзон и донорские и
акцепторные сайты сплайсинга. Амплификация была выполнена в 30 циклов, используя параметры
настройки, ранее описанные для анализа эндонуклеазы. Продукты ПЦР были на гелях агарозы, их
очистили и повторно приостановили в 30 мкл H2O. Второй раунд амплификации был выполнен, используя
2 мкл очищенного продукта еще 30 циклов. Второй раунд ПЦР был очищен и упорядочен как ранее
описано. Последовательности инициатора и электроферограммы предоставляются по запросу.
Иммуногистохимия
Иммунное окрашивание было выполнено как ранее описано (20,36).
Кратко, клетки, культивируемые на покровных стеклах, были фиксированы в ледяном этаноле в течение
10 минут, ополоснутых в PBS, и связанные с усилением проницаемости в Тритоне на 0.3 % X-100 в
течение 10 минут при комнатной температуре. Раствор, содержащий 5 %, инактивированной высокой
температурой нормальной сыворотки козы и BSA на 1 мг/мл в PBS использовались в качестве
блокирования раствора 30 минут.. Клетки инкубированы с основными антителами к дистрофину (Mandys18, 1:100, щедрый подарок доктора Гленна Морриса, Северо-восточного Института Уэльса, Рексхэм,
Великобритания; Mandys-8, 1:200, Novacastra; Dys-2, 1:25, Novacastra) или α-дистрогликана (VIA4-1, 1:100;
Биотехнология Провинциальных областей штата, Лейк-Плэсид, Нью-Йорк, США) быстро при 4°C. Клетки
были вымыты в PBS перед инкубацией в течение 1 часа при комнатной температуре с AlexaTM 546- антимышиными антителами козы (H+L) (1:250; Молекулярные Исследования, Юджин, Орегон, США) или
FITC-антимышинными антителами (целая молекула; 1:200; Cappel ICN Pharmaceuticals Inc. Аврора, Огайо,
США). Покровные стекла были установлены, используя Щит Vecta (Vector Inc., Берлингейм, Калифорния,
США) для флюоресцентной микроскопии .
Примечания

↵* Все письма адресуйте в Департамент неврологии и неврологическому научному обществу
Станфордского университета Medical Center, Room A-343, Stanford, CA 94305-5235, USA. Tel: +1
6508583976; Fax: +1 6508583935; Email: [email protected]
Ссылки
1. ↵
Koenig, M., Hoffman, E.P., Bertelson, C.J., Monaco, A.P., Feener, C. and Kunkel, L.M. (1987) Complete
cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the
DMD gene in normal and affected individuals. Cell, 50, 509–517.
CrossRefMedlineWeb of Science
2. ↵
Amalfitano, A., Rafael, J.A. and Chamberlain, J.S. (1996) Structure and mutation of the dystrophin gene.
In Brown, S.C. and Lucy, J.A. (eds), Dystrophin., Cambridge University Press, Cambridge, pp. 1–26.
3. ↵
Monaco, A.P., Bertelson, C.J., Liechti-Gallati, S., Moser, H. and Kunkel, L.M. (1988) An explanation for
the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics, 2, 90–
95.
CrossRefMedline
4. ↵
Chen, H.H., Mack, L.M., Choi, S.Y., Ontell, M., Kochanek, S. and Clemens, P.R. (1999) DNA from both
high-capacity and first-generation adenoviral vectors remains intact in skeletal muscle. Hum. Gene Ther.,
10, 365–373.
CrossRefMedlineWeb of Science
5. Gilbert, R., Nalbantoglu, J., Howell, J.M., Davies, L., Fletcher, S., Amalfitano, A., Petrof, B.J., Kamen, A.,
Massie, B. and Karpati, G. (2001) Dystrophin expression in muscle following gene transfer with a fully
deleted (‘gutted’) adenovirus is markedly improved by trans-acting
adenoviral gene products. Hum. Gene Ther., 12, 1741–1755.
CrossRefMedlineWeb of Science
6. Wang, B., Li, J. and Xiao, X. (2000) Adeno-associated virus vector carrying human minidystrophin genes
effectively ameliorates muscular dystrophy in mdx mouse model. Proc. Natl Acad. Sci. USA, 97, 13714–
13719.
Abstract/FREE Full Text
7. ↵
Hauser, M.A., Amalfitano, A., Kumar-Singh, R., Hauschka, S.D. and Chamberlain, J.S. (1997) Improved
adenoviral vectors for gene therapy of Duchenne muscular dystrophy. Neuromusc. Disord., 7, 277–283.
CrossRefMedlineWeb of Science
8. ↵
De Angelis, F.G., Sthandier, O., Berarducci, B., Toso, S., Galluzzi, G., Ricci, E., Cossu, G. and Bozzoni, I.
(2002) Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of
the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50
DMD cells. Proc. Natl Acad. Sci. USA, 99, 9456–9461.
Abstract/FREE Full Text
9. ↵
Dunckley, M.G., Manoharan, M., Villiet, P., Eperon, I.C. and Dickson, G. (1998) Modification of splicing
in the dystrophin gene in cultured mdx muscle cells by antisense oligoribonucleotides. Hum. Mol. Genet.,
7, 1083–1090.
CrossRefMedlineWeb of Science
10. ↵
Mann, C.J., Honeyman, K., Cheng, A.J., Ly, T., Lloyd, F., Fletcher, S., Morgan, J.E., Partridge, T.A. and
Wilton, S.D. (2001) Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc.
Natl Acad. Sci. USA, 98, 42–47.
Abstract/FREE Full Text
11. van Deutekom, J.C., Bremmer-Bout, M., Janson, A.A., Ginjaar, I.B., Baas, F., den Dunnen, J.T. and van
Ommen, G.J. (2001) Antisense-induced exon skipping restores dystrophin expression in DMD patient
derived muscle cells. Hum. Mol. Genet., 10, 1547–1554.
Abstract/FREE Full Text
12. ↵
Wilton, S.D., Lloyd, F., Carville, K., Fletcher, S., Honeyman, K., Agrawal, S. and Kole, R. (1999) Specific
removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides.
Neuromusc. Disord., 9, 330–338.
CrossRefMedlineWeb of Science
13. ↵
Rando, T.A. (2002) Oligonucleotide-mediated gene therapy for
muscular dystrophies. Neuromusc. Disord., 12, S55–S60.
14. ↵
Kapsa, R.M., Quigley, A.F., Vadolas, J., Steeper, K., Ioannou, P.A., Byrne, E. and Kornberg, A.J. (2002)
Targeted gene correction in the mdx mouse using short DNA fragments: towards application with bone
marrow-derived cells for autologous remodeling of dystrophic muscle. Gene Ther., 9, 695–699.
CrossRefMedlineWeb of Science
15. ↵
Rice, M.C., Czymmek, K. and Kmiec, E.B. (2001) The potential of nucleic acid repair in functional
genomics. Nat. Biotechnol., 19, 321–326.
CrossRefMedlineWeb of Science
16. ↵
Gamper, H.B. Jr, Cole-Strauss, A., Metz, R., Parekh, H., Kumar, R. and Kmiec, E.B. (2000) A plausible
mechanism for gene correction by chimeric oligonucleotides. Biochemistry, 39, 5808–5816.
CrossRefMedline
17. ↵
Kren, B.T., Metz, R., Kumar, R. and Steer, C.J. (1999) Gene repair using chimeric RNA/DNA
oligonucleotides. Semin. Liver Dis., 19, 93–104.
MedlineWeb of Science
18. ↵
Kren, B.T., Parashar, B., Bandyopadhyay, P., Chowdhury, N.R., Chowdhury, J.R. and Steer, C.J. (1999)
Correction of the UDP-glucuronosyltransferase gene defect in the Gunn rat model of Crigler–Najjar
syndrome type I with a chimeric oligonucleotide. Proc. Natl Acad. Sci. USA, 96, 10349–10354.
Abstract/FREE Full Text
19. ↵
Kren, B.T., Bandyopadhyay, P. and Steer, C.J. (1998) In vivo site-directed mutagenesis of the factor IX
gene by chimeric RNA/DNA oligonucleotides. Nat. Med., 4, 285–290.
CrossRefMedlineWeb of Science
20. ↵
Bertoni, C. and Rando, T.A. (2002) Dystrophin gene repair in mdx muscle precursor cells in vitro and in
vivo mediated by RNA–DNA chimeric oligonucleotides. Hum. Gene Ther., 13, 707–718.
CrossRefMedlineWeb of Science
21. ↵
Rando, T.A., Disatnik, M.H. and Zhou, L.Z. (2000) Rescue of dystrophin expression in mdx mouse muscle
by RNA/DNA oligonucleotides. Proc. Natl Acad. Sci. USA, 97, 5363–5368.
Abstract/FREE Full Text
22. Tagalakis, A.D., Graham, I.R., Riddell, D.R., Dickson, J.G. and Owen, J.S. (2001) Gene correction of the
apolipoprotein (apo) E2 phenotype to wild-type apoE3 by in situ chimeraplasty. J. Biol. Chem., 276,
13226–13230.
Abstract/FREE Full Text
23. ↵
Yoon, K., Cole-Strauss, A. and Kmiec, E.B. (1996) Targeted gene correction of episomal DNA in
mammalian cells mediated by a chimeric RNA:DNA oligonucleotide. Proc. Natl Acad. Sci. USA, 93, 2071–
2076.
Abstract/FREE Full Text
24. ↵
Cole-Strauss, A., Yoon, K., Xiang, Y., Byrne, B.C., Rice, M.C., Gryn, J., Holloman, W.K. and Kmiec, E.B.
(1996) Correction of the mutation responsible for sickle cell anemia by an RNA–DNA oligonucleotide.
Science, 273, 1386–1389.
Abstract
25. ↵
Alexeev, V., Igoucheva, O., Domashenko, A., Cotsarelis, G. and Yoon, K. (2000) Localized in vivo
genotypic and phenotypic correction of the albino mutation in skin by RNA–DNA oligonucleotide. Nat.
Biotechnol., 18, 43–47.
CrossRefMedlineWeb of Science
26. ↵
Igoucheva, O.A. and Yoon, K. (2002) Gene correction frequency by chimeric RNA–DNA oligonucleotide
using nuclear extracts. Meth. Mol. Med., 69, 95–107.
27. ↵
Ohlendieck, K. and Campbell, K.P. (1991) Dystrophin-associated proteins are greatly reduced in skeletal
muscle from mdx mice. J. Cell Biol., 115, 1685–1694.
Abstract/FREE Full Text
28. ↵
Harper, S.Q., Hauser, M.A., DelloRusso, C., Duan, D., Crawford, R.W., Phelps, S.F., Harper, H.A.,
Robinson, A.S., Engelhardt, J.F., Brooks, S.V. and Chamberlain, J.S. (2002) Modular flexibility of
dystrophin: implications for gene therapy of Duchenne muscular dystrophy. Nat. Med., 8, 253–261.
CrossRefMedlineWeb of Science
29. ↵
Sironi, M., Pozzoli, U., Cagliani, R., Comi, G.P., Bardoni, A. and Bresolin, N. (2001) Analysis of splicing
parameters in the dystrophin gene: relevance for physiological and pathogenetic splicing mechanisms.
Hum. Genet., 109, 73–84.
CrossRefMedlineWeb of Science
30. ↵
Melis, M.A., Muntoni, F., Cau, M., Loi, D., Puddu, A., Boccone, L., Mateddu, A., Cianchetti, C. and Cao,
A. (1998) Novel nonsense mutation (C→A nt 10512) in exon 72 of dystrophin gene leading to exon
skipping in a patient with a mild dystrophinopathy. Hum. Mutat., 11, S137–S138.
31. ↵
Cartegni, L., Chew, S.L. and Krainer, A.R. (2002) Listening to silence and understanding nonsense: exonic
mutations that affect splicing. Nat. Rev. Genet., 3, 285–298.
CrossRefMedlineWeb of Science
32. ↵
Thanh, L.T., Nguyen, T.M., Helliwell, T.R. and Morris, G.E. (1995) Characterization of revertant muscle
fibers in Duchenne muscular dystrophy, using exon-specific monoclonal antibodies against dystrophin.
Am. J. Hum. Genet., 56, 725–731.
MedlineWeb of Science
33. ↵
Lu, Q.L., Morris, G.E., Wilton, S.D., Ly, T., Artem'yeva, O.V., Strong, P. and Partridge, T.A. (2000)
Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and
produces functional revertant fibers by clonal expansion. J. Cell Biol., 148, 985–996.
Abstract/FREE Full Text
34. ↵
Hoffman, E.P., Morgan, J.E., Watkins, S.C. and Partridge, T.A. (1990) Somatic reversion/suppression of
the mouse mdx phenotype in vivo. J. Neurol. Sci., 99, 9–25.
CrossRefMedlineWeb of Science
35. ↵
Wilton, S.D., Dye, D.E., Blechynden, L.M. and Laing, N.G. (1997) Revertant fibres: a possible genetic
therapy for Duchenne muscular dystrophy? Neuromusc. Disord., 7, 329–335.
CrossRefMedlineWeb of Science
36. ↵
Rando, T.A., Disatnik, M.H., Yu, Y. and Franco, A. (1998) Muscle cells from mdx mice have an increased
susceptibility to oxidative stress. Neuromusc. Disord., 8, 14–21.
CrossRefMedlineWeb of Science
37. ↵
Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.C. and
Markham, A.F. (1989) Analysis of any point mutation in DNA. The amplification refractory mutation
system (ARMS). Nucl. Acids Res., 17, 2503–2516.
Оригинальная статья http://hmg.oxfordjournals.org/content/12/10/1087.full?view=long&pmid=12719373
Переведено проектом МОЙМИО http://www.mymio.org
Скачать