VI Международная научная конференция 30

advertisement
АКТУАЛЬНЫЕ ВОПРОСЫ
СОВРЕМЕННОЙ НАУКИ
Материалы VI международной
научной конференции
г. Санкт-Петербург
30-31 мая 2013 года
Санкт-Петербург
2013
УДК 001.8
ББК 10
Научно-издательский центр «Открытие»
otkritieinfo.ru
АКТУАЛЬНЫЕ ВОПРОСЫ
СОВРЕМЕННОЙ НАУКИ
Материалы VI международной научной конференции
30-31 мая 2013 года г. Санкт-Петербург
«Актуальные вопросы современной науки»: Материалы VI
международной научной конференции 30-31 мая 2013 года, г.
Санкт-Петербург. – C.-Петербург: Изд-во «Айсинг», 2013. 166с.
Представлены материалы докладов международной научной
конференции «Актуальные вопросы современной науки».
В материалах конференции обсуждаются проблемы различных
областей современной науки: информатики и медицины,
биологии и экологии, технических и сельскохозяйственных
наук, химии, истории и филологии, педагогики, экономики,
социологии. Сборник представляет интерес для учёных
различных исследовательских направлений, преподавателей,
студентов и аспирантов – всех, кто интересуется развитием
современной науки.
ISBN 978-5-91753-068-0
Авторы научных статей
Научно-издательский центр «Открытие»
2
СОДЕРЖАНИЕ
Секция 1 . Информационные технологии
К. Н. Бискуб
АДАПТИВНЫЕ СИСТЕМЫ УПРАВЛЕНИЯ…………………………..7
А. А.Данильчук, С. Г. Юн, В. В. Люстров
МЕТОДИКА ОПРЕДЕЛЕНИЯ ЦЕЛЕСООБРАЗНОСТИ
ВКЛЮЧЕНИЯ IT-СИСТЕМ ПРЕДПРИЯТИЯ
В ИНФРАСТРУКТУРУ МОНИТОРИНГА…………………………….17
Е. И. Клименков
КОНТЕКСТ ПРОЦЕССОРА И ЕГО РОЛЬ
В ПЕРЕКЛЮЧЕНИИ ПОТОКОВ………………………………....27
И. В. Мельникова, А. А. Шаталов
СЕГМЕНТАЦИЯ РУКОПИСНЫХ СИМВОЛОВ
С ИСПОЛЬЗОВАНИЕМ АЛГОРИТМА
ДЕНДРИТНЫХ КЛЕТОК DCA……………………………………...…31
Секция 2 . Химические науки
Э. И. Ярмухамедова, Г. Х. Газизова, А. А. Нургалиева
ИЗУЧЕНИЕ (СО)ПОЛИМЕРИЗАЦИИ МЕТИЛМЕТАКРИЛАТА
С МАЛЕИНОВЫМ АНГИДРИДОМ………………………………..…45
Секция 3 . Биологические науки
С. М. Абрамов, Е. Н. Быконя
МИКРОБНАЯ ПЕРЕРАБОТКА ОРГАНИЧЕСКИХ ОТХОДОВ
В ЭЛЕКТРОЭНЕРГИЮ…………………………………………………50
Д. В. Дерюгин, С. Г. Сапронова
ЛУГОВЫЕ ФИТОЦЕНОЗЫ И ИХ РОЛЬ
В ФОРМИРОВАНИИ РАСТИТЕЛЬНОСТИ………………………….52
3
А. Д. Каиржанова, А. О. Абекова, Ш. А. Манабаева
ПОЛУЧЕНИЕ ВИРУСНОГО ВЕКТОРА НА ОСНОВЕ ГЕНОМА
ВИРУСА КУСТИСТОЙ КАРЛИКОВОСТИ ТОМАТОВ,
ОБЕСПЕЧИВАЮЩИЙ ТРАНЗИЕНТНУЮ ЭКСПРЕССИЮ
GFP В КЛЕТКАХ РАСТЕНИЙ…………………………………………55
М. А. Тубаева
РИТМЫ СЕЗОННОГО РАЗВИТИЯ БУЗИНЫ ЧЕРНОЙ
(SAMBUCUS NIGRA L.) В ПРЕДГОРНОЙ ЗОНЕ
КАБАРДИНО-БАЛКАРИИ……………………………………………..62
Секция 4 . Технические науки
Е. Г. Тушук, Е. А. Лобода
ПИЩЕВАЯ И БИОЛОГИЧЕСКАЯ ЦЕННОСТЬ ЗАЛИВНОГО
ИЗ СЕРДЦА ОДОМАШНЕННОГО СЕВЕРНОГО ОЛЕНЯ…….…...72
Секция 5 . Медицинские науки
Е. М. Казанкова, Н. Е. Большедворская, В. Д. Молоков
СИСТЕМНАЯ ЭНЗИМОТЕРАПИЯ ПРИ ЯЗВЕННОНЕКРОТИЧЕСКИХ ПОРАЖЕНИЯХ СЛИЗИСТОЙ
ОБОЛОЧКИ ПОЛОСТИ РТА…………………………………….…….76
Секция 6. Сельскохозяйственные науки
И. Б. Хапаев
СТРУКТУРА И ЗНАЧЕНИЕ ПОСЕВНЫХ ПЛОЩАДЕЙ
СЕЛЬСКОХОЗЯЙСТВЕННЫХ, ЗЕРНОВЫХ И ЗЕРНОБОБОВЫХ
КУЛЬТУР В РАЗВИТИИ РАСТЕНИЕВОДЧЕСКОЙ ОТРАСЛИ
РЕГИОНОВ СЕВЕРНОГО КАВКАЗА (СТАТИСТИКОАНАЛИТИЧЕСКИЙ ПОДХОД)………………………………………81
4
Секция 7 . Исторические науки
М. Н. Голыбина
НЕКОТОРЫЕ ПРОБЛЕМЫ ИСПОЛНЕНИЯ НАКАЗАНИЯ
В ОТНОШЕНИИ НЕСОВЕРШЕННОЛЕТНИХ
НА РУБЕЖЕ XIX - XX ВВ……………………………………….……..93
А. В. Макутчев
РЕКА КАРУН В ЭПИЦЕНТРЕ БОРЬБЫ РОССИИ
И АНГЛИИ ЗА ВЛИЯНИЕ В ПЕРСИИ (ИРАНЕ)
ВО ВТОРОЙ ПОЛОВИНЕ XIX В………………………………………98
Секция 8. Экономические науки
А. В. Гаврилов, Д. В. Шушарин
ОСОБЫЕ ЭКОНОМИЧЕСКИЕ ЗОНЫ РОССИИ: ИССЛЕДОВАНИЕ
ОСНОВНЫХ ПРИЧИН УСПЕХА И НЕУДАЧ………………………106
М. И. Лукьяненко, А. В. Воронков
ЭФФЕКТИВНОСТЬ ИСПОЛЬЗОВАНИЯ И ОБОРАЧИВАЕМОСТЬ
ОБОРОТНОГО КАПИТАЛА, ПУТИ ИХ ПОВЫШЕНИЯ…………112
Секция 9 . Филологические науки
А. Г. Нуруллина
ОСОБЕННОСТИ КОМПОНЕНТА «ДЬЯВОЛ»
ВО ФРАЗЕОЛОГИЧЕСКИХ ЕДИНИЦАХ
АНГЛИЙСКОГО И РУССКОГО ЯЗЫКОВ…………………………118
А. И. Орлова
ПРЕЦЕДЕНТНЫЕ ФЕНОМЕНЫ В СЛОГАНАХ
БАНКОВСКОЙ РЕКЛАМЫ………………………………………….121
А. А. Чикваидзе
ВОПРОСЫ ИЗУЧЕНИЯ БИЛИНГВИЗМА…………………………127
5
Секция 10. Педагогические науки
В. Д. Молоков, О. П. Самойлова, С. Ю. Бывальцева
ЭЛЕМЕНТЫ ДИСКУССИИ НА ПРАКТИЧЕСКОМ ЗАНЯТИИ
ПО ТЕРАПЕВТИЧЕСКОЙ СТОМАТОЛОГИИ……………….……135
Е. М. Старикова, А. М. Стариков
СТРАТЕГИЧЕСКИЙ АСПЕКТ ФУНКЦИОНИРОВАНИЯ
КОЛЛЕДЖА ФИЗИЧЕСКОЙ КУЛЬТУРЫ…………………….……143
Н. А. Харченко
ФОНЕТИЧЕСКАЯ ЗАРЯДКА НА УРОКАХ
АНГЛИЙСКОГО ЯЗЫКА КАК МОТИВАЦИОННОЕ НАЧАЛО
НА МЛАДШЕМ И СРЕДНЕМ ЭТАПАХ……………………………150
Секция 11 . Социологические науки
Н. Д. Конева
СОЦИАЛЬНЫЕ ПРОБЛЕМЫ ВЫПУСКНИКОВ ПЕДАГОГИЧЕСКИХ
ВУЗОВ. ОЖИДАЕМЫЕ РЕЗУЛЬТАТЫ И РЕАЛЬНОСТЬ…………154
Секция 12. Экология
Т. Г. Князева, И. В. Синявский
ИССЛЕДОВАНИЕ ДИНАМИКИ ХИМИЧЕСКОГО ЗАГРЯЗНЕНИЯ
ВОДНЫХ ОБЪЕКТОВ, РАСПОЛОЖЕННЫХ ВБЛИЗИ
Г. КАРАБАШ ЧЕЛЯБИНСКОЙ ОБЛАСТИ……………………….…160
.
6
Секция 1. Информационные технологии
АДАПТИВНЫЕ СИСТЕМЫ УПРАВЛЕНИЯ
К. Н. Бискуб
Норильский индустриальный институт, г. Норильск, Россия
[email protected]
Разработка самонастраивающихся (адаптивных) систем
(СНС) автоматического управления привлекала исследователей
задолго до создания предпосылок для их широкого внедрения.
Различные структуры и алгоритмы СНС предлагались в общих
чертах без конкретизации принципов действия отдельных
блоков. При классификации СНС в разной литературе
приоритет отдавался разным критериям, что привело к их
существенному несовпадению. Современный уровень техники
позволяет реализовать сколь угодно сложные алгоритмы
управления почти без удорожания системы в целом за счет
применения
цифровых
регуляторов
на
основе
микропроцессоров. Это требует разработки последовательной
классификации
различных
видов
СНС,
наполненной
конкретными схемами их реализации с наиболее полной
детализацией основных блоков и разъяснением их принципов
действия. Для различных вариаций применений необходим
анализ их относительных преимуществ и недостатков.
Одна из наиболее известных классификаций систем [1]
была разработана Ф. Чаки. Он в свою очередь приводит ее из [2]
в следующем виде.
1.
Пассивные адаптивные системы (выполняет
функции даже при значительных внешних
воздействиях
без
изменения
структуры
и
параметров).
2.
Системы с адаптацией по входному сигналу
(параметры подстраиваются к свойствам входных
сигналов).
7
Экстремальные системы (поисковыми процедурами
подстраиваются к экстремумам функций или
функционалов).
4.
Системы с адаптацией переменных системы.
5.
Системы с адаптацией характеристик системы
(осуществляют коррекцию изменений передаточных
характеристик).
Эта классификация наиболее последовательно и богато
проиллюстрирована примерами, но и она далека от
совершенства. Ниже мы покажем, что первые два класса
целесообразно объединить.
Классификация не должна в пределах одного перечня
классов содержать классы, формируемые по разным признакам.
Так, к классу 2 относятся системы, осуществляющие адаптацию
по входному сигналу, т. е. по признаку используемого
источника информации. К классу 4 и 5 отнесены системы по
принципу воздействия на системы, т. е. одна и та же система
может быть одновременно отнесена и к классу 2, и к классу 4
или 5.
По
вопросу
классификации
адаптивных
и
самонастраивающихся систем окончательная, наиболее полная,
последовательная и удовлетворяющая всех специалистов
классификация будет принята еще не скоро.
Одни авторы отождествляют самонастраивающуюся и
адаптивную систему, другие считают только один из указанных
терминов обоснованным, а второй предлагают из терминологии
убрать. Для приближения к решению этого вопроса
целесообразно
рассмотреть
суть
термина
«самонастраивающийся» уже на основе рассмотренных выше
многочисленных схем, из которых далеко не все были
реализованы на практике.
Настройкой регулятора называют все действия, которые
разработчик осуществляет после того, как система в целом уже
готова, но параметры регулятора еще не вычислены. В
результате этих действий определяются параметры регулятора.
При этом оператор осуществляет такие исследовательские
работы, которые могут быть записаны в виде формальных
3.
8
процедур. Важной характеристикой этого этапа является
отсутствие в некоторых случаях ограничительных требований к
функционированию объекта в ходе его настройки.
Разработчик может позволить себе реализовать самые
различные режимы вплоть до полной потери устойчивости.
Зачастую длительность таких режимов и их свойства никак не
регламентируются, т. е. у разработчика имеется полная свобода
действий при одном условии: они не должны продолжаться
бесконечно,
а
обязаны
закончиться
предоставлением
приемлемой системы путем определения наилучшей настройки
регулятора.
Если регулятор снабжен интеллектуальной системой,
которая решает все эти задачи самостоятельно в автоматическом
режиме,
такую
систему
следует
назвать
именно
«самонастраивающейся», поскольку она сама реализует
алгоритм настройки.
При этом объект не обязательно нестационарный. Если
объект все же не стационарный, а процедура самонастройки
реализована так умело, что не выводит объект за рамки
допустимых его режимов даже при условии передачи всей
системы в штатный режим эксплуатации, то система может
сохранять функции самонастройки не только до начала ее
эксплуатации, а и в ее ходе. То есть система может сама
определять изменения параметров объекта и осуществлять
адекватные изменения параметров регулятора.
Такую систему можно называть и самонастраивающейся,
и адаптивной.
По
результатам
технологических
исследований,
проведенных на Надеждинском металлургическом заводе имени
Колесникова Б.И. (ЗФ ОАО «Норильский никель»), и изучения
опыта работы ранее существующей системы газоочистки
плавильных электропечей были выявлены существенные
недостатки в ее работе [3].
На
кафедре
Электропривода
и
автоматизации
технологических процессов и производств Норильского
индустриального института разработана и внедрена в
производство новая прогнозирующая система управления
9
охлаждением технологических газов плавильной электропечи в
процессе их очистки [4]. Работа системы базируется на
оригинальном
алгоритме,
совмещающем
стандартные
программные средства современных промышленных логических
контроллеров и разработанные вновь Windows – приложения
[3]. Система автоматически рассчитывает прогноз температуры
технологических газов перед рукавными фильтрами установки
очистки газов №1 (УОГ-1), учитывая температуру в печи,
расход воздуха 1-й, 2-й и 3-й ступеней дожига СО, расход
распылительной воды скруббера-охладителя, положение
аварийной
задвижки
скруббера-охладителя,
положение
запирающих клапанов рукавных фильтров и положение
направляющей
задвижки
перед
дымососом.
Система
предназначена для имитации действия опытного оператора во
время управления УОГ-1 с целью своевременной компенсации
наиболее вероятных тепловых возмущений, приводящих к
незапланированным отключениям рукавных фильтров УОГ-1.
Разработанные модели объекта управления и регулятора
позволили реализовать прогнозирующую систему управления,
структурная схема которой представлена на рис. 1.
10
Рис. 1. Структурная схема прогнозирующей системы управления
Прогнозирующая система управления состоит из четырех
блоков.
Блок «Адаптивные наблюдатель» представляет собой
устройство наблюдения, адаптирующее все параметры
математической модели скруббера-охладителя (ММСО) к
требуемым значениям для оптимального качества управления. К
таким параметрам относятся регулируемая величина,
возмущения и управляющие воздействия. В качестве алгоритма
оптимизации параметров ММСО используется градиентный
спуск.
Блок «Прогнозатор» – устройство прогнозирования
температуры технологических газов скруббе-охладителя на 15
минут, использующее его математическую модель.
Блок «Регулятор» – прогнозирующий регулятор,
использующий математическую модель прогнозирующего
регулятора, при этом может иметь различное количество
управляющих воздействий в зависимости от режима
управления.
Блок «Скруббер-охладитель» – объект управления.
Важной
особенностью
прогнозирующей
системы
управления является наличие в структуре системы блока
адаптивного
«наблюдателя»,
который
позволяет
компенсировать кроме вышеуказанных возмущений следующие
возмущения:
1.
Нестабильность параметров модели объекта
управления и характеристик датчиков.
2.
Снижение герметичности установки очистки газов
во время ее отключения из-за изнашивания
запирающих клапанов рукавных фильтров и
направляющей задвижки перед дымососом.
Для уточнения качественных показателей работы и
надежности разработанной прогнозирующей системы были
проведены два промышленных испытания, целью которых
являлось определение и сравнение способности компенсировать
возмущения различными алгоритмов управления. В качестве
искусственного возмущения использовался скачок расхода
первой ступени дожига СО с уровня 12000 нм3/час до 16000
нм3/час.
График изменения расхода первой ступени дожига СО
представлен на рис. 2.
Рис. 2. График изменения расхода первой ступени дожига СО.
В ходе первого эксперимента процесс управления
происходил с помощью контроллера, реализующего ПИДзакона регулирования с оптимальными параметрами, а в ходе
второго эксперимента – на основе новой прогнозирующей
системы. Результаты проведенного эксперимента представлены
в виде графиков на рис. 3.
13
Рис. 3. Сравнительные графики результатов активного эксперимента при управлении
ПИД-регулятором и прогнозирующей системы управления.
На графиках а, б рис. 6 представлены переходные
процессы расхода распылительной воды и температуры
технологических газов на выходе скруббера-охладителя во
время управления ПИД-регулятором, а на графиках в, г – расход
распылительной воды и температура технологических газов на
выходе скруббера-охладителя во время управления новой
прогнозирующей системой управления.
Сравнительный анализ результатов двух экспериментов
позволил построить диаграмму (рис. 4) уровней показателей
качества управления двух различных алгоритмов по критериям
среднеквадратической и среднемодульной ошибки.
Рис. 4. Сравнительная диаграмма уровней показателей
качества управления.
ВЫВОДЫ
1. Разработанные математические модели позволили создать
прогнозирующую систему охлаждения технологических
газов плавильной электропечи.
2. Экспериментальные
исследования
синтезированной
системы охлаждения показали существенное улучшение
качественных показателей управления по сравнению с
типовой системой, работающей по ПИД-алгоритму.
Литература
1.
Чаки Ф. Современная теория управления.
Нелинейные, оптимальные и адаптивные системы /
пер. с англ.; под ред. Н.С. Райбмана. – М.: Мир,
1975.
2.
Атанс М.. Фальб П. Оптимальное управление. – М.:
Машиностроение, 1968.
3.
Бискуб К.Н., Писарев А.И. Математическая модель
охлаждения технологических газов плавильных
электропечей // Научно-технические ведомости СПб
ГПУ. Сер. 6. Информатика, телекоммуникации,
управление. – 2010. – Вып. 6(113) 2010. – С. 81-86.
4.
Свидетельство о государственной регистрации
программы
для
ЭВМ
№
2011610292,
зарегистрированной в Реестре программ для ЭВМ
12.10.2010. Прогнозирующая система управления
процессом охлаждения технологических газов
плавильной электропечи (версия 2.0) / Бискуб К.Н.
16
МЕТОДИКА ОПРЕДЕЛЕНИЯ ЦЕЛЕСООБРАЗНОСТИ
ВКЛЮЧЕНИЯ IT-СИСТЕМ ПРЕДПРИЯТИЯ
В ИНФРАСТРУКТУРУ МОНИТОРИНГА
А. А.Данильчук1, С. Г. Юн2, В. В. Люстров3
НГТУ, г. Новосибирск, Россия, [email protected]
НГТУ, г. Новосибирск, Россия, [email protected]
3
Филиал ЗАО «ЭнвижнГруп» Энвижн-Сибирь, г. Новосибирск,
Россия, [email protected]
1
2
1 Информационные системы
Информационные технологии – весьма широкое
определение, под которое попадает ряд отдельных технических
средств и приемов работы с информацией. Но, как правило, в
процессе работы с информацией люди имеют дело со вполне
определенной связанной последовательностью взаимодействий
с различными средствами. В зависимости от шкалы времени (от
оперативных до долгосрочно-стратегических задач) и масштаба
действий (от одного рабочего места до целой компании) могут
обнаруживаться разные связи и последовательности, и для
управления ими нужны разные методы. Методы варьируются
также по степени алгоритмизации и рационализации. Наиболее
рационально алгоритмизированная совокупность методов и
средств работы с информацией – информационная система.
Информационная система (ИС) - взаимосвязанная
совокупность средств, методов и персонала, используемых для
хранения, обработки и выдачи информации.
Инфраструктура мониторинга – автоматизированный
программно-аппаратный
комплекс,
который
позволяет
непрерывно контролировать ключевые компоненты ИТ
инфраструктуры предприятия, а так же отслеживать «узкие
места», тем самым препятствуя возникновению сбоев (а в
случае их возникновения – способствует скорому устранению
проблемы).
В данной статье речь пойдет об инфраструктуре
мониторинга в крупном и среднем бизнесах, т. к. в малом
бизнесе она как таковая практически отсутствует, либо не
столько масштабна и интересна.
17
2 Классификация ИС
Для того чтобы понять какие ИС следует включать в
инфраструктуру мониторинга, а какие нет, необходимо
разобраться в ключевых особенностях этого вопроса:
a)
Понять какие ИС бывают и каково их
назначение;
b)
вывести критерии оценки ИС с точки зрения
критичности для бизнеса;
c)
сделать сравнительный анализ ИС;
d)
на основе результатов вывести рекомендации по
выбору систем мониторинга.
2.1
Классификация ИС по степени
вовлеченности в основную деятельность предприятия
Первоначально поделим все ИС на 2 класса:
1. Базисные ИС – ИС, вовлеченные в основную
деятельность предприятия (оперативный контроль и
управление за производством, планирование объемов
работы и разработка календарных дней, разработка
финансового плана и т.д.).
2. Вспомогательные ИС – ИС, дополняющие
базисные (анализ и установление цены, учет заказов и
т.д.).
Далее классификацию ИС будем рассматривать
исходя из следующих показателей:
a) степень
автоматизации
процессов
на
производстве;
b) уровень управления
c) функциональный признак;
Количество пользователей, использующих ИС на
предприятии,делим условно в процентах:
 большинство персонала (75 – 100%);
 половина персонала (25 – 75%);
 меньшая часть персонала (1 – 25%).
Количественный показатель необходимо рассматривать
рядом с качественным. В данном случае – степень
автоматизации процессов:
18
 Ручные
ИС,
которые
характеризуются
отсутствием
современных
технических
средств
обработки информации и выполнением всех операций
человеком по заранее разработанным методикам.
 АвтоматизированныеИС - человеко-машинные
системы, обеспечивающие автоматизированный сбор,
обработку и передачу информации, необходимой для
принятия управленческих решений в организациях
различного типа.
 Автоматические
ИС
характеризуются
выполнением всех операций по обработке информации
автоматически, без участия человека, но оставляют за
человеком контрольные функции.
Уровень управления и функциональный признак.
Функциональный
признак
определяет
назначение
подсистемы, а также ее основные цели, задачи и функции.
Структура информационной системы может быть представлена
как совокупность ее функциональных подсистем.
В хозяйственной практике производственных и
коммерческих объектов типовыми видами деятельности,
которые определяют функциональный признак классификации
информационных
систем,
являются:
производственная,
маркетинговая, финансовая, кадровая.
Производственная
деятельность
связана
с
непосредственным выпуском продукции и направлена на
создание и внедрение в производство научно-технических
новшеств.
Маркетинговая деятельность включает в себя:
• анализ рынка производителей и потребителей
выпускаемой продукции, анализ продаж;
• организацию рекламной кампании по продвижению
продукции;
• изучается потребительская активность и поведение.
Финансовая деятельность связана с организацией
контроля и анализа финансовых ресурсов фирмы на основе
бухгалтерской, статистической, оперативной информации.
19
Кадровая деятельность направлена на подбор и
расстановку необходимых фирме специалистов, а также ведение
служебной документации по различным аспектам.
Указанные направления деятельности определили
типовой набор информационных систем:
• производственные системы;
• системы маркетинга;
• финансовые и учетные системы;
• системы кадров (человеческих ресурсов);
• прочие типы, выполняющие вспомогательные функции в
зависимости от специфики деятельности фирмы.
В крупных фирмах основная информационная система
функционального назначения может состоять из нескольких
подсистем
для
выполнения
подфункций.
Например,
производственная информационная система имеет следующие
подсистемы:
управления
запасами,
управления
производственным процессом, компьютерного инжиниринга и
т.д.
Для лучшего понимания функционального назначения
информационных систем в табл. 1 приведены по каждому
рассмотренному выше виду решаемые в них типовые задачи.
20
Таблица 1. Функции информационных систем
Система
маркетинга
Производственные системы
Исследование Планирование обърынка и
емов работ и разрапрогнозирова- ботка календарных
ние продаж
планов
Оперативный
Управление
контроль и
продажами
управление
производством
Рекомендации
Анализ работы
по
оборудования
производству
новой
Участие в
Анализ и
продукции
формировании
установление
заказов
цены
поставщикам
Управление
Учет заказов
запасами
Финансовые и
учетные системы
Система кадров
(человеческих
ресурсов)
Прочие системы,
(ИС руководства)
Управление
портфелем заказов
Анализ и
прогнозирование
потребности в
трудовых ресурсах
Контроль за
деятельностью
фирмы
Управление
кредитной
политикой
Ведение архивов
записей о персонале
Выявление
оперативных
проблем
Разработка
финансового плана
Анализ и
планирование
подготовки кадров
Анализ управленческих и стратегических ситуаций
Финансовый анализ
и прогнозирование
Контроль бюджета
Бухгалтерский учет
и расчет зарплаты
Обеспечение
процесса выработки
Тип информационной системы зависит от того, чьи
интересы она обслуживает и на каком уровне управления. На
данном этапе целесообразно ввести критерий: допустимое
время простоя.
Допустимое время простоя – критерий максимально
возможного временного отрезка, до наступления событий,
приносящих отрицательные минимально допустимые потери на
предприятии или на бизнес в целом. Чем ниже данный
показатель, тем качественнее (соответственно дороже) ИС.
На рис. 2 показан один из возможных вариантов
классификации информационных систем по функциональному
признаку с учетом уровней управления и уровней квалификации
персонала.
Из рис. 2 видно, что чем выше по значимости уровень
управления, тем меньше объем работ, выполняемых
специалистом и менеджером с помощью информационной
системы. Однако при этом возрастают сложность и
интеллектуальные возможности информационной системы и ее
роль в принятии менеджером решений. Любой уровень
управления нуждается в информации из всех функциональных
систем, но в разных объемах и с разной степенью обобщения.
Основание пирамиды составляют информационные
системы, с помощью которых сотрудники-исполнители
занимаются операционной обработкой данных, а менеджеры
низшего звена - оперативным управлением. Наверху пирамиды
на уровне стратегического управления информационные
системы изменяют свою роль и становятся стратегическими,
поддерживающими деятельность менеджеров высшего звена по
принятию решений в условиях плохой структурированности
поставленных задач.
Рис. 2.1 - Типы информационных систем
в зависимости от функционального признака
с учетом уровней управления и квалификации персонала.
В любой фирме желательно иметь несколько локальных
ИС разного назначения, которые взаимодействуют между собой
и поддерживают управленческие решения на всех уровнях. На
рис. 4 показан один из таких вариантов. Между локальными ИС
организуются связи различного характера и назначения. Одни
локальные ИС могут быть связаны с большим количеством
работающих в фирме систем и иметь выход во внешнюю среду,
другие связаны только с одной или несколькими родственными.
Современный подход к организации связи основан на
применении локальных внутрифирменных компьютерных сетей
с выходом на аналогичную ИС другой фирмы или
подразделение корпорации. При этом пользуются ресурсами
региональных и глобальных сетей.
23
Управленческие решения на разных уровнях
ИС учета и
хранения
сырья и
материалов
ИС
оперативного
контроля за
производством
ИС
взаимодействия
с поставщиками
ИС
маркетинга
и продаж
Рис. 4. Примеры информационных систем, поддерживающих деятельность фирмы
На основе интеграции ИС разного назначения с помощью
компьютерных сетей в фирме создаются корпоративные ИС.
Подобные ИС предоставляют пользователю возможность
работать как с общефирменной базой данных, так и с
локальными базами данных.
Рассмотрим роль корпоративной ИС в фирме
относительно
формирования
стоимости
выпускаемой
продукции.
Информационные системы в фирме, поддерживая все
стадии выпуска продукции, могут предоставлять информацию
разной степени подробности для анализа, в результате которого
выявляются этапы, где происходит сверхнормативное
увеличение стоимости продукции. В этом случае может быть
выбрана стратегия по уменьшению стоимости продукции.
Результаты принимаемых мер, в свою очередь, отразятся в
информационной системе. Снова можно будет использовать
полученную информацию для анализа. И так до тех пор, пока не
будет достигнута поставленная цель.
3 Оценка важности ИС
Для того чтобы выделить IT системы, которые стоит
включать в инфраструктуру мониторинга, необходимо
разобраться в уровне важности и сложности подобных систем.
Предлагается рассматривать ИС в рамках своих классов и
присваивать некоторые условные оценки по следующим
критериям:
A.
Последствия в случае отказа ИС: (критические –
3 балл; значительные – 2 балла; незначительные – 1 балла);
B.
Количество пользователей: большинство – 3
балл; половина персонала – 2 балла; меньшая часть сотрудников
– 1 балла;
C.
Уровень
автоматизации
процессов
на
предприятии: ручная – 1 балла; автоматизированная – 2 балла;
автоматическая – 3 балл.
D.
Допустимое время простоя (доступность, %):
высокая доступность (99,99 - 99,9999%) – 3 балла; средняя (99,5
– 99,95%) – 2 балла; низкая (90 – 99%) – 1 балл.
Возможность заменить ИС человеком (при экстренном
отказе ИС): высокая – 1 балла; средняя – 2 балла; низкая – 3
балл.
Результаты оценок сведем в таблицу 3.1.
E.
Таблица 3.1 – Сведенные результаты оценки важности ИС
Оценка важности\
Классы ИС
A
B
C
D
E
Итого
Производственная
2
2
3
3
2
12
Маркетинговая
Финансовая
1
2
1
2
1
2
1
2
1
1
5
9
Кадровая
3
2
1
1
1
8
ИС руководства
1
3
3
3
2
12
Таким образом, опираясь на таблицу 3.1 и используя
бально-рейтинговую систему,можно сделать следующие
рекомендации:
1.
ИС, набравшие выше 10баллов следует включать в
комплексную инфраструктуру мониторинга (в том числе
применять инструменты резервного копирования информации и
т.д.). В случае выхода из строя подобной ИС, последствия на
бизнес могут быть критичными.
2.
Для ИС имеющих средние оценки (от 6 - 9 баллов)
рекомендуется так же применять инструменты мониторинга
(возможно узконаправленные и менее дорогие и эффективные,
чем для критически важных ИС).
3.
ИС с низкими оценками (ниже 1 балла) нет
необходимости
включать в инфраструктуру мониторинга.
Достаточно использовать инструменты резервного копирования,
как самой ИС, так и её последних изменений.
26
КОНТЕКСТ ПРОЦЕССОРА И ЕГО РОЛЬ
В ПЕРЕКЛЮЧЕНИИ ПОТОКОВ
Е. И. Клименков
Белорусский Государственный Университет
Информатики и Радиоэлектроники, г. Минск, Беларусь
[email protected]
Одними
из
ключевых
понятий
связанных
с
многозадачностью являются понятия потока и переключения
потоков.
Фундаментальной основой понятия потока является поток
инструкций
(ПИ),
который
можно
определить
как
последовательность инструкций программы выполняемых в
соответствии с правилами выборки инструкций (ПВИ) целевого
процессора в контексте расположения кода программы в памяти
компьютерной системы. Иными словами, ПИ можно определить
через указатель на следующую выполняемую инструкцию в
контексте памяти компьютерной системы, в которой
расположена исполняемая программа в совокупности с набором
ПВИ целевого процессора. В связи с тем, что большинство
современных процессоров построено на базе стековой
организации вычислений, целесообразно расширить понятие ПИ
до понятия потока управления. Под потоком управления (ПУ)
понимается ПИ, выполняющийся в контексте определенного
стека. ПУ может быть выражен парой из связанных указателей:
указателя следующей инструкции и указателя вершины стека. В
контексте архитектуры процессоров семейства Intel x86 ПУ
реализуется регистрами EIP, ESP и EFLAGS. Состояние
последнего напрямую влияет на работу инструкций из набора
инструкций ветвления ПИ.
Основой переключений потоков любого уровня
абстракции, является переключение потоков управления.
Переключение ПУ может быть реализовано следующим
образом:
27
void
__declspec(naked)
__fastcall
switch_control_flow(cf*
outgoing, cf* incoming)
{
…
__asm mov [outgoing].stack_pointer, esp ; // переключение
стеков
__asm mov esp, [incoming].stack_pointer;
…
__asm ret; // переключение потоков инструкций
}
Работа, выполняемая процессором, зависит не только от
потока управления выполняемого процессором, но также и от
содержимого регистров процессора используемых потоком
управления, потому что регистры являются основными
элементами памяти, используемыми для хранения данных над
которыми процессор производит операции. Более того, набор
инструкций процессоров семейства Intel x86 содержит только
одну группу инструкций, оба операнда которой могут
одновременно находиться в оперативной памяти компьютерной
системы – MOVSx. Исходя из этого, может быть введено
понятие контекста процессора или аппаратного потока
понимаемого как поток управления в совокупности с
содержимым всех регистров процессора используемыми
данным потоком управления во время выполнения. В связи с
этим,
переключение
аппаратных
потоков
может
рассматриваться как переключение потоков управления,
которому предшествует сохранение содержимого регистров
процессора используемых потоком управления, покидающим
процессор, в оперативной памяти компьютерной системы. И за
которым следует восстановление содержимого регистров
процессора используемых потоком управления, которому
передается процессор. Таким образом, переключение
контекстов
процессора
позволяет
выполнять
замену
выполняющихся потоков управления прозрачно для заменяемых
потоков, соответственно не требуя их явного участия в
организации разделения процессорного времени. Отсюда
28
следует, что абстракция аппаратного потока является
минимальной абстракцией потока, достаточной для реализации
многозадачности разделением времени.
void __declspec(naked) switch_hw_thread(hw_thread* outgoing,
hw_thread* incoming)
{
// store CPU context of outgoing thread
__asm mov [outgoing].stack_pointer, esp ; // stack switch
__asm mov esp, [incoming].stack_pointer;
// restore CPU context of incoming thread
__asm ret; // instruction stream switch
}
Процессоры архитектуры Intel x86 содержат в себе
следующие наборы регистров:
 регистры общего назначения (EAX, EBX, ECX,
EDX, EBP, ESI, EDI),
 сегментные регистры (CS, SS, DS, ES, GS, FS),
 регистры потока управления (EIP, ESP, EFLAGS),
 регистры FPU/MMX (ST0/MMX0, ST1/MMX1, …,
ST7/MMX7),
 регистры SSE (XMM0, XMM1, …, XMM7),
 отладочные регистры,
 регистры управления (CR0, CR1, CR2, CR3, CR4),
 регистры, зависимые от модели процессора.
Все группы регистров процессора с архитектурой x86
можно разделить на несколько групп:
 Устаревшие регистры – сегментные регистры;
 Регистры глобального состояния процессора –
регистры управления и, практически все регистры,
зависимые от модели процессора.
29

Опциональные – регистры FPU/MMX, регистры
SSE и отладочные регистры;
 Обязательные – регистры общего назначения и
регистры потока управления.
Не все группы регистров процессора входят в состав
контекста процессора. В контекст процессора входят все
регистры из группы обязательных, а также в зависимости от
природы потока управления лежащего в основе аппаратного
потока, могут входить регистры из группы опциональных
регистров. Оценка стоимости выполнения переключения
потоков управления в среде процессоров архитектуры x86
(Pentium III Xeon)[1] показала, что эта операция является
относительно дешевой. На одно переключение потоков
управления тратиться в среднем 20 тактов, что меньше чем
время необходимое для выполнения пары инструкций CLI/STI
или инструкции деления DIV [2]. В то же время, переключение
аппаратных потоков требует от 36 до 1426 тактов, в зависимости
от набора используемых опциональных регистров и
используемых
инструкций
сохранения/восстановления
состояния регистров. Как видно из полученных данных, на
прозрачное поддержание целостности контекста процессора при
переключении аппаратных потоков, необходимое для
реализации многозадачности с
разделением времени,
приходятся основные затраты при переключении потоков, доля
которых в общей стоимости переключения аппаратных потоков
может составлять от 44,4% и до 98,6%. Иными словами,
переключение аппаратных потоков может быть более чем в 70
раз дороже, чем переключение потоков управления.
Литература
1. Pentium® III Xeon™ Processor at 500 and 550 MHz.
Datasheet. [Электронный ресурс]/Intel corp. – Электрон.
Текстовые
дан.
–
2013
–
Режим
доступа:
ftp://download.intel.com/design/PentiumIII/xeon/datashts/24509402.
pdf
2. Agner Fog. Optimization manuals. Vol. 4. Instruction
tables: Lists of instruction latencies, throughputs and micro-operation
30
breakdowns for Intel, AMD and VIA CPUs [Электронный
ресурс]/Agner Fog – Электрон. Текстовые дан. – 2013 – Режим
доступа: http://agner.org/optimize/instruction_tables.pdf
СЕГМЕНТАЦИЯ РУКОПИСНЫХ СИМВОЛОВ
С ИСПОЛЬЗОВАНИЕМ АЛГОРИТМА
ДЕНДРИТНЫХ КЛЕТОК DCA
И. В. Мельникова1, А. А. Шаталов2
каф. АИСУ, Старооскольский технологический институт (филиал)
ФГОУ ВПО НИТУ МИСИС, г. Старый Оскол, Россия
[email protected] , [email protected]
Распознавание рукописного текста (далее текста)
является одним из направлений распознавания образов. В
системах распознавания рукописных и машинописных текстов
важным этапом в последовательности операций по
распознаванию объектов является сегментация изображения.
Роль сегментации сводится к отысканию на плоскости
изображения элементов, подвергаемых распознаванию, таких
как строки символов, отдельные слова или символы, рисунки,
таблицы и т.п.[1]. Существуют следующие методы сегментации
представленные в таблице 1.
31
Таблица 1.
Название метода
Метод
анализа
«профилей»
Методы основанные на
«диаграммах Вороного».
Адаптивное
выделение
символов
рукописного
текста
Достоинства
Недостатки
Прост в исполнении
Слишком много допущений при работе
с рукописным текстом
Малые показатели ошибок.Сложный математический аппарат
Хорошее быстродействие
Адаптивность
Большое
количество
графических
Хорошее быстродействие
преобразований(как известно графика
использует много системных ресурсов)
Однородные
клеточные Прост в исполнении
автоматы
Алгоритмы разрезания и Хорошее быстродействие
склеивания символов .
Медленное функционирование
Наличие осложняющих обстоятельств
Основной
является
задача
выделения
полезной
информации, под которой
понимают задачу сегментации
исходного текста на отдельные символы – шаблоны. Нужно
отметить, что задача до настоящего времени является слабо
решенной [2]. На сегодняшний день существует несколько
методов, результаты применения которых дают хорошие
результаты. Ряд алгоритмов для решения задачи сегментации
представлены, например, в работах [3] ,[4]. Однако все эти
методы имеют определенное ограничение: символы в
представленном тексте должны быть разделены, в противном
случае качество сегментации может весьма разниться.
Задача сегментации рукописного текста сводится к
выделению из основного множества (А) подмножеств (a[i]),
содержащих информацию требуемую для распознания.
Здесь множеством А являются отдельные слова, а
подмножествами a[i] - буквы.
Авторами было исследована возможность применения
для решения задачи сегментации алгоритма дендритовых клеток
(Dendritic Cell Algorithm(DCA)), предназначенного для
идентификации заведомо неизвестной информации. [5] Строку
связанного текста можно отнести к данным подобного рода, так
как требуется вычленить отдельные символы из массива
одинаковых по начертанию элементов почерка. Для упрощения
предполагается, что текст уже выровнен и очищен от шума.
Рис.1. Блок-схема работы алгоритма дендритных клеток.
34
Алгоритм дендритных клеток(DCA) основан на функции
дендритных
клеток(DCs),
главная
роль
которых
–
предоставление антигенов [7]. В природе дендритные клетки
выполняют различные функции, определяемые их состоянием
зрелости. Переключению этих состояний способствует
обнаружение сигналов, называемых сигналом опасности(DS),
патогенными шаблонами(РАМPs), безопасным сигналом (SS) и
воспалительными клетками (inflammatory CKs). Состояние
зрелости дендритной клетки определяется относительной
концентрации этих четырех типов сигнала..Несозревшие
дендритные клетки находятся в ткани, где они собирают
антигены и принимают сигналы. На основе комбинации
полученных сигналов, созревание дендритной клетки
происходит в двух различных вариантах, зрелые или
полузрелые.
Зрелые
дендритные
клетки
производят
активационный эффект, в то время как полузрелые
успокаювающий. Различные выходные сигналы различаются
достаточно, чтобы обеспечить два различных контекста
представления антигена.
– Сигнал опасности(danger signal) образуется в результате
повреждений клеток ткани, также повышает количество зрелых
дендритных клеток, но менее эффективен чем PAMP сигнал
–Безопасный сигнал(safe signal) образуется в результате
регулиремой смерти клеток и я ляется причиной увеличения
полузрелых дендритных клеток и уменьшения зрелых.
– Воспалительные клетки используются для усиления
остальных сигналов.
Алгоритм дендритных клеток(DCA) был разработан как
часть «Проекта Опасность» под эгидой Ноттингемского
университета [8], цель которого найти недостающую связь
между Искусственными иммунными системами (ИИС) и
обнаружением вторжений. «Теория опасности» предполагает,
что
иммунная
система
не
занимается
постоянным
распределение белков на «свои» и «чужие», а реагирует на
вредоносное воздействие на хозяина. Дендритные клетки
являются компонентом этого механизма.
35
Использование дендритных клеток означает, что
множество элементов данных в виде антигенов отбираются
множество раз. Если одна дендритная клетка представляет
некорректную информацию, это становится несущественным
при условии, что большинство дендритных клеток содержат
корректную. Сбор данных соединён с контекстной
информацией, полученной в процессе сбора антигена.
Различные комбинации входных сигналов дают результатом
различные контексты антигена. Полузрелый контекст антигена
означает, что данные антигена были собраны при нормальных
условиях, в то время как зрелый контекст антигена означает
потенциально аномальные элементы данных. Характер реакции
определяется путем измерения количества зрелых дендритных
клеток, представленного значением MCAV. Чем ближе эта
функция алгоритма к 1, тем больше вероятность того, что
антиген является аномальным. Значение MCAV используется
для оценки степени аномальности данного антигена. Применяя
пороги различного уровня, может быть выполнен анализ для
оценки возможности алгоритма к обнаружению аномалий.
Алгоритм дендритных клеток имеет три стадии:
инициализация, обновление и агрегация. Инициализация
заключается в установке различных параметров, далее следует
этап обновления. Этап обновления можно разбить на
обновление ткани и клеточный цикл. Обновление ткани
представляет собой непрерывный процесс, при котором
обновляются значения структур ткани. Это происходит по
событийным сценариям, с обновлением сигналов и антигена
каждый раз при появлении информации в системе. Обновление
сигналов обеспечивает входные сигналы для популяций
дендритных клеток. Клеточный цикл является дискретным
процессом, происходящий при определенной пользователем
скорости. Во время клеточного цикла дендритные клетки
получают доступ к сигналам и антигенам из тканевых структур.
Это включает в себя обновление каждой дендритной клетки в
системе новыми значениями сигналов и антигена. Клеточный
цикл продолжается до достижения критерия остановки, обычно
36
пока не обработаются все данные антигена. На этапе агрегации
производится анализ собранных антигенов и расчёт MCAV.
Все версии DCA до настоящего времени использовали
относительно большое число параметров и стохастических
элементов, таких как случайный выбор клеток и переменные
пороги. Настройка этих параметров для соответствующих
значений всегда была несколько неопределенной и тем самым
оставляла алгоритм открытым для критики. Одним из
недостатков
DCA
является
огромное
количество
взаимодействующих сущностей. В результате этого, до сих пор
неясно,
какая
часть
алгоритма
ответственна
за
производительность и его временно-корреляционные качества.
Ввиду громоздкости такого математического аппарата
Julie Greensmith и Uwe Aickelin [10], была разработана
модификация алгоритма названная детерминированным
алгоритмом дендритных клеток. Для тог, чтобы получить
детерминированную версию алгоритма, необходимо сделать ряд
предположений и изменений в оригинальном DCA:
Для корректной работы системы необходимы и сигналы
и антигены. Если сигналы отсутствуют, то DCs не будут
достигать своего предела продолжительности жизни и будут не
в состоянии представлять антиген. Если отсутствуют антигены,
то изучаемый контекст не содержит объект.
Требуются как минимум два типа сигнала, сигнал
активации и сигнал подавления – сигнал опасности (DS) и
безопасный сигнал (SS) соответственно.
В популяции
продолжительность жизни DC
устанавливается одинаковой. Это позволяет нагляднее изучать
процессы, происходящие в одни и те же временные промежутки
при работе алгоритма DCA
Каждая DC в популяции подвергается воздействию
идентичного входного сигнала и обрабатывает этот сигнал
идентичным образом. Результатом этого является оптимизация
процедуры обработки сигнала, так как значения выходных
сигналов рассчитываются один раз для целой популяции, как
это было предложено Оутс и др.. [9].
37
Выходное значение индивидуальной DC сводится к
одному значению,
, отрицательные значения которого
указывают на сохранность и положительные на используемую
ранее зрелость. Это также вытекает из теоретического анализа,
приведенного Оутс и др.. [9].
В этой системе используется еще одно улучшение. Это
профиль антигена. В предыдущих реализациях DCA, антигены
строкового типа хранились в структуре «вектор антигенов». Это
требовало случайного выбора антигена каждой DC и перезаписи
антигена. Для обеспечения точного воспроизводства случайная
выборка и сохранение заменены простым массивом. В этом
массиве вместе со значением антигена хранится
число,
указывающее сколько раз данная DC получала антиген этого
типа. Это уменьшает нагрузку (поскольку нет динамического
управления памятью) и исключает угрозу переполнения памяти
значениями антигена.
Предыдущие версии DCA обрабатывали более 10
параметров, каждый из которых был получен из эмпирических
биологических
наблюдений
и
посредством
анализа
чувствительности. Конечный алгоритм содержит три параметра.
Во-первых, определенное число DCs. Во-вторых, весовая схема
для обработки сигналов. Уравнение обработки сигнала
использованное ранее модифицировано для использования с
упрощенными значениями весов. Как и в оригинальном DCA,
входные сигналы преобразуются в выходные. Для имитации
процессов преобразования сигналов, происходящих в тканях,
ввели коэффициент . Включение
сокращает выходные
сигналы с трех до двух, и это сочетается с сокращением
входных сигналов до двух категорий.
Новая процедура обработки сигналов показана в
уравнениях 1 – 4, где S и D соответственно являются входными
значениями для сигналов сохранности и опасности.
csm = S + D
(1)
k = (mature – semi)
(2)
k = (D – S) – S
(3)
k = D – 2S
(4)
38
MCAV рассчитывается как только собраны все данные и
зависит от выходных сигналов клеток собранных в ходе работы.
Это значение рассчитывается для каждого типа антигена ( ),
где является набором антигенов с одинаковым значением.
В соответствии с названием MCAV является
пропорциональной мерой антигенов, представленных зрелыми
клетками, как показано в выражении (5) где
– это
MCAV для антигена типа , M – число «созревших» антигенов
типа , Ag – это общее количество антигенов данного типа.
(5)
Данная метрика возвращает значение между 0 и 1,
вероятность того что
антиген является аномальным
увеличивается по мере приближения этой величины к 1. Это
удобный, нормализованный выход к которому может быть
применено пороговое значение.
используется только с dDCA, и использует величины
значения . Эта величина даёт реальную оценку аномальности
и может помочь различить нормальные и аномальные
процессов.
Метод подсчёта этой оценки аномальности показан в
выражении (6), где
– это значение
m-ой дендритной
клетки,
– число антигенов типа m-ой дендритной клетки.
(6)
Это уравнение может быть предложено как метод для
определения
порога
аномальности,
позволяющий
классифицировать проанализированные типы антигенов,
поскольку возвращает вещественные
числа зависящие от
фактических значений использованных входных сигналов.
Порог, , опреределяется по выражению (7), где
взвешенная
сумма всех входных сигналов, определяемая выражением (8) ,
число пар источников сигнала,
среднее число итераций за
жизнь клетки, а D и S представлют значения сигнала опасности
и сохранности соответственно.
39
(7)
(8)
При применениии
к
, типы анигенов с значением
большее порога, классифицируются как аномальные, а со
значением ниже – нормальными. [10]
Основываясь на анализе алгоритма дендритных клеток,
формально задачу можно представить следующим образом:
40
Рис 2. Обобщенная блок-схема алгоритма работы системы
41
В качестве основного источника информации взята
виртуальная «каретка» размеры которой варьируются от
KSmin(10 пикселей) до KSmax.
Антиген – содержание каретки в виде битовой карты(0 и
1) изображения.
Сигналы - источник входных сигналов будет варьируемым
для сличения результатов и выбора наиболее подходящей
формализации
Save Signal(S) - отношение белых пикселей к общему
количеству.
Danger Signal(D) - афинность содержимого каретки по
отношению к абстрактному шаблону.
Обобщенная блок-схема алгоритма работы системы
представлена на рис.2.
Результаты эксперимента.
Результаты теста рис.3 иллюстрируют качество
сегментации русского и латинского текста. Как видно из
рисунка, алгоритм DCA хорошо справляется с разделением
символов. Появление «артефактов» сегментации обусловлено
наличием в алгоритме операторов, имеющих вероятностный
характер. Устранение артефактов в дальнейшем возможно
посредством
настройки
коэффициентов
в
алгоритме
сегментации, однако текущие результаты позволяют говорить о
работоспособности разработанного метода и перспективах его
дальнейшего
совершенствования.
Указанное
время
иллюстрирует скорость работы алгоритма DCA , подтверждая
высокое быстродействие данного алгоритма.
42
Рис.3 Результаты эксперимента
Полученные экспериментальные результаты позволяют
говорить, что хотя предлагаемый прототип системы
сегментации требует дальнейших исследований, но в целом
имеет потенциал развития. По итогам проведенного авторами
анализа существующих применений «теории опасности», можно
сделать вывод о актуальности и перспективности данного
направления развития систем искусственного интеллекта.
Литература
1. Литвиненко В.И., Дидык А.А., Захарченко Ю.А.
Компьютерная система для решения задач классификации на
основе
модифицированных
иммунных
алгоритмов//
Информационно-измерительные системы, ААЭКС, №2(22),
2008.
2. Травин А. Технологии оптического распознавания
текстов // Электронный офис. Ноябрь. 2007.
3. Горошкин А. Н. Обработка и распознавание рукописного
текста в системах электронного документооборота: автореферат
дис. ... кандидата технических наук : 05.13.01 / Красноярск.
СибГАУ, 2008. – 22 c.
4. Запрягаев С.А., Сорокин А.И. Сегментация рукописных
и машинописных текстов методом диаграмм вороного / Вестник
Воронежского
государственного
университета.
Серия:
Системный анализ и информационные технологии. 2010. № 01.
С. 160-165.
5. Julie Greensmith, Amanda Whitbrook, Uwe Aickelin
Artificial Immune Systems, Handbook of Metaheuristics, 2nd
edition, Springer, 2010, 27p.
6. Искусственные иммунные системы и их применение /
Под ред. Д. Дасгупты. Пер. с англ. под ред А.А. Романюхи. —
М.: ФИЗМАТЛИТ, 2006. 344 с.
7. Julie Greensmith, Uwe Aickelin, Jamie Twycross
Articulation and Clarification of the Dendritic Cell Algorithm
Proceedings of the 5th International Conference on Artificial
Immune Systems, Oeiras, Portugal p. 404-417.2006
8. http://ima.ac.uk/danger
9. R. Oates, G. Kendall, and J. Garibaldi and. Frequency
analysis for dendritic cell population
tuning: Decimating the dendritic cell. Evolutionary Intelligence:
Special Issue on Artificial Immune Systems, 2008.
10. Julie Greensmith, Uwe Aickelin
The
Deterministic
Dendritic Cell Algorithm
Proceedings of the 7th International
Conference on Artificial Immune Systems (ICARIS 2008), LNCS
5132, Phuket, Thailand p.291-303.
2008.
Секция 2. Химические науки
ИЗУЧЕНИЕ (СО)ПОЛИМЕРИЗАЦИИ
МЕТИЛМЕТАКРИЛАТА С МАЛЕИНОВЫМ
АНГИДРИДОМ1
Э. И. Ярмухамедова, Г. Х. Газизова,
А. А. Нургалиева
Федеральное государственное бюджетное образовательное
учреждение высшего профессионального образования «Башкирский
государственный аграрный университет», г. Уфа, Россия
[email protected]
Полимеры и сополимеры малеинового ангидрида (МА), а
также продукты их модификации широко используются в
производстве различных полимерных покрытий, адгезива для
упаковочных материалов, в качестве полимерных присадок в
процессах подготовки и транспорта нефти 1. Сополимеры налкил /мет/акрилатов с малеиновым ангидридом, применяются в
качестве присадок, улучшающих текучесть 2 . В связи с этим
актуальным
является
исследование
(со)полимеризации
метилметакрилата и малеинового ангидрида.
Работа выполнена при финансовой поддержке Федеральной целевой
программы «Научные и научно-педагогические кадры инновационной
России» на 2009-2013 г.г. (Заявка 2012-1.2.1-12-000-1006-004.
Соглашение 8458).
1
45
Радикальная сополимеризация МА с некоторыми
мономерами протекает через образование комплексов с
переносом заряда. Наличие в реакционной массе веществ,
обладающих электродонорными свойствами, тоже влияет на
состав сополимеров малеинового ангидрида [1].
В работе изучена (со)полимеризация метилметакрилата
(ММА) с малеиновым ангидридом (МА) в присутствии 1,3,5 тритиана, инициатор азо–диизобутиронитрил (АИБН). Тритиан
– циклический сульфид, способный к комплексообразованию с
МА.
При
исследовании
полимеризации
ММА,
инициированной АИБН в присутствии малеинового ангидрида и
тритиана, обнаружено снижение скорости процесса с
увеличением содержания МА в полимеризационной смеси.
Вероятно, происходит взаимодействие между тритианом и МА с
образованием комплекса (рис. 1.).
46
Рис. 1. Кинетические кривые полимеризации ММА при 75 оС,
инициированной 1×10-3 моль/л АИБН в присутствии тритиана:
1×10-3 моль/л (1) и малеинового ангидрида: 0,001 (2), 0,010 (3),
0,100 (4), 1,000 (5) моль/л.
При
повышении
концентрации
серосодержащего
соединения общая скорость полимеризации увеличивается (рис.
2).
47
Конверсия,%
2
90
3
1
60
30
0
0
100
200
Время, мин
Рис. 2. Кинетические кривые полимеризации ММА при 75 оС,
инициированной 1×10-3 моль/л АИБН в присутствии
малеинового ангидрида 0,01 моль/л и тритиана:
0(1), 0,005(2), 0,0020 (3) моль/л.
Сополимеризацию
малеинового
ангидрида
с
метилметакрилатом проводили при различных соотношениях
МА : ММА и МА : тритиан. Показано, что гомополимер
малеинового ангидрида при данных условиях реакции не
образует.
Для определения состава сополимеров МА с
метилметакрилатом использовали спектральную методику
анализа в ИК – области. Количественный расчет содержания
звеньев малеинового ангидрида основан на измерении
оптической плотности полосы 1780 см-1, характерной для СО
48
групп МА 2. Сополимер очищали от мономеров, не
вступивших в реакцию, трехкратным переосаждением.
Обнаружено, что увеличение концентрации тритиана
приводит к повышению содержания звеньев МА в сополимерах
с метилметакрилатом.
Таблица. Состав исходной мономерной смеси и содержание МА
в сополимере
Содержание
Содержание МА в
[тритиан]103
мономеров в
полимере,
моль/л
реакционной массе
%
[ММА] : [МА],
мольные доли
0
0,9 : 0,1
10
0
0,8 : 0,2
20
1
0,9 : 0,1
15
1
0,8 : 0,2
25
1
0,7 : 0,3
30
1
0,6 : 0,4
40
Константы сополимеризации r1= 0,72 (ММА) и r2= 0,21
(МА) (при сополимеризации в присутствии тритиана)
рассчитывали по методу Майо-Льюиса и Файнмана-Росса.
Варьируя концентрации тритиана и малеинового
ангидрида можно получить сополимеры различного состава, с
содержанием МА от 10 до 40 %, следовательно, с различными
свойствами.
Литература
1. Рзаев З.Р. Полимеры и сополимеры малеинового
ангидрида.-.Баку: Элм, 1984
2. Ахмедов А.И., Левшина А.М. //Нефтехимия. – 1983. Т.23, N 5. –С. 696.
3. Морозова Л.В., Михалева А.И., Маркова М.В.,
Трофимов Б.А. //Журнал прикладной химии. – 1995. –
Т.68. - №2. – С.341.
49
Секция 3. Биологические науки
МИКРОБНАЯ ПЕРЕРАБОТКА ОРГАНИЧЕСКИХ
ОТХОДОВ В ЭЛЕКТРОЭНЕРГИЮ1
С.М. Абрамов, Е.Н. Быконя
Биологический факультет МГУ имени М. В. Ломоносова,
г. Москва, Россия, [email protected]
Спиртзаводы России ежегодно производят около 1*109
литров этанола. При получении этого количества спирта
образуется 1,1*107 тон послеспиртовой барды, которая является
одним из основных отходов производства.
Для очистки загрязненных стоков в спиртовой
промышленности до настоящего времени применяют поля
фильтрации. Это приводит к заражению и загрязнению
грунтовых вод, открытых водоемов и атмосферы, вынуждает
отводить значительные площади под очистные сооружения. При
этом, с загрязненными водами теряется большое количество
органических (растворимые углеводы, белки) и минеральных
веществ (соли азота, фосфора, микроэлементы), которые могут
быть рассмотрены как потенциальный сырьевой источник для
микробиологического синтеза. Поэтому крайне актуальной
является задача по разработке новых, не наносящих серьёзного
вреда окружающей среде и экономически рентабельных
технологий переработки послеспиртовой барды.
В этом отношении, интересен процесс переработки
сточных вод, содержащих органические вещества в микробном
топливном элементе (МТЭ). Микробная стадия переработки,
реализована за счёт использования электрохимически активных
микроорганизмов, которые в природе способны осуществлять
процесс
восстановления
минеральных
нерастворимых
соединений. Этот процесс осуществляется за счёт переноса
электронов от окисляемого субстрата, по мембранным электрон
1
Работа была выполнена в рамках ГК № 14.12413.1840 НК.
50
транспортным цепям, к нерастворимому акцептору. В МТЭ
акцептором служит анодный электрод топливного элемента [1].
В представленной работе, из природных биотопов были
выделены
электрохимически
активные
сообщества
микроорганизмов. Было показано, что полученные микробные
сообщества способны восстанавливать, нерастворимый при
нейтральных значениях рН, оксид железа (III). Это говорит о
вероятном
наличии
у
этих
микроорганизмов
специализированных
электрон
транспортных
цепей,
осуществляющих перенос электрона от метаболизируемого
субстрата
к
нерастворимому
акцептору
электронов.
Таксономический состав сообществ был изучен методом
денатурирующего градиентного гель электрофореза. В
сообществах, выделенных из ила озера Белое (Московская
область.) и ила озера Тамбукан (Ставропольский край)
преобладающими микроорганизмами были Patulibacter sp.,
Clostridium sp., Bacillus sp., Thermincola sp., Bacteroides sp. и
Haliea sp., Parabacteroides sp., Desulfovibrio africanus
соответственно. Для изучения электрохимических параметров
выделенных сообществ, их культивировали в разработанном
нами МТЭ. Было показано, что сообщество микроорганизмов
выделенное из ила озера Тамбукан, наиболее эффективно
перерабатывало послеспиртовую барду и генерировала
электроэнергию. Так, при использовании в качестве субстрата
жидкой фракции послеспиртовой барды максимальная
мощность составила 2,5 мВт/1 л реактора.
Одним из важнейших направлений для дальнейшего
развития технологии МТЭ является повышение эффективности
транспорта электронов между клетками и электродом. Так
известно, что бактерии рода Geobacter в 1*104 раз активнее
переносят электроны на естественный акцептор (соединения
железа), чем на электрод [2].
Литература
1. Logan B.E. Scaling up microbial fuel cells and other
bioelectrochemical systems // Appl. Microbiol. Biotechnol.,
2010. 85: 1665–1671.
51
2. Holzman D.C. Microbe power. // Environ Health. Persp.,
2005. 113: 754–757.
ЛУГОВЫЕ ФИТОЦЕНОЗЫ И ИХ РОЛЬ
В ФОРМИРОВАНИИ РАСТИТЕЛЬНОСТИ
Д. В. Дерюгин1, С. Г. Сапронова2
Курский Государственный университет, г. Курск, Россия
1
[email protected]
2
Доцент кафедры биологии растений и животных,
кандидат сельскохозяйственных наук
Луга всегда являлись ценными кормовыми угодьями,
используемыми человеком как сенокосы и пастбища. Они очень
разнообразны по происхождению, возрасту, сложившимся
фитоценозам, условиям обитания растений, урожаю. К
сожалению, сегодня на Земле уже почти совсем не сохранилось
естественных лугов, все они постоянно подвергаются
антропогенному давлению и, как следствие, исчезает все больше
и больше растений – все это, в конечном счете, приводит к
потере видового разнообразия. Поэтому необходимо наиболее
полное изучение луговых сообществ и выявление их роли в
формировании растительности, что является одним из
актуальных направлений научной деятельности в настоящее
время.
В лесной зоне Нечерноземья поймы крупных рек бассейна
Волги носят следы явного влияния флоры лесостепи. Так, в
долинах Оки и нижнего течения Клязьмы появляется много
лесостепных видов, отсутствующих на водоразделах. Здесь,
оторванными от своего сплошного ареала, встречаются:
тимофеевка степная Phleum
phleoides
(L.),
тонконог гребенчатый Koeleria
cristata
(L.),
перловник высокий - Melica altissima (L.), чемерица черная.
Veratrum nigrum (L.), лук скорода - Allium schoenoprasum (L.),
ирис сибирский - Iris sibirica (L.), ломонос прямой - Clematis
recta (L.), синеголовник плосколистный - Еryngium planum (L.),
жабрица однолетняя - Seseli annuum (L.) и т. п. Все они могут
52
создавать фрагменты остепненных луговых сообществ, входить
в существующие луговые ценозы или создавать одновидовые
группировки [2].
На территории Восточной Сибири развитию суходольной
луговой растительности препятствуют континентальность
климата и малоснежные зимы. Луга на водоразделах
представлены немногими типами. Наиболее распространены
здесь якутские аласы – луга, развивающиеся в бессточных
понижениях, образовавшихся в результате карстовых процессов
или вымерзания льда из рыхлых почвенных пород. Они всегда
имеют несколько остепненный характер и составлены мелкими
злаками, преимущественно видами овсяницы и мятлика,
осоками и разнообразным разнотравьем, куда входят виды,
распространенные и в европейской части: мышиный горошек Vicia crаcca (L.), подмаренники северный - Galium boreale (L.) и
подмаренник настоящий - Galium verum (L.), щавель кислый Rumex acetosa (L.) и др. Имеются здесь и галофитные луга, или
тураны, приуроченные к берегам солоноватых озер или
окраинам солонцов. Пойменные и низинные луга занимают
обширные площади на Лено-Вилюйской равнине. Многие из
них представлены зарослями вейника Лангсдорфа Calamagrostis langsdorffii (Link) Trin. с примесью бекмании Beckmannia (Host.); имеются также сообщества из мятлика
лугового - Poa pratensis (L.) и разнообразного разнотравья. На
Дальнем Востоке суходольные луга формируются после
сведения лесной растительности на всех элементах рельефа.
Они образуют разные сообщества с господством злаков и
разнотравья. Низинные и пойменные луга иногда занимают
обширные площади. Здесь выделяются крупно-травные луговые
ценозы, особенно развитые на Камчатке и Сахалине, где
основную массу составляют высокорослые злаки и гигантские –
высотой свыше 2 м – растения преимущественно из семейств
зонтичных и сложноцветных [4]. Продуктивность этих
сообществ очень высока, но качество сена низкое.
Распределение лугов по высотным поясам горных районов
аналогично их широтному распространению. В лесном среднегорном поясе все луговые ценозы вторичны, возникли, как и на
53
равнине, в результате вырубки участков леса и с устранением
влияния хозяйственной деятельности человека возвращаются к
исходному типу. Наибольшее своеобразие луговых ценозов
наблюдается в субальпийском поясе, где луговой тип
растительности наряду с лесным находится в оптимальных
условиях для своего произрастания. Луговые ценозы –
сообщества субальпийского высокотравья – вкраплены
фрагментами в леса и у их верхней границы и местами образуют
самостоятельный
высотный
пояс
[3].
Субальпийское
высокотравье характерно для Карпат и Кавказа, некоторых
горных систем Средней Азии и Алтая.
Особенность луговой растительности и ее отличие от
других типов растительного покрова состоят в том, что само ее
появление и существование в подавляющем большинстве
случаев зависит от деятельности человека. Лишь использование
лугов в качестве сенокосных и пастбищных угодий сохраняет их
как тип. При прекращении воздействия человека участки
луговых биоценозов возвращаются к исходному типу
растительного покрова, на месте которого был создан луг. Так, в
лесной зоне европейской части России абсолютные суходолы,
представленные различными сообществами полевицы тонкой Agrostis capillaris (L.), при выходе из сферы хозяйственной
деятельности человека зарастают березой повислой - Betula
pendula (Roth.) и сосной - Pinus (L.); на влажных лугах верховых
местоположений происходит восстановление елового леса через
предшествующий ему березняк; низинные луга с течением
времени превращаются в леса из березы пушистой - Betula
pubescens (Ehrh.) и ольхи черной - Alnus glutinosa (L.). На
участках пойменных лугов, выходящих из черты речных
разливов, формируются биоценозы, близкие к материковым
лугам; со временем они также сменяются древеснокустарниковой растительностью [1].
Таким образом, луга играют большую роль в
формировании растительного покрова. Различные типы лугов
встречаются повсеместно – в горах и на равнине, на склонах
балок и в долине рек, часто являясь естественным типом
54
растительности, а иногда являясь следствием антропогенного
воздействия (вырубки лесов, осушения болот).
Литература
1. Горчаковский П.Л. Антропогенная трансформация и
восстановление продутивности луговых фитоценозов.
Екатеринбург: Изд-во “Екатеринбург”. 1999. – 156 с.
2. Маевский П.Ф. Флора средней полосы европейской
части России. 10-е изд. Москва: Товарищество научных
изданий КМК. 2006. – 600 с.
3. Работнов Т.А. Луговедение. - М.: Изд-во МГУ, 1974. –
384 с.
4. Степановских А.С. Экология: Учебник для вузов. М.:
ЮНИТИ-ДАНА, 2001. – 703 с.
ПОЛУЧЕНИЕ ВИРУСНОГО ВЕКТОРА НА ОСНОВЕ
ГЕНОМА ВИРУСА КУСТИСТОЙ КАРЛИКОВОСТИ
ТОМАТОВ, ОБЕСПЕЧИВАЮЩИЙ ТРАНЗИЕНТНУЮ
ЭКСПРЕССИЮ GFP В КЛЕТКАХ РАСТЕНИЙ.
А. Д. Каиржанова1,2, А. О. Абекова1, Ш. А. Манабаева1
РГП «Национальный центр биотехнологии» КН МОН РК,
г. Астана, Казахстан1,
Евразийский Национальный университет им. Л. Н. Гумилева2
е-mail: [email protected]
Одним из наиболее эффективных методов, позволяющих
быстро получать в растениях значительные количества целевого
белка,
является
использование
самореплицирующихся
рекомбинантных вирусных векторов. Векторы на основе
геномов фитовирусов успешно применяются для продукции в
растениях белков медицинского назначения, в том числе
вакцинных белков возбудителей бешенства [1], чумы [2], βсубъединицы термолабильного энтеротоксина [3], антител [4] и
многих других. Идея данного метода состоит в интеграции гена,
кодирующего необходимый чужеродный белок, в геном
растительного вируса и заражении модифицированным вирусом
55
растительных клеток. При инфекции синтезируются не только
собственные белки вируса, но и целевой белок. Продукция
рекомбинантного белка в такой системе может достигать до
20% от общего растворимого белка растений. Известно, что
одним из основных факторов, ограничивающих Agrobacteriumопосредованную систему транзиентной экспрессии генов и, в
частности, экспрессию целевых белков в вирусных системах
экспрессии, является одна из защитных систем растения
посттранскрипционное умолкание генов (ПТУГ) - механизм
регуляции экспрессии генов, оснований на специфичном
узнавании и деградации РНК. В тоже время, было показано, что
транзиентная ко-экспрессия целевого гена с геном белка р19 из
вируса кустистой карликовости томатов (ВККТ) ингибирует
посттранскрипционное умолкания генов и повышает уровень
экспрессии целевых белков в растениях. Белок р19 является
супрессором противовирусной реакции клеток растения-хозяина
- «умолкания генов» в составе вирусной РНК. В связи с этим,
представляется интересным изучение генома вируса кустистой
карликовости томатов (ВККТ) в качестве автономно
реплицирующегося вектора для создания генно-инженерных
конструкций обеспечивающих транзиентную экспрессию
целевых белков в растениях.
Таким образом, целью нашего исследования являлась
апробация
молекулярного
модульного
комплекса,
сконструированного на основе вируса кустистой карликовости
томатов (ВККТ) предназначенного для осуществления процесса
временной (транзиентной) экспрессии целевого белка GFP в
цитозоли растительных клеток.
Материалы и методы
В работе были использованы бактериальные штаммы
Escherichia coli XL-Blue и Agrobacterium tumefaciens LBA4404, а
также растения Nicotiana benthamiana. Все растения,
используемые в опыте, были высажены в виде семян
непосредственно в тепличный грунт, где их выращивали в
течение 6-8 недель.
Дизайн целевого гена зеленого флуоресцентного белка и
генно-инженерной конструкции на основе генома ВККТ
56
выполнен с использованием пакета программ Vector NTI 11.5
(Invitrogen,
США).
Праймеры
рассчитаны
с
таким
перекрыванием, чтобы в дальнейшем использовать их в ПЦР м
температурой отжига 600 С. Для синтеза генов de novo, при
расчетах олигонуклеотидных праймеров, праймеры делили на
две группы – «внутренние» и «фланкирующие». «Внутренние»
праймеры 100% гомологичны определенному участку
рассчитанной последовательности синтезируемого гена,
совокупность «внутренних» праймеров покрывает всю длину
гена. «Фланкирующие» праймеры предназначены для концов
синтезируемого гена и несут уникальные сайты узнавания
рестриктаз для последующего клонирования фрагмента ДНК,
синтезированного de novo, в плазмидах. При проведении ПЦР
использовалась высокоточная полимераза Pfu (Thermo Scientific,
США).
Подтверждение правильности сборки гена в синтезе de
novo
проводили
путём
определения
нуклеотидной
последовательности
ДНК
клонированных
фрагментов.
Секвенирование проводили с использованием наборов Big Dye
3.1 на автоматическом секвенаторе ABI Prism 3100 (Applied
Biosystems, США).
В качестве базового был использован вектор, созданный
ранее на основе генома ВККТ, любезно предоставленный
доктором H. Scholthof [1]. Его особенность состоит в том, что в
нем вирусный геном был встроен под промотором Т7 для
получения
вирусной РНК в in vitro и нуклеотидная
последовательность
кодирующая
капсидный
белок
модифицирована в результате внедрения полилинкера с
множественными сайтами рестрикции.
Исходя из вышеизложенного, был проведен in silico
дизайн вирусного генома ВККТ для получения генноинженерной конструкции с геном GFP. В данной конструкции
была сохранена последовательность, кодирующая первые 28
аминокислот белка оболочки, следом за которой расположена
последовательность гена GFP. В результате, целевой белок
имеет дополнительный фрагмент
БО на N-конце.
Предполагается, что экспрессия GFP будет проходить
57
эффективнее, благодаря имитации природного контекста гена
БО.
Результаты
В результате двухэтапного химического синтеза с
помощью ПЦР был получен ген GFP (зеленого флуоресцентного
белка) длиной 751 пар нуклеотидов, содержащий сайты
рестрикции NotI и AgeI. Продукт амплификации второго раунда
был обработан смесью рестриктаз NotI и AgeI. В этом же
эксперименте был приготовлен вектор для клонирования. В
качестве векторной молекулы использовали плазмиду pRS2,
которую обрабатывали рестриктазами NotI и AgeI в присутствии
фосфатазы SAP. Подготовленный вектор был смешан со
вставкой и обработан лигазой, после чего лигазными смесями
трансформировали
в
компетентные
клетки
XL-Blue.
Трансформированные клетки высевали на агаризованную среду
с добавлением ампициллина (100 мкг/мкл). Из выросших
клонов-трансформантов были выбраны семь клонов, которые
использовали для выделения ДНК. В результате данных
процедур была получена ДНК плазмиды pRS2/GFP, несущая
вставку целевого гена GFP. Было выполнено секвенирование
плазмидных ДНК из этих клонов, и выбран клон, в котором
последовательности, целевого гена имели правильную
структуру. В дальнейшем из плазмиды p RS2/GFP целевой ген
был вырезан с помощью рестриктаз NotI и AgeI очищен из 1%
агарозного геля и в последующем был клонирован (лигирован) в
вирусный вектор, обработанный NotI и AgeI, созданный на
основе генома ВККТ. В данной конструкции геном ВККТ
находился под промотором Т7 для получения вирусной РНК в
in vitro. Для того чтобы создать вектор ВККТ-GFP
транслируемая последовательность капсидного белка р41
частично была заменена на последовательность гена GFP,
модифицированной шестью гистидинами.
Таким образом, в данной генно-инженерной конструкции
целевой ген GFP был встроен внутрь рамки считывания гена
кодирующего капсидный белок, по границам которого
находятся сайты рестрикции NotI и AgeI. При этом участок гена
белка оболочки перекрывающий субгеномный промотор был
58
сохранен. Далее, чтобы проверить возможность транзиентной
экспрессии GFP в данной конструкции, плазмидная ДНК была
линеаризована с использованием SmaI и были получены
вирусные РНК транскрипты in vitro с использованием Т7 РНКполимеразы. Затем проводили инокуляцию растений Nicotiana
benthamiana с вирусной РНК, на 3-ий день после инокуляции
наблюдали экспрессию гена GFP под ультрафиолетовой лампой,
что является прямым доказательством подтверждения
правильной встройки GFP в геном вируса и возможности
транзиентной экспрессии данного гена в клетках растений.
Основой для нового вирусного вектора послужил вектор
pJL. Репликон (фрагмент вирусного генома способного к
автономной репликации в пермиссивных клетках) ВККТ-GFP
был амплифицирован с помощью ПЦР используя праймеры (F:
AGGATCGATAATTCTCCAGG
и
R:CGATCGGGGAAATTCGAGCT)
содержащие
сайты
рестрикции GlaI и PvuI, на матрице Т7-ВККТ-GFP. Далее
полученный фрагмент ВККТ с модифицированным геном GFP
был клонирован в бинарный вектор pJL в под контролем
сильного конститутивного промотора 35S вируса мозаики
цветной капусты (CaMV) по сайтам рестрикции GlaI и PvuI, в
результате чего был получен вирусный вектор Т-ВККТ-GFP.
В результате был получен бинарный вектор, содержащий
в своем составе копию самореплицирующегося вируса – вектора
ВККТ, продуцента целевых белков. Правильность собранной
конструкции подтверждена рестрикционными анализом.
Проведена трансформация клеток Agrobacterium tumefaciens
вирусным вектором Т-ВККТ-GFP путем электропорации.
Для детекции экспрессии белка GFP в листья Nicotiana
benthamiana после 3-4 дней агроинфильтрации провели
мониторинг под ультрафиолетовым светом. Методом Бредфорда
определили
общее
количества
GFP
белка,
агроинфильтрованные листья экстрагировали в ТЕ- буфере
(10мМ Трис рН 7,5, 1мМ ЭДТА). С помощью
спектрофотометрии определили общее количество белка GFP,
которое составило 200-250 мкг на 1 грамм сухой массы листа.
После определения концентрации, белки были нанесены на
59
SDS- гель и окрашивание белков в гелях провели красителем
Кумасси (рис 1а). Экспрессия белка GFP была подверждена с
помощью Вестерн- блот анализа, с помощью специфических
моноклональных антител к зеленому флуоресцентному белку
(рис 1б)
а)
б)
27 kb
Рис 1а. Окрашенный Coomassi SDS- гель, 1-6 образцы с разной
концентрацией белка: 1 - 199 мкг, 2- 300 мкг, 3- 330 мкг, 4- 280
мкг, 5- 240 мкг, 6- 294.
Рис 1б. Определение транзиентной экспрессии GFP в Nicotiana
benthamiana при помощи Western Blot. 1- маркер, 2-10 образцы с
разной концентрацией белка. 3-5 и 8-9 бенды не выявлены с
связи с низкой концентрацией белка, которое в среднем
составляет 80-100 мкг.
60
Заключение
В нашей работе качестве вирусного вектора
использовался вирус кустистой карликовости томатов (ВККТ).
В результате частичной замены гена белка оболочки ВККТ
геном GFP с оптимизированной последовательностью в геноме
ВККТ получен репликон ВККТ-GFP, обеспечивающий
транзиентную экспрессию GFP в клетках растений. В результате
клонирования репликона ВККТ-GFP в бинарный вектор pJL был
получен вирусный вектор Т-ВККТ-GFP, содержащий полный
геном ВККТ с геном GFP, помещенным под контролем
сильного конститутивного промотора 35S вируса мозаики
цветной капусты (CaMV) обеспечивающий экспрессию ВККТGFP в растениях.
Литература
1. Yusibov, V., Hooper, D., Spitsin, S., Fleysh, N., Kean, R.,
Mikheeva, Т., Deka, D., Karasev, A., Cox, S., Randall, J.,
Koprowski, H. (2002) Vaccine, 20, 3155-3164.
2. Santi L, Giritch A, Roy CJ, Marillonnet S, Klimyuk V, Gleba Y,
Webb R, Arntzen CJ, Mason HS. (2006) Proc. Natl. Acad. Sci. USA,
103, 861-866.
3. Wagner, В., Hufnagl, К., Radauer, С., Wagner, S., Baier, K.,
Scheiner, O., Wiedermann, U. Breiteneder, H. (2004) J. Immunol.
Methods, 287, 203-215.
4. Giritch A, Marillonnet S, Engler C, van Eldik G, Botterman J,
Klimyuk V, Gleba Y. (2006) Proc. Natl. Acad. Sci. USA, 103,
14701-14706.
61
РИТМЫ СЕЗОННОГО РАЗВИТИЯ БУЗИНЫ ЧЕРНОЙ
(SAMBUCUS NIGRA L.) В ПРЕДГОРНОЙ ЗОНЕ
КАБАРДИНО-БАЛКАРИИ
М. А. Тубаева
Кабардино-Балкарский госуниверситет им. Х. М. Бербекова,
г.о. Нальчик, КБР, [email protected]
Вступление растения в ту или иную фенофазу
обусловлено происходящими в нем внутренними процессами.
Растение предъявляет к внешней среде определенные
требования, различные в разные этапы- стадии его развития.
Таким образом, фенофазы, морфологически выражающиеся в
появлении на растении определенных органов- почек, листьев,
бутонов, цветков, плодов- тесно связаны не только с
изменениями, происходящими внутри растения, но и с
комплексом внешних условий. Поэтому необходимым условием
изучения ритмов сезонного развития растения является
привлечение климатических данных (температура воздуха,
количество осадков и др.).
Объектом нашего исследования является Sambucus nigra
(семейство Caprifoliaceae Juss) - кустарник или небольшое
дерево 4,7 - (10) м высотой, со стволом до 30 см толщиной,
покрытыми чечевичками. Листья супротивные, сложные,
длиной 20-30 см. Цветки обоеполые, мелкие, желтовато-белые,
собраны в в щитковидно-метельчатые соцветия до 20 см в
диаметре; плод-сочная блестящая, черная ягодообразная
костянка. Размножается семенами, порослью от пня, корневыми
отпрысками [2].
Ареал бузины черной охватывает югозападную и южную полосу европейской части России, Западную
Сибирь, Белоруссию, Украину. Растет в подлесках лиственных
лесов, реже смешанных и хвойных, на опушках. Предпочитает
влажные богатые почвы. Теневынослива, морозостойка.
Относится к почвоулучшающей породе. Растение представляет
большой интерес для промышленного и любительского
садоводства, декоративно, хороший медонос, цветки и плоды
используются в медицине, пищевой промышленности [2].
62
В Кабардино-Балкарии бузина черная в естественных
условиях встречается в основном на равнине и в предгорьях,
иногда- в среднегорном поясе. Декоративность бузины, легкость
в размножении и неприхотливость явились основанием для
введения ее в культуру и использования в практике зеленого
строительства в г. о. Нальчике. Несомненно, это декоративное,
ценное лекарственное и медоносное растение заслуживает более
широкого внедрения в культуру и в других населенных пунктах
республики.
Целью
наших
исследований
явилось
изучение
фенологических фаз S. nigra в условиях г. о. Нальчика. Знание
наступления той или иной фазы имеет значение для
определения оптимальных сроков вегетативного или семенного
размножения бузины черной, сбора лекарственного сырья
(цветков,
плодов).
Особую
значимость
приобретает
фенологические наблюдения в практике озеленения городов.
Важно знать какова чувствительность растений и возможности
их адаптации
при интродукции в новых климатических
условиях. О необходимости проведения фенологических
исследований в связи с интродукцией растений говорит С. В.
Кольцов [5]. Им рассмотрено влияние метеоусловий на
прохождение фенофаз на примере бузины черной в условиях
Белгородской области [5].
В Кабардино-Балкарии С. Х. Шхагапсоевым и Л. Х
Тхазаплижевой были также проведены фенологические
исследования по подснежникам [6]. Ими были рассмотрены в
сравнительном аспекте фенофазы трех видов Galanthus L. в
условиях г. о. Нальчика (2004 г.), с. Герменчика и с. Верхней
Жемталы [6].
Изучение фенологии бузины черной в КабардиноБалкарии проведено нами впервые. В основу исследования
положен описательный метод, разработанный В.А. Батмановым
в 1961 г. [1]. С этой целью в январе 2011 г. в Атажукинском
парке г. Нальчика (предгорная зона) была заложена площадка
размером 4 м2, на которой произрастал один куст бузины из 17
побегов, средняя высота которых 2,7 м. В дневнике отмечали
наступление и продолжительность той или иной фазы в течение
63
всего года. В 2012 гг. наблюдения повторили. Климатические
условия в годы проведения исследований анализировали по
данным Гидрометцентра г. Нальчика.
Результаты исследований представлены в таблицах 1 и 2.
Сравнение фенологических данных за 2011, 2012 гг. показало
существенную разницу в сроках и продолжительности
прохождении фенологических фаз. Из таблиц видно, что при
близких
градациях
температуры
воздуха,
неизменно
повышающейся от вегетативной фазы к плодоношению,
количество осадков в это же время меняется.
64
Таблица 1
Основные фенологические состояния и развития вида Sambucus nigra L. в предгорной зоне и
изменение температуры воздуха, количество осадков за вегетационный период (2011,2012 гг.)
Географический пункт: КБР, г.о. Нальчик, Атажукинский парк, у спуска («календарь»)
Вид, фенофаза
Дата
2011 г.
Характеристика фенофаз
Продолжительн
Средняя температура
ость, дн
воздуха, оС
Sambucus nigra L.
119
от -2,6 оС до +5,3 оС
20
+15,3 оС
70
+20,1 оС
Среднее кол-во
осадков, мм
Вегетативная
Бутонизация
Цветение
02.01-09.04
02.05-19.05
21.05-21.07
Плодоношение
29.07-11.11
111
от +13,4 оС до -0,3 оС
82
Период
относительного
покоя
27.12
48
0,7 оС
4
40
106
116
Продолжение таблицы 1
Вид, фенофаза
Дата
2012 г.
Вегетативная
17.02-17.04
Бутонизация
Цветение
Плодоношение
22.05-07.06
24.06-09.08
29.09-10.12
Период
относительного
покоя
19.12
Характеристика фенофаз
ПродолжительСредняя температура
ность, дн
воздуха, оС
Sambucus nigra L.
62
от -8,6 оС до +11,6
о
С
95
+19,9 оС
36
+21,1 оС
136
+13,3 оС до -0,5 оС
25
66
-0,5оС
Среднее кол-во
осадков, мм
30
71
110
45
44
Для более детальной фенологической характеристики
вида проанализировали связь сроков наступления фенофаз с
температурой воздуха и количеством осадков (табл. 1., 2., рис.
2., 3.).
Начало вегетации у S. nigra отмечается 2 января в 2011
г., а в 2012 г.-17 февраля. При этом температура воздуха в 2011
г. в период вегетации была на уровне +5,3оС, по сравнению с
2012 г. (+11,6оС ).Следующая фазабутонизация, также
проходила раньше на 20 дней в 2011 г.-2 мая по сравнению с
2012 г. Температурный режим в период бутонизации в 2012 г.
составил +19,9оС, в 2011 г. - +15,3оС, а количество осадков,
соответственно 71 мм и 106 мм. Фаза цветения отмечалось в
2011 г. 21 мая, в 2012 г.-24 июня. В этот период количество
осадков в 2011-2012 гг. составило 116 мм и 110 мм. Созревание
плодов в 2011 г. началось, соответственно раньше, чем в 2012 г.
Весь период плодоношения в 2011 г. длился 136 дней, а в 2012
г.- 111. Прослеживали также и период относительного покоя.
Температура воздуха в начале зимы в 2011 г- +0,7оС, количество
осадков- 4 мм, а в 2012 г.- -0,5оС , количество осадков больше на
40 мм. Отмечено продолжительность покоя в 2011 г. 48 дней, а в
2012 г.- 25. Фенодаты полного засыхания и отмирания
надземной части растений, знаменующих собой окончание
вегетации, были зафиксированы в 2011 г. 26-29 декабря, в 2012
г. 19-23 декабря.
На основании таблицы построили фенологический
спектр годичного цикла развития S. nigra в предгорной зоне
КБР (рис. 1), который наглядно показывает продолжительность
отдельных фаз, время вступления вида в ту или иную фазу и
характер их протекания. Сравнивая спектры развития одного и
того же вида за несколько лет, легко установить изменение в
ритме развития в разные годы.
нач. вег.
бут.
цвет.
плодон.
2012
окон. вег.
пер. пок.
2011
Рис. 1. Фенологический спектр годичного цикла развития S. nigra в
предгорной зоне КБР.
30
25
20
15
2011
10
2012
5
0
-5
7
8
9 10 11 12
Рис. 2. Среднемесячная температура воздуха
за период 2011-2012 гг.
Рис. 3. Среднемесячное количество осадков
за период 2011-2012 гг.
Таким образом, по данным С. В. Кольцова сезонный ритм
развития интродуцированных видов бузины определяется
биологическими особенностями видов и метеоусловиями
конкретного вида. Он отмечает связь сроков наступления
фенофаз развития растений с районами их естественного
произрастания и интродукции. Так, у видов, имеющих
обширные и далеко заходящие на север ареалы наступления и
протекания фенофаз, как правило, происходит в более ранние
сроки нежели у видов имеющих более южные ареалы.
70
Сравнение прохождения и длительности фенологических
фаз бузины черной в условиях естественного местообитания за
2011-2012 гг. показало, что в зависимости от года пластично
меняется начало вегетации, реагируя на изменение среды. При
этом следует заметить, что характер развития и особенности
протекания фенологических фаз бузины черной свидетельствует
о том, что условия предгорной зоны Кабардино-Балкарии
благоприятны для их интродукции.
Литература
1. Бейдеман И. Н. Методика изучения фенологии растений и
растительных сообществ. Новосибирск: Наука, Сибирское
отделение. 1974. 154 с.
2. Галушко А. И. Деревья и кустарники Сев. Кавказа. Нальчик:
Эльбрус. 1967.- 533 с.
3. Кольцов С. В. И др. Влияние метеорологических условий на
феноритмику бузины черной в условиях Белгородской
области//Проблемы региональной экологии. 2009.- №1. С. 8-11.
4. Шхагапсоев С. Х., Тхазаплижева Л. Х. Экология
подснежников Кабардино-Балкарии.- Нальчик: Издательство М.
и В. Котляровых, 2007.- С. 44-52.
71
Секция 4. Технические науки
ПИЩЕВАЯ И БИОЛОГИЧЕСКАЯ ЦЕННОСТЬ
ЗАЛИВНОГО ИЗ СЕРДЦА
ОДОМАШНЕННОГО СЕВЕРНОГО ОЛЕНЯ
Е. Г. Туршук, Е. А. Лобода
Мурманский Государственный Технический Университет, Мурманск,
Россия, [email protected]
Традиционно в России наибольшим спросом пользуется
мясная продукция из говядины и свинины. Однако рынок
мясных продуктов постепенно расширяется. На фоне большого
выбора
мясной
продукции
потребитель
стремится
разнообразить свое питание, пробуя новые продукты. Рост
объемов потребления связан, в первую очередь, с увеличением
потребления
продукции
из
нетрадиционного,
малоиспользуемого сырья, с разными добавками с
оригинальным и своеобразным вкусом. Таким сырьем являются
субпродукты одомашненного северного оленя. Как показали
наши исследования они обладают высокой пищевой ценностью
и поэтому являются прекрасным сырьем для производства
мясной продукции.
Разработана рецептура заливного, включающая сердце
одомашненного северного оленя, морковь, зелень петрушки,
костный бульон, желатин, соль при определенном соотношении
ингредиентов.
Основными критериями оценки качества пищевых
продуктов являются показатели их пищевой и энергетической
ценности.
Определение пищевой ценности (комплекса свойств
продукта, обеспечивающих физиологические потребности
человека в энергии и основных пищевых веществах – белках,
жирах, углеводах, витаминах, макро- и микроэлементах) и
энергетической ценности, являются обязательными при
разработке новых видов продукции.
72
Проведено исследование пищевой и энергетической
ценности разработанных паштетов из печени одомашненного
северного оленя и их сравнение с «Нормами физиологических
потребностей в энергии и пищевых веществах для различных
групп населения Российской федерации», данные приведены в
таблице 1.
Таблица 1 - Степень удовлетворения суточной потребности в
основных пищевых веществах
при употреблении 100 г
печеночного паштета, в день
Продукт
заливное из сердца
одомашненного
северного оленя
Массовая доля, %
Белок
Жир
Углеводы
20,5
3,7
1,6
Энергетическая ценность, ккал
121,7
Данные таблицы свидетельствуют о высокой пищевой
ценности заливного, в нем содержится довольно много
протеинов, что особенно важно на фоне дефицита пищевого
белка в мире.
Одним из основных показателей пищевой ценности
продуктов питания является биологическая ценность, т.е.
качественный состав белков. Для оценки сбалансированности
незаменимых аминокислот по отношению к эталонному белку
рассчитан аминокислотный скор, а также коэффициент
утилитарности. Результаты представлены в таблице 2.
73
Таблица 2 – Аминокислотный скор и коэффициент утилитарности
белков паштетов из печени одомашненного северного оленя
Незаменимая
аминокислота
(НАМК)
Валин
Изолейцин
Лейцин
Метионин +
цистин
Треонин
Лизин
Триптофан
Фенилаланин
+ тирозин
Лимитирующая
аминокислота
Эталон
Коэффициент
ФАО/ВОЗ, Аминокислотный утилитарности
г/100 г
скор, %
НАМК в
белка
белке
5,0
169
0,78
4,0
183
0,72
7,0
182
0,72
3,5
0,46
284
4,0
246
0,53
5,5
132
1
1,0
178
0,74
6,0
0,72
182
-
Как показывают данные таблицы 2, белки заливного из
сердца
одомашненного
северного
оленя
не
имеют
лимитирующей аминокислоты, наименьший коэффициент
утилитарности имеют метионин и цистин.
В качестве численных характеристик, достаточно полно
отражающих сбалансированность незаменимых аминокислот в
белке оцениваемого продукта, в настоящее время используют
коэффициент
утилитарности
аминокислотного
состава,
коэффициент
различия
аминокислотного
скора
и
биологическую ценность. Результаты расчета данных
показателей приведены в таблице 3.
74
Таблица 3 – Биологическая ценность и коэффициент
утилитарности аминокислотного состава белков заливного из
сердца одомашненного северного оленя
Продукция
Заливное
из сердца
Показатели биологической ценности
Коэффициент
БиологиКоэффициент
утилитарности
ческая
различия
аминокислотного
ценность,
аминокислотсостава белка,
%
ного скора, %
доли единицы,
(д.е.)
0,70
62,5
37,5
Коэффициент утилитарности аминокислотного состава
заливного отражает его высокую сбалансированность по
отношению к эталону. Биологическая ценность и коэффициент
различия аминокислотного скора, свидетельствует высокой
биологической ценности разработанной продукции.
Результаты исследований показывают, что разработанное
заливное из сердца одомашненного северного оленя обладает
высокой пищевой и биологической ценностью и способен
обогатить рацион потребителей новыми качественным мясным
продуктам.
75
Секция 5. Медицинские науки
СИСТЕМНАЯ ЭНЗИМОТЕРАПИЯ ПРИ ЯЗВЕННОНЕКРОТИЧЕСКИХ ПОРАЖЕНИЯХ СЛИЗИСТОЙ
ОБОЛОЧКИ ПОЛОСТИ РТА
Е. М. Казанкова, Н. Е. Большедворская,
В. Д. Молоков
ГБОУ ВПО ИГМУ, г. Иркутск, Россия [email protected]
Среди актуальных проблем стоматологии воспалительные
заболевания слизистой оболочки полости рта занимают одно из
ведущих мест.
До настоящего времени лечение язвенно-некротических
заболеваний
слизистой
оболочки
полости
рта,
сопровождающихся некротическими изменениями мягких
тканей, остается актуальной задачей стоматологии.
В связи с этим лечение заболеваний полости рта, в генезе
которых значительная роль принадлежит воспалению,
инициируемому патогенной микрофлорой становится важной
проблемой фармакотерапии в стоматологии.
В литературе имеются сведения о том, что многие
стоматологические заболевания и процедуры могут стать
причиной бактеремии. Наличие одонтогенных очагов инфекции
может иметь большое значение в развитии некоторых
заболеваний. Это обуславливает широкое использование наряду
с различными группами противовоспалительных средств в
комплексной терапии язвенно-некротических поражений
слизистой
оболочки
полости
рта
антисептиков
и
химиотерапевтических
препаратов
для
подавления
жизнедеятельности возбудителей и уменьшения степени
бактериальной интоксикации организма, а также средств,
усиливающих их действие [1, 4, 6, 8, 9]. Однако местное и
парентеральное введение протеиназ имеет ряд недостатков:
быстрое вымывание биологическими жидкостями введенного в
очаг фермента, боль, выраженные болевые ощущения в месте
введения; возможность образование инфильтратов. Таким
76
образом
перспективным
представляется
использование
перорально применяемых системных энзимов [2, 3, 6, 9].
Сочетание нескольких позитивных клинико-лабораторных
эффектов делают применение современных пероральных
энзимных препаратов патогенетически обоснованным методом
лечения в стоматологии [3, 5, 6, 9]. При ослаблении защитных
сил организма, снижении общего и местного иммунитета
уменьшается эффективность антибактериальной терапии и
наблюдается
интенсивный
рост
и
размножение
микроорганизмов. Клинические исследования убедительно
показывают необходимость стимуляции защитных сил
организма при лечении воспалительных процессов в челюстнолицевой области, что позволяет повысить эффективность
лечения и предотвратить возникновение рецидивов [2, 7, 10, 11].
Нами проведено лечение 48 больных в возрасте 18-60 лет
с эрозивно-язвенными поражениями слизистой оболочки
полости рта. Все пациенты были распределены на группы
соответственно способу лечения.
• основная группа – 24 пациента с эрозивно-язвенными
поражениями слизистой оболочки полости рта, которые
получали
стандартное
противовоспалительное
и
антибактериальное комплексное лечение с использованием
перорального
введения
антибиотиков
и
системной
ферментотерапии;
• группа клинического сравнения – 24 пациента с
эрозивно-язвенными поражениями слизистой оболочки полости
рта, которые получали стандартное противовоспалительное
и антибактериальное комплексное лечение с использованием
перорального введения антибиотиков;
Изучение стоматологического статуса проводили по
общепринятой методике. Наличие воспаления в десне
оценивали при помощи пробы Шиллера-Писарева, тяжесть
воспаления - по индексу гингивита (РМА) по Parma (1960),
состояние гигиены полости рта - по индексу Ю.А. Федорова В.В. Володкиной (1971). Оценку состояния тканей пародонта
проводили до лечения, на 3 сутки от начала лечения и после
окончания курса.
77
Всем больным, принятым на лечение было проведено
комплексное обследование, консультации других специалистов,
назначено общее лечение (витаминотерапия, усиленное питание,
применение неспецифических биостимуляторов). Местно под
аппликационной анестезией проводили тщательное удаление
над и поддесневых зубных отложений, санировали полость рта,
пришлифовывали острые края зубов. Во время и после удаления
зубных отложений слизистую оболочку полости рта обильно
орошали 3% раствором перекиси водорода. После этого на
пораженные участки слизистой оболочки накладывали десневые
противовоспалительные повязки. Обработку пораженных
участков слизистой оболочки полости рта проводили ежедневно
по 1-4 раза в день в зависимости от степени тяжести
заболевания. Кроме того назначались адекватные дозы
антибиотиков для перорального приема, а в основной группе
системная ферментотерапия в стандартной дозировке.
На следующий день после начала лечения самочувствие
больных улучшалось: значительно уменьшалась болезненность,
очищалась раневая поверхность от некротических масс,
уменьшались явления воспаления, а на 2-3 день в основной
группе начиналась активная эпителизация, которая завершалась
на 4-5сутки, а в более тяжелых случаях на 7-9 сутки, тогда как у
пациентов группы сравнения процесс регенерации поражений
удлинялся на 1-2 дня. Это, вероятно, связано со способностью
энзимов сокращать катаболическую и ускорять анаболическую
(репарационную) фазу воспаления за счет усиления оксигенации
и снижении гипоксии тканей и устранения ишемия.
При анализе результатов наблюдения в обеих группах
было установлено, что у пациентов основной группы
воспалительный процесс на 7-е сутки полностью купирован, а у
пациентов группы сравнения к этому сроку еще сохранялся: до
лечения – проба Шиллера – Писарева положительна у 100%
больных. После окончания лечения – в основной группе
отрицательна у 100%, в группе сравнения: отрицательна у
91,7%, слабоположительна у 8,3%.
78
Индекс РМА, который до лечения был равен 44,8% у
пациентов основной группы, после лечения составил 0 %, а в
группе сравнения после лечения составил 6,9%.
Индекс гигиены по Федорову-Володкиной до лечения в
обеих группах составлял от 3,8 до 4,2 , после лечения – 1,2 до
1,8.
Нормализацию этих показателей можно связать с
основными свойствами протеолитических энзимов, в частности,
их потенцирующим эффектом, который позволяет длительно
сохранять терапевтические дозы антибиотика в крови за счет
повышении концентрации последних в результате усиления
проницаемости тканей, облегчающее проникновение их к очагу
воспаления именно за счет сочетанного использования с
энзимами. Это, соответственно, приводит к скорейшему
устранению бактериемии, симптомов острой интоксикации и
местных болезненных ощущений. Необходимо также отметить
противоотечный, протеолитический и фибринолитический
эффекты системного введения протеиназ. Кроме того,
достоинством системной энзимотерапии является путь
введения, позволяющий сохранять высокую активность
компонентов длительное время, независимо от наличия кислой
среды в очаге поражения.
Но,
кроме
вышеописанных
механизмов,
при
инфекционном
воспалительном
процессе
используется
иммуномодулирующий эффект гидролаз, действующий на
клеточные и медиаторные компоненты воспалительной реакции.
Литература
1. Бушковская А.С., Дрегалкина А.А., Васильева Е.С.
Применение
флогэнзима
–
препарата
системной
энзимотерапии в комплексном лечении флегмон челюстно–
лицевой области // Урал. стоматол. журн. 2002. – № 2. – С.
37–39.
2. Горбачева И.А. Комплексные подходы к лечению больных с
сочетанными заболеваниями внутренних органов и
воспалительными поражениями пародонта. Автореф. дисс..
д.м.н. – СПб, 2004. – 34 с.
79
3. Дмитриева Л.А., Атрушкевич В.Г., Герасимова Е.В.,
Кнорринг Г.Ю. Опыт и перспективы применения системной
энзимотерапии в пародонтологии. Стоматология для всех. –
2010. – № 1. – С. 52-56.
4. Использование энзимных препаратов в хирургической
стоматологии и челюстно–лицевой хирургии: Методические
рекомендации. Сост.: Дрегалкина А.А., Васильева Е. С. –
Екатеринбург: УГМА, 2003 – 25 с.
5. Любенко О.Г., Москвичев В.Е., Родин Р.Ю., Кнорринг Г.Ю.
Системная энзимотерапия при острых состояниях в
стоматологии // Стоматолог. – 2007., №12. – С. 58–61.
6. Любенко О.Г., Стернин Ю.И., Кнорринг Г.Ю. Обоснование и
опыт применения системной энзимотерапии в стоматологии.
Стоматология для всех. – 2010. – № 1. – С. 22-24.
7. Минаев С.В., Ибрагимов О.Р., Зеленский В.А., Минаева Н.В.
Улучшение результатов лечения больных с гнойно–
воспалительными заболеваниями в челюстно–лицевой
хирургии. Военно–Медицинский журнал. – 2007. – № 11. – С.
52–58.
8. Притыко А.Г., Лопатин А.В., Гончаков Г.В. Применение
Флогэнзима и Вобэнзима в клинике детской черепно–
лицевой хирургии // Мат. науч.–практ. конф. «Новые аспекты
системной энзимотерапии». М., 2001. – С. 147–151.
9. Протеолитическая энзимотерапия в стоматологии Стернин
Ю.И., Кнорринг Г.Ю., Любенко О.Г., Мамедов С.С. Институт
стоматологии. 2010. Т. 1. № 46. С. 52-54.
10. Ремезов А.П., Кнорринг Г.Ю. Cистемная энзимотерапия как
способ потенцирования антибактериальных средств //
Антибиотики и химиотерапия. 2003. Т. 48. № 3. С. 30–33.
11. Хасанов Т.А., Чуйкин С.В., Баймухаметов А.Р. Системная
энзимотерапия
в
комплексном
лечении
гнойновоспалительных заболеваний челюстно-лицевой области у
детей. Креативная хирургия и онкология. – 2011. – № 4. – С.
101-104.
80
Секция 6. Сельскохозяйственные науки
СТРУКТУРА И ЗНАЧЕНИЕ ПОСЕВНЫХ ПЛОЩАДЕЙ
СЕЛЬСКОХОЗЯЙСТВЕННЫХ, ЗЕРНОВЫХ
И ЗЕРНОБОБОВЫХ КУЛЬТУР В РАЗВИТИИ
РАСТЕНИЕВОДЧЕСКОЙ ОТРАСЛИ РЕГИОНОВ
СЕВЕРНОГО КАВКАЗА
(СТАТИСТИКО-АНАЛИТИЧЕСКИЙ ПОДХОД)
И. Б. Хапаев
Карачаево-Черкесский филиал ФБГОУ ВПО «Российский
государственный социальный университет» в г. Черкесске,
Россия, [email protected]
Растениеводство является одной из основных отраслей
сельского хозяйства, которая, прежде всего, занимается
возделыванием культурных растений для производства
растениеводческой продукции. Именно данная отрасль
аграрного сектора занимает главенствующую роль в его
развитии, за счет которой непосредственно происходит
обеспечение населения страны качественным продовольствием.
От
его
развития
зависит
напрямую
и
развитие
животноводческой отрасли страны, т.к. эта сфера обеспечивает
его кормами.
Растениеводство
также
непосредственно
или
опосредованно влияет на динамику развития таких отраслей
экономики, как
пищевая промышленность, текстильная
промышленность, фармацевтическая промышленность и др.
Растениеводство состоит из следующих отраслей:
полеводство, овощеводство, луговодство, плодоводство,
виноградарство, лесоводство и цветоводство.
Для земледелия характерны присущие только ей
особенности. В отличие от других отраслей экономики здесь
существуют как экономические, так и естественные процессы
воспроизводства.
В данной отрасли земли растения выступают
одновременно и основным средством производства и объектом
81
труда, поскольку, как нам полагается, земля, вернее ее почва
обладает таким свойством как плодородие, от которого и
зависит
и показатели урожайности сельскохозяйственных
культур.
Паритетными задачами растениеводства являются:
разработка
и
совершенствование
технологии
возделывания сортов интенсивного типа;
- работы по исследованию устойчивости растений к
засухе, низким и высоким температурам, засолению почвы;
- разработка и внедрение интегрированных систем защиты
растений от болезней и вредителей; создание наиболее
эффективных форм удобрений;
- мелиорация земель;
- совершенствование методов программирования высоких
урожаев;
разработка
высокомеханизированных
способов
возделывания сельскохозяйственных культур и др.
В последние годы развитие растениеводства в регионах
СКФО, а именно в Республике Дагестан, Карачаево-Черкесии и
Ставрополье, характеризуется как положительной динамикой,
так и определенными негативами.
82
Таблица 1
Посевные площади всех сельскохозяйственных культур
регионов СКФО (в хозяйствах всех категорий, тыс. га) [1]
Регионы СКФО
Ставропольский
край
КарачаевоЧеркесская
Республика
Республика
Дагестан
Республика
Ингушетия
КабардиноБалкарская
Республика
Республика
Северная Осетия Алания
Чеченская
Республика
Всего
Годы
2008
2009
2010
2945,1
2972,9
2890,5
113,4
135,2
121,9
275,0
274,5
271,0
56,9
57,5
62,7
297,1
297,9
271,0
167,6
173,0
160,6
183,8
199,0
189,0
4038,9
4110,0
3986,8
По данным таблицы 1 видно, что в целом за
рассматриваемый
период
посевные
площади
всех
сельскохозяйственных культур регионов СКФО в целом
несколько снизились: на 52,1 тыс. га.
Но при этом следует отметить некоторое увеличение в
2009 годом по сравнению с 2008 годом на 71, 1 тыс. га, но по
сравнению с 2009 годом в 2010 году произошло сокращение
посевные площади всех сельскохозяйственных культур
регионов СКФО на 123,2 тыс. га.
При этом на Ставрополье посевные площади всех
сельскохозяйственных культур за три года также несколько
83
сократились. Так, по сравнению с 2008 годом в 2010 году
произошло их сокращение на 54,6 тыс. га, а в 2009 году,
наоборот,
посевные площади всех сельскохозяйственных
культур края увеличились 27,8 тыс. га.
С 2008 года по 2010 год также произошло сокращение
посевных площадей всех сельскохозяйственных культур
Республики Дагестан (на 4 тыс. га).
Здесь следует отметить, что в Карачаево-Черкесской
Республике с 2008 по 2010 год посевные площади всех
сельскохозяйственных культур увеличились на 8,5 тыс. га, но
при этом в 2010 году произошло их снижение на 13,3 тыс. га.
Основную долю имеющихся посевных площадей всех
сельскохозяйственных культур в регионе СКФО занимает
Ставропольский край, который занимает первое место, а
Дагестан – на третьем месте, немного уступая КабардиноБалкарии – на 22, 1 тыс. га. В то время, как, к нашему
сожалению, Карачаево-Черкесия находится по данному
показателю на скромном, предпоследнем 6 месте.
Но при этом, в целом по долям Дагестан и КабардиноБалкария имеют одинаковую величину, которая составляет по
7% соответственно.
Достаточно наглядно вышеизложенное показано на
рисунках 1 - 3.
84
Рис. 1. Доля посевных площадей всех сельскохозяйственных
культур регионов СКФО в 2008 г. (в хозяйствах всех категорий).
Как видно из диаграммы 2.1, в 2008 году подавляющая
часть посевных площадей всех сельскохозяйственных культур в
регионе СКФО находилась на территории Ставрополья – 73%,
наиболее отсталыми регионами по данному показатели явились
Карачаево-Черкесия и Ингушетия 1% и 3%, но при этом следует
заметить, что согласно данным рис. 2.1 в среднем разница доли
имеющихся посевных площадей всех сельскохозяйственных
культур всех субъектов Северного Кавказа достигает до 4%, за
исключением, естественно Ставропольского края – 73% (1 место
по имеющейся площади) и, конечно, Ингушетии – 1%
(последнее место).
85
Рис. 1. Доля посевных площадей всех сельскохозяйственных
культур регионов СКФО в 2009 г. (в хозяйствах всех категорий).
По данным рис. 2 достаточно четко выявляется, что в 2009
году по сравнению с 2008 году доля посевных площадей всех
сельскохозяйственных культур Ставропольского края и
Дагестана снизились на 1% и на 2% соответственно
При этом следует констатировать, что, несмотря на
незначительное сокращение посевных площадей всех
сельскохозяйственных культур Карачаево-Черкесии в целом
(всего на 500 га), ее доля в структуре регионов Северного
Кавказа осталась неизменной – 3%.
Следовательно, таким образом, судя по вышесказанному,
выявляется, что в 2009 году по сравнению с предыдущим годом
наблюдалось некоторое сокращение посевных площадей всех
сельскохозяйственных культур на территории Старополья,
Дагестана и Карачаево-Черкесии. Какова же доля этих регионов
в структуре регионов СКФО в целом за последующий, 2010 год?
86
Рис. 3. Доля посевных площадей всех сельскохозяйственных
культур регионов СКФО в 2010 г. (в хозяйствах всех категорий).
Судя по данным рис. 3 четко прослеживается следующая
ситуация: в 2010 году, как и в 2008 году доля посевных
площадей всех сельскохозяйственных культур регионов
Ставропольского края составила 73%, что же касается Дагестана
и Карачаево-Черкесии, то их показатели остались практически
неизменными: 7% и 3% соответственно.
Таким образом, в целом за три года, несмотря на
незначительные колебания в структуре посевных площадей всех
сельскохозяйственных культур Старополья, Дагестана и
Карачаево-Черкесии, значения этих показателей остались
практически
неизменными,
что
говорит,
как
нам
представляется, о достаточно устойчивой
положительной
динамике их состояния.
87
Таблица 2
Посевные площади зерновых и зернобобовых культур регионов
СКФО (в хозяйствах всех категорий, тыс. га) [2]
Регионы СКФО
Годы
2008
2009
2010
Ставропольский край
2254,8
2267,4
2139,3
Карачаево-Черкесская
Республика
Республика Дагестан
65,0
77,8
58,1
115,5
105,7
103,9
Республика Ингушетия
37,9
39,4
39,1
196,3
191,2
175,6
100,5
121,8
119,8
118,6
2888,6
126,6
2929,9
101,5
2737,3
Кабардино-Балкарская
Республика
Республика Северная
Осетия - Алания
Чеченская Республика
Всего
По данным таблицы 2 видно, что посевные площади
зерновых и зернобобовых культур одного Ставропольского края
в 2008 году превышают посевные площади всех вместе взятых
регионов Северного Кавказа: 2254,8 тыс. га, в то время идущей
на второй позиции Кабардино-Балкарии данный показатель
составляет всего
196,3 тыс. га, показатель Чеченской
Республики, которая находится на третьем месте, равен 115,5
тыс. га. Самыми отсталыми регионами по посевным площадям
зерновых и зернобобовых культур являются Ингушетия и
Карачаево-Черкесия – 37,9 тыс. га и 65,0 тыс. га соответственно.
Но здесь необходимо подчеркнуть, что основная территория
Ставропольского края находится в низменности, на равнине, а
другие регионы Северного Кавказа в горной и предгорной
местности, вследствие чего и имеется такая существенная
разница в посевных площадях регионов Северного Кавказа.
88
Такая динамика данного показателя, несомненно, сохранилась и
в последующие годы.
В целом за рассматриваемый период, судя по данным
таблицы 2, выявляется нежелательная тенденция, которая
заключается в сокращении посевных площадей зерновых и
зернобобовых культур на территориях большинства регионов
Северного Кавказа. Исключением явились два региона –
Республика Ингушетия и Республика Северная Осетия-Алания,
посевные площади зерновых и зернобобовых культур которых
увеличились на 1,2 тыс. га и 19,3 тыс. га.
В целом в регионах Северного Кавказа в 2010 году по
сравнению с 2008 годом посевные площади зерновых и
зернобобовых культур сократились на 151,3 тыс. га. Но в 2010
году наблюдалась иная картина: посевные площади зерновых и
зернобобовых культур регионов увеличились на 41, 3 тыс. га.
Более
наглядно
динамика
посевных
площадей
за
рассматриваемый период показана на рис. 2.7. Данное явление,
к нашему сожалению, явно нежелательное, поскольку именно
посевные площади зерновых и зернобобовых культур играют
немаловажную роль в развитии растениеводства, которое
находится в тесной взаимосвязи с другой, не менее важной
отраслью сельского хозяйства – животноводства.
Для более наглядной картины структуры посевных
площадей зерновых и зернобобовых культур регионов
Северного Кавказа за рассматриваемый период построим
диаграммы 4 - 6, данные которых достаточно четко отражают
сложившуюся ситуацию по данному показателю.
89
Рис. 4. Доля посевных площадей зерновых и зернобобовых
культур регионов СКФО в 2008 г. (в хозяйствах всех категорий).
Как видно по данным рис. 4, львиная доля посевных
площадей зерновых и зернобобовых культур в регионах
Северного Кавказа, как ранее было сказано, принадлежит
Ставропольскому краю – 78%. Идущая на второй позиции
Кабардино-Балкария – всего 7%. Явным аутсайдером по
данному показателю является Ингушетия – всего 1%.
Несмотря на то, что одним из основных факторов
вышеизложенного
является
естественное
явление:
географическое местоположение регионов, необходимо принять
определенные меры по увеличению посевных площадей
зерновых и зернобобовых культур наиболее отсталых республик
по данному показателю.
Рис. 5. Доля посевных площадей зерновых и зернобобовых
культур регионов СКФО в 2009 г. (в хозяйствах всех категорий).
Как свидетельствуют данные рис. 5, за рассматриваемый
период в структуре площадей зерновых и зернобобовых
культур регионов СКФО, как и за предыдущий год
подавляющая часть принадлежит Ставропольскому краю – 77%,
идущая на втором месте по данному показателю КабардиноБалкария в 11 раз уступает Ставрополью – 7%, здесь отрадным,
как представляется, является тот факт, что несколько
увеличилась доля этого показателя у Карачаево-Черкесии (на
1%). На первый взгляд, данное обстоятельство является
незначительным, но, если более углубленно посмотреть
специализацию данного региона в сельскохозяйственном
секторе и его географическое местоположение, то не трудно
понять,
что
вышеизложенное
бесспорно
является
положительным аспектом в увеличении производства зерновых
и зернобобовых культур в республике.
91
Рис. 6. Доля посевных площадей зерновых и зернобобовых
культур регионов СКФО в 2010 г. (в хозяйствах всех категорий).
Судя по данным рис. 2.6, за рассматриваемые три года в
структуре посевных площадей зерновых и зернобобовых
культур регионов Северного Кавказа практически коренных
изменений не происходило. Бесспорным лидером по данному
показателю является Ставрополье (78%), а показатели
большинства других регионов СКФО за данный период
колебались в пределах (+ -) 1%.
Вышеизложенное объясняется как объективными, так и
субъективными факторами. К объективным факторам, на наш
взгляд,
прежде всего, относятся природно-климатические
условия и географическое местоположение региона. Но при
этом, как было замечено ранее, имеется ряд существенных
негативных аспектов, влияющих на посевных площадей
зерновых и зернобобовых культур в Северо-Кавказском
федеральном округе: низкая техническая оснащенность,
раздробленность малых форм хозяйствования, слабая
инфраструктура села, отток населения, лоскутное земледелие и
92
т.д. К сожалению, такие негативные факторы присутствуют у
большинства как регионов СКФО, так и других регионов РФ.
Литература
1. Регионы России. Социально-экономические показатели. 2012:
Стат. Сб / Росстат. – М., 2012. - С. 535.
2. Там же. С. 537.
Секция 7. Исторические науки
НЕКОТОРЫЕ ПРОБЛЕМЫ ИСПОЛНЕНИЯ НАКАЗАНИЯ
В ОТНОШЕНИИ НЕСОВЕРШЕННОЛЕТНИХ
НА РУБЕЖЕ XIX - XX ВВ.
М. Н. Голыбина
Второй Тамбовский филиал Российской академии народного
хозяйства и государственной службы при Президенте РФ,
г. Тамбов, Россия, [email protected]
В конце XIX в. в России возникла необходимость
правового регулирования режима исполнения уголовного
наказания в отношении несовершеннолетних. Отметим, что в
России на протяжении длительного периода отсутствовали не
только специальные уголовно-правовые нормы, но и отдельные
исправительные
учреждения
для
содержания
несовершеннолетних правонарушителей, дети содержались
совместно со взрослыми. Одной из первых попыток обратить
внимание
на
бедственное
положение
подростковправонарушителей явилась разработка в 1838 г. Положения о
детских приютах, в котором предлагалась программа
организации приютов для несовершеннолетних [1].
Устав о наказаниях, налагаемых мировыми судьями,
впервые провозгласил, что малолетние преступники могут быть
в судебном порядке направлены в исправительные приюты [2].
93
5 декабря 1866 г. был принят Закон об исправительных
приютах. Условия, при которых малолетние преступники
направлялись в исправительные приюты, регламентировались
Уложением о наказаниях 1866 г. – отдаче в такие приюты
подлежали подростки в возрасте от 10–17 лет.
Приюты должны были находиться в ведении
Министерства внутренних дел, но учреждения именовались
«богоугодными и общеполезными», поэтому их учредителями
могли быть государственные, общественные организации и
общества, частные лица, земства, духовенство.
В конце XIX в. нормы об ответственности
несовершеннолетних и применении к ним уголовного наказания
содержались не только в Уложении о наказаниях уголовных и
исправительных, но и в Уставе о наказаниях, налагаемых
мировыми судьями, в Уставе о ссыльных, Уставе о паспортах и
беглых.
Закон «Об изменении постановлений, касающихся
обращения в исправительные приюты и содержания в них
малолетних преступников» был принят 20 мая 1892 г. и внес
изменения в ст. 137, 138 Уложения о наказаниях уголовных и
исправительных. В соответствии с этим законом срок
содержания несовершеннолетних в заведении определялся не
судом, а самим исправительным заведением и зависел от
степени исправления. Законом определялись лишь границы
срока, воспитанников можно было содержать не менее года и не
более 18-летнего возраста. Изменения в законодательстве
показывают попытку поиска решения проблем в данной сфере
[3, с. 87].
К этому периоду число исправительно-воспитательных
заведений в России достигло 48, из которых 1 Руковишниковский Московский приют принадлежал городу, 2 –
Тамбовский приют и Тверская колония – земству, 4 – Вятская,
Нижегородская, Владимирская и Смоленская колонии –
находились в частичной зависимости от земств и, наконец,
остальные 41 – существовали в зависимости от частной
благотворительности [3, с. 99].
94
К началу XIX в. в России существовали два типа
заведений для несовершеннолетних: ремесленные приюты и
земледельческие колонии. На практике они представляли собой
ремесленно-земледельческие колонии или ремесленные колонии
со школами садоводства, огородничества и пчеловодства.
В соответствии с Уголовным Уложением 1903 г.
названные учреждения для несовершеннолетних стали
называться воспитательно-исправительными.
В эти заведения помещались несовершеннолетние от 10
до 17 лет:
1. Признанные виновными в совершении, какого либо
преступного деяния по определениям и приговорам суда.
2. Обвиняемые и подсудимые, относительно которых
оказывалось необходимым принять меру пресечения способов
уклонения от следствия и суда взятие их под стражу по
постановлениям следственной или судебной власти.
3. Нищенствующие, бродяжествующие и бесприютные.
4. Отдаваемые для исправления родителями. Закон
предоставлял право уставам отдельных заведений определять
предельный возраст подлежащих приему несовершенно-летних
и устанавливал продолжительность пребывания их в
учреждениях в зависимости от категории помещаемого и его
возраста [4, с. 54].
Цель данных учреждений, согласно законодательным
нормам была воспитательно-исправительная. Но на практике
некоторые заведения оставались подобием небольших тюрем, с
огромным количеством проблем, таких как материальное
состояние, не решен вопрос о порядке исполнения наказания в
отношении несовершеннолетних, дисциплина и т.д.
В
частности,
рассмотрим
некоторые
проблемы
деятельности
Тамбовского
земского
ремесленновоспитательного приюта. Данные предоставлены в результате
ревизии ремесленно-воспитательного приюта Тамбовской
губернской тюремной инспекцией.
Приют представлял собой две каменные постройки,
двухэтажного здания и надворные деревянные постройки для
лиц местной администрации приюта. Двор содержался
95
удовлетворительно, имелся сад, для огороднических работ, две
голубятни. Нижний этаж занимали мастерские, кухня, кладовая,
цейхгауз, столовая и квартира учителя.
Личный состав включал двух надзирателей, двух
мастеров, садовник, сторож, кучер, учитель, законоучитель,
директор. На их содержание в месяц уходило 400 рублей. Все
лица кроме законоучителя имели казенные квартиры. В
тюремной инспекции нет данных о лицах служащих в приюте в
качестве учителя и надзирателей. Главным образом на средства
земства содержался приют, оно избрало Правление приюта,
которое выполняло контрольную функцию. Контроль со
стороны Тюремной инспекции не устраивал директора приюта
[5, с. 23].
Список воспитанников включал: старшая группа – 7
человек, средняя – 11, младшая – 6 человек и того 24 человека.
Два, из которых в момент ревизии находились в бегах. Было
установлено, что за последние 4 месяца побеги составляли 40 %,
причем с причинением материального вреда приюту. Данные
сведения директор приюта скрывал.
Во избежание общероссийского скандала в приют
направлена тюремная стража [5, с. 112].
Четкого распорядка и расписания занятий нет, в районе 11
часов проходили занятия, работа в мастерских (столярной,
плотничной, корзиночной). Вид малолетних преступников
неудовлетворительный, нет четкой дисциплины, процветала
безграмотность (из 19 человек, 11 - пишут неграмотно, 8 –
показали слабые знания арифметики, про остальных нет
данных). Осмотр кухни показал наличие некачественных
продуктов (суп постный, сырой хлеб) [5, с. 43].
Ревизия приходно-расходных книг и оправдательных
документов велась небрежно. Директор не в состоянии
составить годовой отчет расходов на приют. Директор выдавал
периодически деньги воспитанникам приюта за благоповедение,
бывшим воспитанникам пособие в день ангела. Инспектор по
результатам проверки сделал запрос в правление о разрешении
директору Касаткину Ивану Васильевичу производить данные
96
расхода (так как возникли подозрения на растрату казенных
средств) [5, с. 134].
Таким образом, ревизия показала неудовлетворительное
состояние приюта, что повлекло всестороннее расследование.
Интересен следующий факт, в 1912 г. состоялось
совещание в помещении Тамбовского губернского правления
под председательством начальника главного тюремного
управления Хрулева С.С. по поводу урегулирования порядка в
Тамбовском приюте. Правление приюта отправило в адрес
министра юстиции жалобу на незаконные
действия ревизии.
Председатель
выразил
сочувствие
таким
приютам,
преследующим исправительные цели, и подчеркнул важность
участия земств и городов. Главное тюремное управление
делегирует полномочия земству. Из этого следует, что
оснований для увольнения директора приюта нет. Причем
данные сведения были опубликованы в газете «Русское слово»
[5, с. 158].
Данная проблема актуальна не только для Тамбовской
губернии, но и для империи в целом. Хотя история развития
исправительных заведений для несовершеннолетних в
Российской империи свидетельствует о том, что в ходе
осуществления
реформ
уголовного
законодательства
определился новый подход к организации работы с
несовершеннолетними правонарушителями. Однако проблема
заключается в том, что тюремное реформирование в России в
большей степени носило теоретический характер разработки
законов, нежели чем их практическое применение.
Литература
1. Буксгевден
О.О.
Исправительно-воспитательные
приюты. СПб, 1903. IX.
2. Устав о наказаниях, налагаемых мировыми судьями //
Судебные уставы. 1864 г. 20 ноября. Ст. 6. СПб, 1866.
3. Позднышев С.В. Введение к «Курсу практического
тюрьмоведения» // Тюремный вестник. Приложение.
1912. № 12.
97
4. Таганцев Н.С. Исследования об ответственности
малолетних преступников по русскому праву. СПб,
1871.
5. Государственный архив Тамбовской области (ГАТО).
Ф.716 – Тюремное отделение Тамбовского губернского
правления. Оп. 3. Д. 8.
РЕКА КАРУН В ЭПИЦЕНТРЕ БОРЬБЫ РОССИИ
И АНГЛИИ ЗА ВЛИЯНИЕ В ПЕРСИИ (ИРАНЕ)
ВО ВТОРОЙ ПОЛОВИНЕ XIX В.
А. В. Макутчев
Тульский государственный педагогический университет
им. Л.Н. Толстого, г. Тула, Россия, [email protected]
Персия начала торговать с европейцами уже в начале
XVIII в. и к середине XIX в. стала притягательным рынком
сырья и сбыта для европейских коммерсантов. Наибольшую
долю в торговом балансе Персии имели Англия и Россия,
державшие в Тегеране постоянные дипломатические миссии со
времен Наполеона. Обе великих державы стремились добиться
собственной экономической и политической гегемонии в
стране, одновременно ослабив конкурента. Чтобы прочно
закрепиться на персидских рынках, Англии и России
требовалось создать надежные и эффективные торговые пути и
обеспечить возможность свободно пользоваться ими.
Крупные города Персии отдалены от Каспийского моря
или Персидского залива, что затрудняло перевозку товаров.
Русским купцам на пути из Энзели в Тегеран приходилось
пересекать хребет Эльбурс. Англичане же на юге страны при
перевозке грузов к портам Персидского залива были вынуждены
взбираться на Центральное плато и преодолевать хребет Загрос.
К тому же в Персии не было шоссейных дорог и
железнодорожных путей, а караваны нередко подвергались
нападениям разбойников. В таких условиях серьезные
облегчения в торговле могло принести освоение речных путей,
98
способных соединить морские порты с центральными районами
страны. Первыми это осознали англичане, поскольку в зоне их
экономической экспансии на юго-западе Персии для навигации
была доступна река Карун. На севере же, где были активны
русские торговцы, судоходных рек нет, поэтому задачей
русской дипломатии стало противодействие британским
попыткам открыть Карун для своего речного транспорта.
Толчок борьбе за Карун дала деятельность британской
коммерческой фирмы «Грей, Пол и компания», образованной в
Бушире. В 1871 г. она решила организовать пароходное
сообщение на Каруне между Мохаммерехом (ныне Хорремшехр) и Шустером. Выгода была налицо: на доставку
товаров из Исфахана в Бушир по суше требовалось 30-35 дней, а
по реке на это уходило бы 10 дней. Компания обратилась к
британскому посланнику в Тегеране Чарльзу Элисону с
просьбой о содействии в получении концессии. Правительство
Индии, когда узнало об этом письме, также проявило свой
интерес и просило Элисона сообщить ему результаты
переговоров с персидским правительством. Однако шах Насер
эд-Дин отказался обсуждать этот вопрос, что объяснялось
общим обострением англо-персидских отношений в 60-е гг. XIX
в. В 1857 г. Персия потерпела унизительное поражение в
Гератской войне с Англией, что подтолкнуло шаха к ряду
внутренних реформ, реализованных под руководством визиря
Амир
Кебира.
Правительство
предприняло
попытку
восстановить свою власть в пограничных районах, в частности
на юго-западе страны, где местные правители, пользуясь
поддержкой Англии, считали себя независимыми. Шах
потребовал возвращения под персидское управление порта
Бендер-Аббас, который был занят имамом Маската, и
архипелага Бахрейн. Однако англичане, заинтересованные в
закреплении на берегах Персидского залива, под угрозой новой
войны заставили шаха отказаться от своих намерений.
Новую попытку открыть Карун для своих пароходов
британцы предприняли в конце 1875 г. К тому времени Россия
завоевала Хиву, соединила черноморский порт Поти с
Тифлисом железной дорогой, которая должна была скоро
99
достигнуть Каспия в Баку, и установила регулярное пароходное
сообщение между устьем Волги и персидскими портами.
Русские товары появились на базарах в Исфахане и даже южнее.
Это серьезно обеспокоило британских коммерсантов. «Грей,
Пол и компания» и «Грей, Доуз и компания» вновь потребовали
у английского правительства принять меры для открытия Каруна, а правительство Индии объявило о своей готовности
субсидировать навигацию на реке.
Обстановка благоприятствовала британцам. Шах вызвал
враждебность России, предоставив в 1873 г. железнодорожную
концессию Юлиусу Рейтеру, и раздражение англичан
вследствие ее отмены. В такой ситуации Персия не хотела
ссориться с англичанами, но и с интересами России вынуждена
была считаться. Пытаясь найти «золотую середину» и не
обидеть ни Англию, ни Россию, шах назначил совет из двадцати
одного министра, принцев и высших чиновников для изучения
проблемы Каруна. После месячного обдумывания совет, приняв
во внимание настойчивость англичан, одобрил идею свободной
навигации. Однако, чтобы не вызвать протесты России, министр
иностранных дел мирза Саид-хан поставил англичанам условие:
за судоходство они должны были платить сборы на
строительство портовых сооружений, доков и маяков, как это
было принято в Европе [1].
Англичан такие условия не устраивали: уплата
персидскому правительству сборов повышала стоимость товара.
Они посчитали, что выдвинутые персами условия были
направлены исключительно на затягивание времени. Более того,
правительство Индии во главе с лордом Литтоном было
убеждено, что за отказом Персии позволить свободную навигацию стояла Россия. Поводом для таких подозрений стала
статья в «Санкт-Петербургских ведомостях» от 18(30) марта
1876 г., которая с удовлетворением отмечала факт отказа шаха
от
британских
условий
открытия
Каруна.
Однако
документальных свидетельств давления России на Персию в
вопросе о Каруне нет, а удовлетворение по поводу неудач
дипломатии Англии можно объяснить общим осложнением
русско-британских отношений после Крымской войны.
100
В 1877 г. Россия вступила в войну с Турцией, что было
воспринято британцами как подходящий момент для
укрепления своих позиций в Персии. Энергичный вице-король
Индии лорд Литтон был возмущен неторопливостью
британского посла в Персии Рональда Т. Томсона в ведении
переговоров о Каруне и пожаловался на него в Лондон. Получив
приказ министра иностранных дел лорда Дерби, Томсон вручил
персидскому министру иностранных дел мирзе Хосейн-хану
Мошир од-Дойлы ноту, в которой повторил доводы в пользу
открытия Каруна для судоходства. Однако персидское
правительство продолжало уклоняться от обсуждения темы,
поскольку опасалось принимать решения без учета позиции
России.
В июле 1878 г. Россия, оказавшаяся усилиями Англии в
международной изоляции, вынуждена была подписать
Берлинский трактат, что ослабило позиции русской дипломатии
в Персии. В этих условиях британцы усилили нажим на Насер
эд-Дин-шаха. 21 сентябри 1878 г. Томсон вручил шаху новый
меморандум с просьбой открыть Карун для судоходства, однако
вновь не добился успеха. Назойливость британского посла
оскорбила шаха, и в ответном послании он написал: «В течение
пятидесяти лет вы, англичане, осуществляли торговлю с
Персией, но никогда не было ни слова о реке Карун. Что
произошло, в чем причина, что вдруг стал нужен Карун? Реки,
подобные этой, являются как бы дверью в доме: ждите нашего
решения» [3]. Переговоры продолжались в течение многих
месяцев безуспешно, пока сами персы не оказались вынуждены
их ускорить.
В начале 1881 г. у Персии возник пограничный спор с
Турцией по поводу территорий, населенных курдами. Дело шло
к войне, денег на которую в казне не было. Шах назначил
министром иностранных дел мирзу Саид-хана, который решил
просить Россию или Англию надавить на турок. 1 марта 1881 г.
в Петербурге был убит император Александр II, и позиция его
преемника Александра III по этому вопросу пока была неясна.
Британцы же после Берлинского конгресса усилились, к тому же
Саид-хан заранее знал, что предложить англичанам, а что в
101
качестве благодарности потребовала бы Россия, персам было
неясно. В середине марта 1881 г. Саид-хан официально
попросил поддержки в споре с Турцией у Англии, пообещав,
что Персия допустит свободную навигацию на реке Карун [2].
Он также предложил шаху передать проблему Каруна в руки
Зел ос-Солтана, старшего сына шаха. Зел ос-Солтан, хоть и был
вычеркнут
из
престолонаследия
из-за
незнатного
происхождения его матери, имел очень серьезное влияние на
шаха, чем собирались воспользоваться британцы.
6 января 1882 г. британский резидент в Персидском заливе Э.К. Росс телеграфировал вице-королю Индии лорду
Литтону, что получил послание от Зел ос-Солтана о том, что
шах передал ему полномочия решить проблему реки Карун.
Взамен Зел ос-Солтан ожидал от британцев награждения
орденом «Звезда Индии». После недолгих раздумий лорд
Литтон согласился с условиями Зел ос-Солтана. Однако шах
вновь оказался непреклонен. Он поблагодарил британцев за
помощь в урегулировании спора с Турцией, но дать взамен
свободную навигацию по Каруну не торопился, и ни Томсон, ни
Зел ос-Солтан не смогли заставить его изменить решение.
Англичане по традиции объяснили неудачу в переговорах
деятельностью русских дипломатов. Утверждали, что шах
отказывается от окончательного открытия Каруна под
давлением русского посланника А.А. Мельникова, который
требовал от шаха в случае удовлетворения требований
британцев исполнить и русские пожелания относительно
судоходства у иранского побережья Каспия.
Проблема открытия Каруна получила продолжение в 1887
г., когда в Тегеран прибыл новый английский посланник Генри
Драммонд
Вольф,
предложивший
новую
политику
противостояния России. Вольф верил в первичность экономики,
правительство и дипломатия, по его мнению, были только
средствами достижения экономических интересов [2]. Вольф
предложил русскому посланнику князю Долгорукову отказаться
от соперничества и избрать новый подход к персидской
проблеме, который, на его взгляд, создал бы преимущества для
обоих государств. Суть его предложений сводилась к
102
разделению Персии на сферы влияния, в которых обе державы
не были бы ничем ограничены. Тем самым Вольф в скрытой
форме предлагал России померяться силами в экономическом
противостоянии и отказаться от политического. Долгоруков
суть послания уяснил, поэтому поблагодарил Вольфа за
предложение, но ответа не дал: тягаться в экономической мощи
с Англией было бы опрометчиво.
Для решения проблемы Каруна Вольф нашел
влиятельного сторонника в лице нового фаворита шаха – визиря
мирзы Али Асгар-хана Амин ос-Солтане. Однако наибольшее
воздействие на шаха оказал не он, а напористая и
прямолинейная политика князя Долгорукова, который своей
склонностью к запугиванию персидских чиновников толкал их к
сотрудничеству с Англией. Шах и визирь начали искать
британской поддержки против увеличивающегося русского
давления по вопросам предоставления русским коммерсантам
концессий на строительство железных дорог в Персии.
Окончательно симпатии шаха в сторону Англии склонили
события 1888 г. Весной 1888 г. на северо-востоке Персии
вспыхнул бунт туркменских племен под руководством Хаджи
Назар-хана. На его подавление правительство бросило войско в
тринадцать тысяч человек, однако военачальники неумело вели
военную кампанию и украли жалованье солдат. В итоге бунт
был подавлен только с помощью предательства. Россия никак не
вмешивалась в эти события, однако персидское правительство
посчитало, что бунт был инициирован Россией для оказания
давления на шаха. Распространению
этого
мнения
способствовали и британцы, настойчиво указывая персам на то,
что туркмены были вооружены русскими винтовками.
Ради получения британской поддержки Насер эд-Дин-шах
теперь был согласен открыть Карун и предоставить другие
концессии. Детали, которые на предшествующих переговорах
становились
непреодолимыми
препятствиями,
были
проигнорированы. Амин ос-Солтане попросил у британцев
только письменный документ как гарантию поддержки в случае
русского вторжения, о вероятности которого постоянно
напоминали сами англичане. 24 октября 1888 г. Вольф с одобре103
ния своего правительства предоставил Амин ос-Солтане
письменное заявление о том, что в случае нападения любой
страны на Персию правительство Ее Величества обязуется
предпринять действия для предотвращения нарушения
территориальной целостности Персии.
30 октября 1888 г. шах издал указ (ферман) об открытии
Каруна для коммерческих пароходов. Формально судоходство
по Каруну было открыто для всех иностранных судов, но
воспользоваться им фактически могла только Англия – других
торговцев на юге Персии практически не было. Преамбула
документа давала официальное обоснование принятия указа: «В
целях расширения торговли, заселения края, а также развития
хлебопашества в Хузестане» [4]. Шах открывал свободную
навигацию по Каруну на 170 км вглубь страны - от
Мохаммереха до плотины Ахваз. Оговаривались и персидские
условия: уплата иностранцами небольших пошлин в
Мохаммерехе, запрет судам подниматься выше плотины и
стоять дольше, чем понадобится для погрузки и выгрузки
товаров.
Петербург, который получил новости об открытии Каруна
прежде, чем указ был издан, был одновременно возмущен и
разочарован. На полях телеграммы от русского поверенного в
делах в Тегеране А. Поджио Александр III написал: «К
сожалению, мы хорошо знаем, как шах предался англичанам и
ничего не делает без их совета» [2]. Долгоруков, оказавшийся в
это время в Петербурге, также был сильно уязвлен.
Как только было получено разрешение на судоходство и
Каруну, английское правительство приступило к освоению реки.
13 февраля 1889 г. на заседании Лондонской торговой палаты
бывший английский резидент в Иране генерал М. Смит сделал
доклад «О перспективах развития британской торговли в
Персии в результате открытия судоходства по р. Карун».
Английская торговая компания «Линч» получила от
правительства крупную субсидию на рейсы по Каруну с
условием совершать их регулярно, даже если не будет грузов.
Судоходство по Каруну открыло англичанам доступ к
центральным районам Персии. Мохаммерех стал местом склада
104
британских товаров, отправляемых в Исфахан и на восток
Персии. В 1889-1890 гг. вдоль Каруна была создана английская
телеграфная служба, а в 1889 г. англичане получили концессию
на постройку шоссейной дороги вдоль Каруна от Тегерана до
Шустера. Эта концессия изначально принадлежала бывшему
министру иностранных дел Хосейн-хану Мошир од-Дойлы,
который уступил ее английскому коммерсанту Линчу.
Строительство
этой
дороги
также
способствовало
распространению британского влияния на кочевые племена
бахтиаров и луров, населяющие земли, прилегающие к Каруну.
С помощью взяток и установления ежегодных платежей вождям
этих племен англичане добились того, кто бахтиарские ханы
вошли в соглашение с компанией «Линч» и обязалась
сопровождать английские караваны.
Итогом многолетнего противостояния России и Англии по
поводу открытия для свободной навигации реки Карун,
важнейшего речного пути в глубинные районы страны, стала
дипломатическая победа Англии, хотя Россия восприняла ее
так, как и следовало - как небольшую дипломатическую
неудачу, обусловленную негибкой политикой русских
посланников в Тегеране. Серьезной борьбы за Карун не
получилось, поскольку Россия не была реально заинтересована
в Каруне: доля русской торговли на юге и в окрестностях реки
была очень мала. Россию больше интересовали вопросы
навигации вдоль каспийских берегов Персии, которые были
успешно решены. Однако при этом помешать укреплению
британцев на юге Персии Россия не смогла. Англичане же всеми
доступными средствами в итоге добились желаемого результата,
значительно расширив свое присутствие в регионе, к концу XIX
в. поставившее под сомнение государственный суверенитет
Персии.
Литература
1. Бондаревский Г.Л. Политика Англии на Ближнем и
Среднем Востоке. - М., 1966.
105
2. Казем-заде Ф. Борьба за влияние в Персии:
дипломатическое противостояние России и Англии. - М.:
Центрполиграф, 2004.
3. Кулагина Л.М. Экспансия иностранного империализма в
Иран и превращение его в полуколонию (70-е гг. XIX в.
– начало XX в.) // Очерки новой истории Ирана (XIX-XX
вв.). М.: Наука, 1978.
4. Хрестоматия по новой истории Ирана. / Под ред. М.С.
Иванова и В.Н. Зайцева. - М., 1988.
Секция 8. Экономические науки
ОСОБЫЕ ЭКОНОМИЧЕСКИЕ ЗОНЫ РОССИИ:
ИССЛЕДОВАНИЕ ОСНОВНЫХ ПРИЧИН
УСПЕХА И НЕУДАЧ
А. В. Гаврилов, Д. В. Шушарин
Национальный исследовательский университет Высшая школа
экономики, Санкт-Петербург, [email protected]
Особые экономические зоны (ОЭЗ) существуют во многих
странах мира и их появления обусловлено различными
факторами. Прежде всего стоит отметить, что под особой
экономической зоной понимается некоторая территория,
которая обладает особым юридическим статусом и заданными
льготными условиями экономического характера как для
региональных и национальных, так и для иностранных
предпринимателей. В процессе исследования было выяснено,
что основной причиной появления таких зон является
необходимость развития тех или иных территорий в
общеэкономическом или социальном плане. Так как создание
ОЭЗ подразумевает социально-экономический компонент,
основной целью их создания являются:
106
- развитие экспортной базы и импортозамещение;
- общее развитие инфраструктуры и устранение
административных барьеров;
- привлечение инвестиций в регион;
- создание рабочих мест, использование дешевой или
квалифицированной рабочей силы;
- минимизация затрат для инвесторов за счет экономии на
отсутствии налогов и пошлин.
В настоящее время разделяют три типа экономических зон
с точки зрения функциональности:
- рекреационная зона, подразумевающая создание,
развитие объектов туризма и отдыха, оказание связанных с
туризмом услуг;
- промышленно-производственная зона, в которой
налажено
производство
промышленной
продукции
(предоставляются налоговые и таможенные льготы);
- технико-внедренческая зона (проведение научноисследовательских работ);
- зона свободной торговли (таможенные льготы).
В рамках исследования был произведен анализ трех
особых экономических зон: «Алабуга», «Ульяновск» и
«Калининградская область». Стоит отметить, что все ОЭЗ
относятся к промышленно-производственной зоне, но ОЭЗ
«Калининградская область» имеет особый статус. ОЭЗ
«Калининградская область» действует в соответствии с
Федеральным законом «Об особых экономических зонах в
Российской Федерации» №116-ФЗ от 22 июля 2005 года,
Федеральным законом «Об особой экономической зоне в
Калининграде» №13-ФЗ от 22.01.1996 года, Гражданским
кодексом Российской Федерации, Федеральной целевой
программы развития особой экономической зоны в
Калининградской области на 1998-2005 года. Деятельность ОЭЗ
«Алабуга» и «Ульяновск» регулируются типовым Федеральным
законом «Об особых экономических зонах в Российской
Федерации» №116-ФЗ от 22 июля 2005 года и Постановлениями
Правительства Российской Федерации, которые также являются
типовыми для рассматриваемых зон. Стоит отметить, что ОЭЗ
107
«Калининградская область» существует уже с 1996 года, и вся
территория рассматриваемого региона подпадает под
федеральные законы и Постановления Правительства РФ об
особых экономических зонах. Отсюда следует вывод о том, что
законодательная база для ОЭЗ разрабатывалась в разное время,
поэтому различия в развитии и регулировании данных
территорий также разнообразно.
Перейдем к непосредственному изучению каждой из зон.
Главной целью создания ОЭЗ было достижения благоприятных
условий для реализации российских и иностранных
инвестиционных проектов в области производства. Данный
регион
обладает
достаточно
большим
количеством
потенциальных квалифицированных работников, которые
способны работать в отраслях тяжелой и легкой
промышленности. Дальнейший анализ выявил, что главная цель
достигнута, а ОЭЗ «Елабуга» признана одной из самых
экономически эффективных не только в России, на и на
мировом уровне [1]. Принятие решения о создании особой
экономической зоны именно в Елабуге было осуществлено
после рассмотрения 73 заявок из 41 региона России. Решение
считается обоснованным, производителям действительно
интересен данные регион по следующим соображениям:
- в регионе существует большое количество компаний,
осуществляющих деятельность в той же отрасли (возможность
взаимного сотрудничества на более выгодных условиях);
регион
с
социально-экономической
стороны
демонстрирует стабильный рост;
- наличие квалифицированных кадров;
- относительная близость к Центральной России.
Для большинства населенных пунктов Российской
Федерации присвоение статуса особой экономической зоны
связано с негативными факторами и процессами: закрытием
крупных предприятий, дотационность региона, общий
социально-экономический спад. Случай ОЭЗ «Алабуга»
уникален, так как Елабужский район достаточно развит в
промышленном плане, особенно нефтедобывающая и
строительная отрасли. Также здесь осуществляют деятельность
108
предприятия легкой промышленности, энергетики. Компании в
ОЭЗ «Алабуга» преимущественно направлены на развитие
производства в области автомобилестроения, но присутствуют и
предприятия нефтедобывающей, химической промышленности,
мебельные фабрики, строительные компании. В связи с этим
предполагается, что ОЭЗ была создана с целью экономии на
издержках в логистике, что позволяет удерживаться на плаву
уже существующие компании, а также новые в ОЭЗ «Алабуга»
ОЭЗ «Алабуга»: существует в течении 7 лет, практически
вся ее территория арендуется резидентами. Это говорит о том,
что местоположение экономической зоны (транспортная
доступность) в сочетании с предоставляемыми преференциями
делают данную территорию привлекательной для инвесторов и
бизнесменов. Относительная близость к населенному пункту
предполагает активное вовлечение местного населения в
деятельность фирм, работающих на территории ОЭЗ «Алабуга».
В
списке
компаний-арендаторов
имеются
известные
автомобильные концерны, крупные отечественные заводы и
фабрики по производству пищевых продуктов, строительных
материалов и прочее. Предполагается, что данная ОЭЗ серьезно
повлияла на экономику города Елабуга и близлежащих
населенных пунктов.
Следующая изучаемая ОЭЗ «Ульяновск» располагается
рядом с аэропортом «Ульяновск-Восточный», который в свою
очередь находится на расстоянии 20 км. от города. Аэропорт
«Ульяновск-Восточный»
преимущественно
занимается
пассажирскими авиаперевозками. Само расположение зоны
идеально ввиду следующих соображений:
- выгодное положение в Центральной части России;
- непосредственная близость к Ульяновску;
- близость к аэропорту;
- развитая авиационная отрасль;
- наличие развитой транспортной сети;
- развитая промышленность в регионе.
В ОЭЗ по состоянию на 2013 год только 4 резидента,
которые занимаются техническим обслуживанием и ремонтом
самолетов. Непосредственная близость с аэропортом является
109
несомненным плюсом, так как это позволяет тестировать
самолеты на их пригодность, снизить расходы в логистике. Тем
не
менее,
иностранные
и
российские
компании,
специализирующиеся а области авиастроения и эксплуатации не
охотно реагируют на выгодные условия работы в ОЭЗ. Все
резиденты экономической зоны представлены только
российскими компаниями, которые, скорее всего, решили
переместить свои производственные мощности с целью
экономии финансовых средств на бюджетных выплатах. В связи
с
этим
стоит
предположить,
что
цель
создания
авиастроительного и портового центра не достигнута.
В целом стоит отметить, что в России нет достаточно
крупных авиастроительных кластеров, есть отдельные
авиагородки, небольшие кластеры, и они присутствуют в
большинстве крупных городов РФ. Низкая популярность ОЭЗ
можно объяснить спецификой авиастроительной отрасли.
Иностранные компании не заинтересованы развивать
собственные проекты в России, так как фактическим
монополистом здесь является «Аэрофлот» и российские
компании, как перевозчики, так и производители. Мелкие
компании-производители самолетов не имеют мощных
производств, а средние производители не считают нужным
воспользоваться экономической выгодой от государственных
льгот. В целом, территориальное положение экономической
зоны во всех отношениях можно назвать относительно
успешным, но единственным минусом является то, что
большинство рейсов отправляется в крупные города страны и
Зарубежья. Экономическая зона «Ульяновск» ориентирована на
развитие
портовой
и
воздушной
логистической
инфраструктуры, тем не менее, рецензенты в больше степени
специализируются на авиа индустрии. По сравнению с ОЭЗ
«Алабуга», данная зона развивается медленными темпами.
Скорее всего, это связано со спецификой зоны (воздушнопортовая), которая представлена только 5 компаниями.
Предполагается, что появление данной экономической зоны
слабо повлияло на экономику агломерации города Ульяновска.
110
Последней рассматривалась ОЭЗ «Калининградская
область». В целом стоит отметить, что ОЭЗ является не
отдельный участок, а вся Калининградская область. Суть
экономической зоны заключается в том, что предприятия могут
ввозить следующие товары без таможенных пошлин (кроме
подакцизных), и производить товары на территории области со
сниженным налоговым бременем (налог на прибыль – 0%
первые 7 лет). Область имеет право сама устанавливать
ограничения на таможенный режим, защищая местных
производителей товаров. По факту на сегодняшний день
Калининградскую область называют «европейской оффшорной
зоной» [2]. По закону, ввезенные и произведенные товары
должны быть использованы и потреблены на территории
области. Пользоваться таким положением может любое ИП и
организация, деятельность которой отвечает всем формальным
критериям. Также стоит отметить, что таможенные льготы
распространяются и в том случае, если организация
осуществляет экспорт с территории Калининградской области.
В Интернете были найдены объявления о продаже
компаний на территории Калининградской области, в которых
особое внимание акцентируется на их льготном положении. Это
говорит о том, что Калининградская область действительно
используется как зона, на которой можно ввезти товар, не
оплачивая таможенные пошлины и налоги, а затем
беспрепятственно ввезти его на территорию других российских
регионов. Первичная цель создания ОЭЗ не достигнута –
Калининградская область является промежуточной зоной для
очистки товара от таможенных пошлин и налоговых сборов. По
итогам изучения трех экономических зон был сделан вывод о
том, что все они развиваются абсолютно по-разному, и
привлекательно ОЭЗ зависит не только от тех льгот, которые
предоставляет государство, но и от территориального
размещения зоны, социально-экономических характеристик
региона.
111
Литература
1. Информация об особой экономической зоне «Алабуга»
[Электронный ресурс] // Интернет-сайт об ОЭЗ «Алабуга». –
URL: www.alabuga.ru (Дата обращения: 17.05.2013)
2. Калининградская область как европейский оффшор
[Электронный ресурс] // Центр правовой поддержки
«Моральный кодекс». – URL: www.alabuga.ru (Дата обращения:
17.05.2013)
ЭФФЕКТИВНОСТЬ ИСПОЛЬЗОВАНИЯ И
ОБОРАЧИВАЕМОСТЬ ОБОРОТНОГО КАПИТАЛА,
ПУТИ ИХ ПОВЫШЕНИЯ
М. И. Лукьяненко, А. В. Воронков
«Белгородский государственный национальный исследовательский
университет», г. Белгород, Россия, [email protected]
В систeме мер, направлeнных на повышeние
эффективности работы прeдприятия и укрепление его
финансoвого состояния, важное мeсто занимают вопросы
рационального использования оборотных средств. Проблема
улучшeния использoвания оборотных средств стала еще бoлее
актуальной в условиях фoрмирования рынoчных отнoшений.
Интерeсы прeдприятия трeбуют пoлной ответствeнности за
рeзультаты свoей производствeнно-хозяйствeнной деятeльности.
Поскoльку финансoвое полoжение прeдприятий нахoдится
в прямoй зависимoсти от состoяния обoротных срeдств и
предпoлагает соизмeрение затрат с рeзультатами хозяйствeнной
деятeльности и возмeщение затрат сoбственными срeдствами,
прeдприятия заинтeресованы в рациoнальной oрганизации
обoротных срeдств - oрганизации их движeния с минимальнo
возможнoй суммoй для получeния наибoльшего эконoмического
эффeкта.
На эффeктивность испoльзования обoрoтных срeдств
прeдприятий дeйствуют мнoжество фактoров, нерeдко в
противoположных направлeниях. По ширoте влияния и степeни
112
управляeмости фактoры услoвно мoжно объeдинить в три
группы: общеэкoномические, организациoнные и связанныe с
тeхническим прoгрессом.
К общеэкoномическим фактoрам отнoсятся: изменeние
величины товарoоборота и его структуры; размещeние
производитeльных
сил;
динамикa
произвoдительности
обществeнного трудa, занятoго в сфeре товарнoго обращeния и в
oтраслях, ее обслуживaющих; развитиe хозяйствeнного расчeта.
В группу эконoмико-организациoнных фактoров вхoдят:
изменeние размeров торгoвых прeдприятий и их спeциализации:
внeдрение нoвых спосoбов торгoвли и др. Факторы, связaнные с
тeхническим прогрeссом, - это: измeнение тeхнологии и
примeняемой тeхники в отрaслях, обслуживaющих торгoвлю
(транспорт, связь, коммунальное хозяйствo); автoматизация
торгoвых процесoов.
На эффeктивность испoльзования обoротных срeдств и
ускорeние их оборачиваeмости влияют фактoры, как
пoвышающие их вeличину, так и снижaющие.
К фактoрам, повышaющим вeличину обoротных срeдств,
отнoсятся: повышeние качeства торгoвого обслуживaния,
расширeние сeти магазинoв в райoнах новoстроек, изменeние
структуры товарoоборота в сторoну увeличения удeльного вeса
тoваров, имeющих замeдленную обoрачиваемость, и др.
Снижeнию обoротных срeдств спосoбствуют: экoномия
матeриальных и финaнсовых ресурсoв; ширoкое внeдрение
принципoв хозяйствeнного расчeта в деятeльность торгoвых
прeдприятий (объединений).
Фактoры, опрeделяющие вeличину обoротных срeдств,
могут быть oбъективными, т.е. не зaвисящими от дeятельности
дaнного прeдприятия, и субъeктивными. К числу субъeктивных
мoжно отнeсти, напримeр, рациoнальность испoльзования
обoротных средств, выпoлнение плана товарoоборота,
примeняемые фoрмы обслуживaния, соблюдeние крeдитной и
финансoвой дисциплины.
Обoрачиваемость обoротных срeдств – это их движeние в
процeссе воспрoизводства, последоватeльный их пeреход из
однoй фoрмы в другую. Характeризуется врeменем, в тeчение
113
котoрого срeдства, авансирoванные в оборoтные фoнды, и
срeдства обрaщения совершают пoлный обoрот, или скoростью,
котoрая выражаeтся числом пoлных обoротов за устанoвленное
время (год, квартал, месяц).
Под обoрачиваемостью оборoтных срeдств понимаeтся
длитeльность однoго полнoго кругообoрота срeдств с момeнта
прeвращения обoротных срeдств в денeжной фoрме в
производствeнные зaпасы и до выходa готoвой прoдукции и ее
реaлизации. Кругoоборот средств завершаeтся зачислениeм
выручки на счет прeдприятия.
Оборачиваeмость обoротных срeдств нeодинакова на
прeдприятиях как однoй, так и рaзличных отрaслей экоoномики,
что зaвисит от оргaнизации производствa и сбытa прoдукции,
размещeния оборoтных срeдств и других фактoров. Так, в
тяжeлом машинoстроении с длитeльным произвoдственным
циклoм врeмя оборoта средств наибольшeе, быстрeе
оборачивaaются обoротные срeдства в пищeвой и дoбывающих
oтраслях прoмышленности.
Систeма
обoбщающих
и
чaстных
показатeлей
оборaчиваемости обoротных срeдств основывaется на двух
взaимосвязанных финанcовых кoэффициентах: кoэффициенте
оборaчиваемости
и
длитeльности
однoго
обoрота,
характeризующих эффeктивность использoвания оборoтного
капитaла, а в чaстности оборaчиваемость и длитeльность
оборoта
матeриально-прoизводственных
запaсов,
оборaчиваемость и срoк погaшения дебиторскoй задoлженности
и т.д.
По свoему сoдержанию покaзатели обoрачиваемости
являются прямыми пoказателями эффeктивности рeсурсного
типа, т.е. хaрактеризующими отнoшение эффeкта к зaтратам. В
качeстве эффeкта примeняется исхoдный финaнсовый
покaзатель – выручкa от прoдаж. Количествeнно зaтраты
вырaжаются черeз показaтели авансирoванных ресурсoв, что
дaет основaние отнoсить покaзатели оборaчиваемости к
ресурснoму типу. Другими слoвами, оборaчиваемость
харaктеризуется сопoставлением покaзателей объeма прoдукции
и вeличины авaнсированных оборoтных срeдств.
114
На длительность нахождения средств в обороте влияют
факторы внешнего и внутреннего характера.
К внешним факторам относятся: сфера деятельности
организации;
отраслевая
принадлежность;
масштабы
организации; экономическая ситуация в стране и связанные с
ней условия хозяйствования.
Внутренние факторы – ценовая политика организации,
структура активов, методика оценки запасов.
Резервы и пути ускорения оборачиваемости оборотных
средств в обобщенном виде зависят от двух факторов: объема
производства, сбыта и размера оборотных средств. Чтобы
ускорить оборачиваемость, необходимо:
- совершенствовать производство и сбыт, нормализовать
размещение оборотных средств;
- полностью и ритмично выполнять планы хозяйственной
деятельности;
- совершенствовать организацию производства и сбыта,
внедрять прогрессивные формы и методы;
- совершенствовать расчеты с поставщиками и
покупателями;
- улучшать претензионную работу;
- ускорять оборот денежных средств за счет улучшения
инкассации выручки, строгого лимитирования остатков
денежных средств в кассах предприятия, в пути, на расчетном
счете в банке;
- свести к минимуму запасы хозяйственных материалов,
малоценных и быстроизнашивающихся предметов, инвентаря,
спецодежды на складе, сократить подотчетные суммы, расходы
будущих периодов;
- не допускать роста дебиторской задолженности.
Эффективность использования оборотных средств
предприятий, следовательно, зависит прежде всего от умения
управлять ими, улучшать организацию производства и сбыта,
повышать уровень коммерческой и финансовой работы.
Особое
внимание
уделяется
изучению
причин
выявленных отклонений по отдельным видам оборотных
активов и разработке мер по их оптимизации. Рост товарных
115
запасов может быть результатом недостатков в организации
торговли, рекламе, изучении спроса покупателей, другой
маркетинговой деятельности, наличия невостребованных и
неходовых производств.
Большие остатки денежных средств в кассе и в пути
возникают в связи с неритмичным развитием сбыта,
несвоевременной сдачей выручки в банк, неиспользуемых
денежных средств и другими нарушениями кассовой
дисциплины. Сверхнормативные остатки прочих товарноматериальных ценностей являются результатом наличия или
приобретения излишних и ненужных материалов, сырья,
топлива, малоценных и быстроизнашивающихся предметов,
других материальных ценностей. Снизить запасы товаров,
материалов, сырья, топлива до оптимальных размеров можно
путем их оптовой реализации или бартерных сделок,
равномерного и частого завоза. Нормализации остатков товаров
и денежных средств в кассе и в пути способствует ритмичное
развитие товарооборота.
На счетах в банке должны храниться минимально
необходимые суммы денежных средств, а все свободные их
остатки следует перечислять в досрочное погашение
полученных кредитов, вкладывать в ценные бумаги,
предоставлять кредит юридическим и физическим лицам. При
перерасходе средств фондов специального назначения и
резервов основное внимание уделяется разработке мер по его
погашению и предупреждению.
Основная цель анализа – своевременное выявление и
устранение недостатков управления оборотным капиталом и
нахождение
резервов
повышения
интенсивности
и
эффективности его использования. А также: выявление
факторов, влияющих на показатели оборачиваемости и
длительности одного периода, количественное измерение их
влияния; определение влияния оборачиваемости оборотных
средств на финансовое состояние предприятия
Финансовое положение предприятия, его ликвидность и
платёжеспособность непосредственно зависят от того,
насколько быстро средства, вложенные в активы, превращаются
116
в реальные деньги. Такое влияние объясняется тем, что со
скоростью оборота средств связаны:
- минимально необходимая величина авансированного
(задействованного) капитала и связанные с ним выплаты
денежных средств (проценты за пользованием кредитами
банков, дивиденды по акциям и др.);
- потребность в дополнительных источниках финансирования и
плата за них;
- сумма затрат, связанных с владением товарно–материальными
ценностями и их хранением;
- величина уплачиваемых налогов и др.
Текущее расходование денежных средств и их поступления, как
правило не совпадают во времени, в результате у предприятия
возникает потребность в большем или меньшем объёме
финансирования в целях поддержания платёжеспособности. Чем
ниже скорость оборота оборотных активов, тем больше
потребность в финансировании.
Внешнее финансирование является дорогостоящим и имеет
определённые
ограничительные
условия.
Собственные
источники увеличения капитала ограничены в первую очередь
способностью получения необходимой прибыли. Таким
образом, управляя оборотным капиталом, предприятие получает
возможность в меньшей степени зависеть от внешних
источников получения денежных средств и повысить свою
ликвидность. Поэтому, управление оборотными активами
рассматривается как один из способов удовлетворения
потребности в капитале.
В целях управления оборотными активами используются
показатели их оборачиваемости и факторный анализ
показателей оборачиваемости, хотя они и являются скорее
подтверждающими конкретное мнение, чем основополагающим
доводом для принятия управленческого решения.
Анализ оборотного капитала позволяет оценить
эффективность использования ресурсов в оперативной
деятельности предприятия, определить ликвидность баланса
предприятия, то есть возможность своевременно погасить
краткосрочные обязательства, выяснить во что вкладываются
117
собственные оборотные средства предприятия в течение
финансового цикла. Величина и структура оборотного капитала
должна соответствовать потребностям предприятия, которые
отражены в бюджете, при этом текущие активы должны быть
минимальны, но достаточны для успешной работы предприятия.
Таким образом, оборотные средства включают как
материальные, так и денежные ресурсы, от их организации и
эффективности использования зависит не только процесс
материального производства, но и финансовая устойчивость
предприятия.
Секция 9. Филологические науки
ОСОБЕННОСТИ КОМПОНЕНТА «ДЬЯВОЛ»
ВО ФРАЗЕОЛОГИЧЕСКИХ ЕДИНИЦАХ
АНГЛИЙСКОГО И РУССКОГО ЯЗЫКОВ
А. Г. Нуруллина
Казанский (Приволжский) федеральный университет,
г. Набережные Челны, Россия, [email protected]
Культура каждого этноса или народа реализуется в
языковых
стереотипах
непосредственно
с
помощью
фразеологических единиц (ФЕ). Образ «дьявола» является
представителем зла, врагом Бога и человека. Вслед за З.Е.
Александровой мы включаем в синонимический ряд ФЕ с
компонентом «дьявол»: сатана, демон, черт, бес, лукавый, злой
дух, нечистый дух, нечистая сила, чертяка, анчутка,
Мефистофель, враг рода человеческого, князь тьмы, дух тьмы,
падший ангел, отец лжи, враг, черная сила, нечистый, окаянный,
черный, нечисть [1,с.116].
В «Большом энциклопедическом словаре» под редакцией
Е.М. Мелетинского «чёрт – антропоморфные существа,
покрытые черной шерстью, с рогами, хвостами и копытами. В
118
русской средневековой живописи облик черта отличается от
человеческого остроголовостью, иногда – крыльями за спиной»
[3,с.611]. В ходе исследования выявлена группа ФЕ
описывающий внешний вид и облик: The devil wipes his tail with
the poor man’s pride в значении «дьявол вытирает свой хвост о
гордость бедных людей»; чумазый как черт; богатый, как черт
рогатый.
Группа ФЕ, характеризующая силу персонажа: силен бес
и горами качает, а людьми, что вениками трясет.
Появление дьявола часто вызвано разрушением
спокойствия, хаоса, ссоры, шума: raise the devil – (букв.
шуметь/буянить/поднимать скандал); пришел черт на череду (о
беспричинной ругани, ссоре).
Анализируя, ФЕ с данным компонентом выявляется
антропоцентрическая направленность. ФЕ, описывающее
человеческие поступки, действия: дьявол веревку подсунул (о
повесившемся человеке); черт дернул (о чьем-л. необдуманном
поступке, опрометчивом поступке); лезть к черту в зубы
(совершать опасные поступки). ФЕ, обозначающее характер,
особые качества и черты человека: poor devil –
бедняга/горемыка/неудачник; queer devil – чудак; бес луканьский
(о хитром, нечестном человеке); веревочный черт (об
обманщике, сумасброде). ФЕ, описывающее внешность
человека: handsome devil – красавчик; черт кудрявый (о
лохматом, кудрявом человеке); черт малоглазый (о человеке с
маленькими глазами). ФЕ, выражающее психологическое и
эмоциональное состояние человека: бесы с глаз накатятся;
черти верхи поехали (о возбужденном состоянии человека);
черт сухопутный (о человеке, вызывающем отрицательные
эмоции).
Шаловливые, проказливые дети
также являются
предметом искушения дьявола. Так, А.Е. Махов указывает на то,
что «дети – излюбленный предмет обманных манипуляций
демонов» [2,с.150]. ФЕ, характеризующая детей: little devil –
чертенок, сущий дьявол, отчаянный парень; dare-devil –
бесшабашный человек, сорвиголова, смельчак; черт на шкуру не
берет (об озорном, шаловливом ребенке).
119
Выявлена группа ФЕ, включающая бранные слова:
встречный бес тебя зашиби! (восклицание, выражающий
досаду, раздражение, негодование); дьявол тебя (его, вас)
побери! (выражение досады, негодования, желания избавиться
от кого-л.).
ФЕ, выражающее проклятье, дурное пожелание: бес
помяни (недоброе пожелание кому-л.); пущай бесы опашут;
двори тебя черт за что!(недоброе пожелание в чей-л. адрес).
ФЕ, выражающее досаду, негодование, раздражение: бес
рогатый; встрешный бес тебя расшиби! Бесы бы задрали; к
бесу; за каким дьяволом! на кой дьявол! что за дьявол
(выражение недоумения, растерянности).
ФЕ характеризующее потерю, утрату вещей, предметов:
бес хвостом накрыл; бесы украли; бесы унесли; луканька,
поиграй, да назад отдай!
ФЕ,
обозначающее
время,
несвоевременность,
неуместность, период: бес носит (кто-л. не вовремя, некстати
ходит); a deuce of a time ago «сам дьявол прошлого»; еще черт в
кулачки не играл/ еще черт в ладоши не хлопал (очень рано
утром, перед рассветом).
Группа ФЕ, характеризующая азартные игры: Колода
карт – молитвослов дьявола; Карты – это книги дьявола.
Группа, характеризующая политическую деятельность:
Политик – это наковальня дьявола; Политик подражает
дьяволу.
Группа, характеризующая благие дела: Дьявол иногда
говорит правду; Дьявол может совершать достойные
поступки.
Таким образом, компонент «дьявол» в английском и
русском языках во многом аналогичен, и объединяющим
признаком является то, что дьявол – искуситель, враг всего того,
что создал Бог, и в первую очередь человека. В ходе анализа
раскрыта внешний облик данного компонента, его сила.
Выявлена антропологическая направленность ФЕ изучаемого
компонента. Основными признаками в английской и русской
лингвокультуре являются использование бранных слов и
выражений; проклятий, дурных пожеланий; выражение досады,
120
раздражения; характеристика азартных игр и политическую
деятельность.
Литература
1. Александрова З.Е. Словарь синонимов русского языка:
Практический справочник:Ок. 11000 синоним.рядов. –
11 –е изд., перераб и доп. – М.: Рус.яз., 2001.
2. Махов А.В. Категории и образы средневековой
христианской демонологии. Опыт словаря. – Москва:
Intrada, 2006.
3. Мелетинский Е.М. Поэтика мифа. - М., Вост.лит. РАН,
2000.
ПРЕЦЕДЕНТНЫЕ ФЕНОМЕНЫ
В СЛОГАНАХ БАНКОВСКОЙ РЕКЛАМЫ
А. И. Орлова
Тюменский государственный университет, г. Тюмень, Россия
[email protected]
Реклама занимает важное место в жизни современного
человека и является неотъемлемой частью средств массовых
коммуникаций. Представляя собой социокультурное явление,
реклама воссоздает и в то же время формирует культурные и
потребительские предпочтения человека. Интерес для
лингвистов представляет то, что в рекламных текстах
функционирует современный, живой язык, при этом реклама не
только отражает, но и оказывает огромное влияние на языковую
культуру и языковые предпочтения потребителей, а также на
формирование
новых
образов
и
моделей
речевой
коммуникации.
Банковская реклама представляет собой особый тип
экономической рекламы. Она имеет ряд особенностей. Вопервых, набор услуг, предоставляемых любым банком,
практически одинаков. Во-вторых, реклама услуг значительно
отличается от рекламы товара в силу своего нематериального
121
состояния. Е. Песоцкий отмечает «мифический характер»
рекламы услуг, говоря о том, что «услуга – нематериальный
товар. Она неосязаема. Её невозможно увидеть, услышать,
понюхать или попробовать на вкус до потребления» [3; с. 87].
Поэтому для того чтобы привлечь клиента, банки активно
используют в своей рекламе уже имеющиеся в сознании
потребителя тексты.
Понятие
«прецедентный
феномен»
вводится
в
лингвистику в 90-е годы XX в. Вслед за В.В. Красных под
прецедентным
феноменом
мы
понимаем
«феномены
(лингвистические и экстралингвистические), хорошо известные
членам того или иного социума (от семьи до национальнокультурного сообщества), входящие в комплективное
когнитивное пространство коммуникантов» [2; с. 63].
Исследователи (В.В. Красных, Д.Б. Гудков) различают
следующие прецедентные феномены: прецедентный текст,
прецедентное
высказывание,
прецедентную ситуацию,
прецедентное имя.
Анализ слоганов банковской рекламы показал активное
использование прецедентных феноменов. В рекламных текстах
обнаруживают себя прецедентные высказывания. Прецедентное
высказывание – «репродуцируемый продукт речемыслительной
деятельности; законченная и самодостаточная единица, которая
может быть или не быть предикативной; сложный знак, сумма
значений компонентов которой не равна его смыслу» [1; с. 106].
В качестве рабочей вслед мы принимаем классификацию
по характеру употребления прецедентов Д.Б. Гудкова, который
выделяет «канонические» и трансформированные прецедентные
высказывания: 1) «канонические», выступающие в виде
строгой цитаты; 2) трансформированные: прецедентное
высказывание
подвергается
трансформации,
цитата
узнается, но происходит ее изменение [1; с. 34].
Д.Б. Гудков отмечает, что употребление прецедентных
высказываний в трансформированном виде опознаются
носителями языка. Преобразование этих элементов может
быть четырех типов: замещение, усечение, контаминация,
добавление [1; с. 116].
122
В слоганах банковской рекламы присутствуют как
«канонические», так и трансформированные прецедентные
высказывания. «Канонические» высказывания встречаются
редко (Доверяю как себе – банк Русский Стандарт; Время –
деньги – Банк Югра), чаще обнаруживают себя
трансформированные.
Среди трансформированных высказываний широко
используется:
1. Добавление (расширение состава): Деньги на всякий
случай? – Сбербанк; Взгляни на покупки другими глазами! –
Альфа-банк; Удачный момент – низкий процент! – Сбербанк;
Больше чем кредит! – Запсибкомбанк.
В результате добавления расширяется значение
высказывания, оно приобретает новый смысл, который
способствует пониманию высказывания в целом.
2. Замещение: Кредит с первого взгляда – банк Русский
Стандарт; Пришел, увидел и купил! – Запсибкомбанк;
Улыбнитесь! Вам скидка! – Запсибкомбанк.
При замещении прямое значение прецедента обычно
играет важную роль, причем основное значение воплощает
замещающее слово. Данный тип трансформации повышает
выразительность, а также способствует возникновению
дополнительных значений прецедента.
Использование добавления и замещения в слоганах
банковской
рекламы
можно
объяснить
тем,
что
употребление в слогане исходного прецедента привлекает
внимание, создавая уже имеющиеся в сознании потребителя
образы, которые отличаются простотой ассоциаций и
быстротой угадывания, при этом добавочный или
замещающий компонент чаще всего несет основную
смысловую нагрузку.
Менее частотными, но также встречающимися в
слоганах являются:
3. Контаминация: Удовольствие от жизни – проще
простого! – ОТП Банк; Покорять новые просторы с ВТБ24
– проще, чем вы думали! – банк ВТБ24.
123
Соединяя два прецедентных высказывания в одно,
контаминация «участвует в организации нового смысла,
опираясь на фоновые знания читателя, и этим лукаво
«заманивает» его в процесс сотворчества» [4; с. 76-77].
4. Усечение: Автомобиль не роскошь – Сбербанк; На
всё про всё. Зайдите и узнайте больше – УРАЛСИБ.
«Усечение фразы позволяет читателю создать,
подключая фоновые знания, текст, более насыщенный
смыслами и коннотациями, чем тот, что создал автор» [4; с.
76].
Помимо
основных
типов
трансформированных
прецедентных высказываний, выделенных Д.Б. Гудковым, в
чистом виде, встречается использование в одном слогане сразу
нескольких типов одновременно, например: Не откладывай
жизнь на завтра – банк Русский стандарт – в данном случае мы
обнаруживаем усечение (не откладывай на завтра то, что можно
сделать сегодня), а также дополнение – путем включения
компонента «жизнь». Точно такое же явление в слогане
Сбербанка: Простой способ не откладывать жизнь на завтра –
разница лишь в том, что в этом случае два добавочных
компонента: «простой способ» и «жизнь».
Использование прецедентов в рекламных слоганах,
безусловно, способствует привлечению внимания клиентов, но
это привлечение не всегда является успешным, в связи с
возникающими негативными ассоциациями, вызываемыми
прецедентом. Например, не совсем удачным является слоган
Банка Москвы: Банк Вам в помощь – в данном случае идет
отсылка к выражению «Бог вам в помощь», такое сравнение
может оскорбить религиозные взгляды потребителей. Также
негативную окраску приобретает слоган Совкомбанка: Мы
сошли с ума! – вряд ли клиента привлечет банк, который сходит
с ума.
Но в большинстве случаев прецедентные феномены
положительно влияют на реализацию основных задач
рекламного слогана – привлечение внимания и побуждение к
совершению покупки.
124
Исследуя функционирование прецедентных феноменов в
слоганах банковской рекламы, было выявлено, что
встречающиеся прецеденты можно разделить на определенные
тематические группы. Опираясь на известную систему
приоритета потребностей человека А. Маслоу, была составлена
тематическая классификация.
Первой тематической группой являются прецедентные
феномены, относящиеся к физиологическим потребностям
человека. Чаще всего это высказывания, связанные с
продуктами питания, потреблением, приготовлений пищи,
акцентируются внимания на вкусе: Кредит быстрого
приготовления! – банк Ренессанс Кредит; Бизнес-ланч с
Запсибкомбанком: в меню 5 пакетов услуг! – Запсибкомбанк;
Лакомый кусок за малый срок – Запсибкомбанк.
Прецеденты, имеющие отношение к безопасности,
стабильности, защите: Будьте уверены в завтрашнем дне! –
Сбербанк; От безопасности к уверенности – банк ВТБ24; Банк
на все времена! – ОТП Банк; Банк, который всегда под рукой!
– банк Ренессанс Кредит.
Прецедентные высказывания, связанные с социальными
потребностями человека, его чувства, межличностные
отношения (любовь, дружба, семья и т.д.): Близкий во всех
отношениях – Банк Хоум кредит; Кредит с первого взгляда –
банк Русский Стандарт; Я жду тебя всегда! С каждым
клиентом мы находим общий язык – Альфа-банк; Вклады в
крепкие отношения – Русский Стандарт.
Группа уважение-признание (внимание уделяется статусу,
преимуществу человека): Вы в центре внимания – банк ВТБ24;
Сибиряк сибиряка поймет наверняка! – Сибирский банк;
Позволь себе больше – Сбербанк; Наши – на особом положении!
– Альфа-банк; Счет в вашу пользу – Агропромкредит.
Данная классификация показала, что банки, стараясь
привлечь клиентов, апеллирует к основным потребностям
человека, что связано с особенностями рекламируемого
продукта, его нематериальным характером. В данной
классификации большая часть уделяется потребностям человека
в уважении-признании, затем социальным потребностям и
125
потребностям в безопасности, и в меньшей степени
физиологическим. Такое распределение, на наш взгляд, связано
с тем, что банки имеют отношение к более развитой части
нашей жизни, к экономической ее стороне, где акцентируется
внимание на личностных характеристиках, а точнее на
способностях зарабатывать деньги, что, в свою очередь,
напрямую связано с преимуществом и статусом человека в
обществе.
Таким образом, мы видим, что банки активно использует
прецедентные феномены в своих рекламных слоганах.
Прецедентные феномены способствуют привлечению внимания
клиентов, обращаясь уже к имеющимся в сознании потребителя
образам, они повышают узнаваемость слоганов. Кроме того,
такая демонстрация общности образов, а также культурного
опыта создает некий контакт банка с клиентом.
Литература
1. Гудков Д. Б. Некоторые особенности функционирования
прецедентных высказываний / Д. Б. Гудков, В. В.
Красных, И. В. Захаренко, Д. В. Багаева // Вестник
Московского университета. Сер. 9, Филология. 1997. №
4. С 106-118.
2. Красных В. В. Когнитивная база и прецедентные
феномены в системе других единиц и в коммуникации /
В. В. Красных, Д. Б. Гудков, И. В. Захаренко, Д. Б.
Багаева // Вестник МГУ. Сер. 9, Филология. 1997. № 3.
С. 62-75.
3. Песоцкий Е.А. Современная реклама: теория и практика.
Ростов-на-Дону, 2001. 315 с.
4. Солопова О. А. Использование прецедентных феноменов
в
политическом
дискурсе
выборов
депутатов
Государственной Думы / О. А. Солопова //
Ethnohermeneutik und Antropologie. – Landau, 2004. Bd.
10. С. 70-79.
126
ВОПРОСЫ ИЗУЧЕНИЯ БИЛИНГВИЗМА
А. А. Чикваидзе
Кутаисский государственный университет им. А. Церетели,
г. Кутаиси, Грузия, e-mail: [email protected]
Билингвизм стал одним из наиболее актуальных и
исследуемых явлений современности, особенно в связи с
изучением соотношения мышление – язык – культура. К. ЛевиСтрос отмечал, что язык есть одновременно и продукт
культуры, и ее составная часть, и условие ее существования.
Язык является способом существования культуры и фактором
формирования культурных кодов. Каждый носитель языка
является в то же время и носителем культуры, языковые знаки
становятся знаками культуры, передают ее основные установки.
Языковые различия во многом связаны с культурными
различиями в обычаях, общепринятых ценностях и нормах
поведения. Культура тесно связана и с лексикой, и с
прагматикой языка. Как показывают исследования, язык может
играть важную роль как предсказатель поведения и характера
личности людей. Многие люди, владеющие двумя языками,
утверждают, что думают и действуют по-разному, в
зависимости от того, на каком языке они говорят в настоящий
момент. Эксперименты с двуязычными людьми не столь
многочисленны. В результате одного из таких опытов Эрвин
пришел к заключению, что на французском языке участники
выражали больше агрессии и замкнутости, чем на английском, и
что женщины демонстрировали более высокую потребность в
достижениях, когда говорили на английском. Эрвин
приписывает эти различия тому, что во французской культуре
более важна словесная демонстрация своей доблести и сильнее
различаются роли мужчин и женщин. Обусловленные языком
различия в поведении могут быть связаны с разными
прагматическими системами и другими лингвистическими
различиями, но существует еще два объяснения механизмов,
лежащих в основе подобных личностных сдвигов, связанных с
языком. Они известны как гипотеза присоединения к культуре и
гипотеза присоединения к меньшинству. Первая состоит в том,
127
что «двуязычные иммигранты склонны принимать, как свои,
ценности и убеждения культуры, связанной с тем языком, на
котором они в данный момент общаются. Когда они
переключаются на другой язык, они вместе с тем
переключаются также и на другие культурные ценности.
Гипотеза присоединения к меньшинству, напротив, утверждает,
что двуязычные иммигранты склонны идентифицировать себя
как членов этнического меньшинства и принимать
поведенческие стереотипы культуры большинства, касающиеся
их группы, как свои собственные характеристики, в то время,
когда они общаются на языке своей группы. До тех пор пока эти
стереотипы
соответствуют
действительности,
гипотеза
присоединения к меньшинству приводит к тем же
предсказаниям, что и гипотеза присоединения к культуре; т. е.
можно сказать, что, разговаривая на своем первом языке, люди
будут в большей степени вести себя так, как принято в культуре
их предков, и это также будет соответствовать стереотипам
культуры большинства относительно их культуры. Языковой
контекст в таком случае служил бы предсказателем изменений в
поведении, так же как и в свойствах личности» [3].
Теория лингвистической относительности предполагает,
что люди, владеющие более чем одним языком, могут
руководствоваться разными структурами мышления при
общении на разных языках. Возникает вопрос: можно ли
утверждать, что двуязычные люди действительно имеют доступ
к двум различным моделям мышления? И каким образом
происходит сосуществование различных языковых миров в
сознании одного человека? Согласно одной из существующих
точек зрения, у билингва языковая картина мира собственного
языка дополняется и расширяется новыми ксеноконцептами,
новыми образованиями в виде интегрированных когнитивных
структур. Залевская А. считает, что общая концептуальная
система независима от языка и что эта система действует по
одинаковым принципам и у монолингвов, и у билингвов.
Представители психологического подхода (Л. Щерба, Е.
Верещагин, Ю. Дешериев) исследуют особенности речевых
психофизиологических механизмов в процессе языкового
128
контакта, описывают закономерности функционирования
различных языковых систем у билингвов. Они утверждают, что
при билингвизме возможны два вида взаимодействия языков в
сознании индивида: 1) языки образуют независимые системы
ассоциаций, не вступающие во взаимодействие (индивид может
испытывать затруднения при переключении с одного языка на
другой в процессе коммуникации); 2) языки образуют в
сознании человека одну общую систему ассоциаций, каждый
элемент которой имеет эквивалент в другом языке, поэтому
процесс переключения не вызывает затруднений.
Язык всегда тесно связан с национальным чувством и
сознанием. И у каждого народа формируются те уникальные
ассоциации образного мышления, которые обусловлены языком.
Язык
и
культура
являются
важнейшими
этнодифференцирующими признаками. Как осознают себя
двуязычные люди? Что становится для них определяющим
этническую принадлежность? Какова роль языка (или языков)
на различных этапах становления или изменения этнической
идентичности? Как утверждает Т. Стефаненко, этнический
статус чаще всего остается неизменным на протяжении всей
жизни человека. Но это не статичное, а динамичное
образование. Под влиянием внешних обстоятельств может
произойти
переосмысление,
трансформация
этнической
идентичности. Антон Дельвиг, немец по происхождению,
воспитывался в русских традициях и сформировался как
русский поэт и русская языковая личность. Н. Берберова в
воспоминаниях о русском писателе и поэте Вл. Ходасевиче
пишет: «...Для меня он, не имеющий в себе ни капли русской
крови, есть олицетворение России... я не знаю никого более
связанного с русским ренессансом первой четверти века, чем
он...» [1; с. 504].
Наблюдения привели ученых к мысли о возможности
существования двойного самосознания этноса («биэтническая
идентичность», по Т. Стефаненко). Развитию биэтнической
идентичности способствует билингвизм, поскольку язык
отражает национальную картину мира. Явление двойного
самосознания становится еще более интересным, когда речь
129
заходит о проблеме художественного билингвизма, который
влияет на творчество любого писателя, обостряя чувство
родного и иностранного языков. «Видимо, в этом разгадка
феномена поэтов, которые творили на нескольких языках и
стали великими представителями нескольких народов.
Например, Саят-Нова слагал свои стихи на грузинском,
армянском и азербайджанском языках и стал поэтом трёх
народов. Объясняют этот феномен тем, что большая часть
жизни поэта прошла в Тифлисе (ныне Тбилиси), который был
духовным центром Закавказья и в котором складывалась посвоему единая культура, о чём писал армянский поэт О.
Туманян: «То был особый, самобытный мир, где кавказские
народы, — каждый с присущим ему бытием и колоритом, —
объединились и создали чрезвычайно привлекательную и
интересную жизнь, смешение наций. И так как в этой жизни
задавал тон веселый грузинский дух, то старый Тифлис не был
простым этнографическим сборищем чуждых друг другу
элементов. То был весёлый свадебный пир, на который были
званы все национальности и племена Кавказа». Близость
культур среднеазиатских народов, равно как и двойное
самосознание, способствовали появлению многоязычных
классиков поэзии этого региона (например, персидский и
таджикский поэт Фирдоуси)» [9; с. 92].
Писатель, пишущий на двух языках, особенно внимателен
к свойствам языка и ощущает его своеобразие. Взаимосвязь
национальной ментальности и языка особенно ощутима в
процессе создания художественного произведения. По словам
А. Вознесенского, разница языка отражает различие
психологического склада. Например, он считал, что русский
язык более расположен к передаче психологического состояния,
он непереводим и незаменим в пейзаже-настроении, а
английский более подходит к чувственным описаниям, он
экономен в передаче действия и юмора. Свое отношение к
двуязычию Набоков изложил в «Постскриптуме к русскому
изданию» «Лолиты». Он считал, что определенные понятия
точнее и ярче отражаются на русском языке: «Телодвижения,
ужимки, ландшафты, томление деревьев, запахи, дожди, тающие
130
и переливчатые оттенки природы, все нежно-человеческое (как
ни странно!), а также все мужицкое, грубое, сочно-похабное
выходит по-русски не хуже, если не лучше, чем по-английски;
но столь свойственные английскому тонкие недоговоренности,
поэзия мысли, мгновенная перекличка между отвлеченнейшими
понятиями, роение односложных эпитетов – все это, а также все
относящееся к технике, модам, спорту, естественным наукам и
противоестественным
страстям,
становится
по-русски
топорным, многословным и часто отвратительным в смысле
стиля и ритма. Эта неувязка отражает основную разницу в
историческом плане между зеленым русским литературным
языком и зрелым, как лопающаяся по швам смоква, языком
английским: между гениальным, но еще недостаточно
образованным, а иногда довольно безвкусным юношей, и
маститым гением, соединяющим в себе запасы пестрого знания
с полной свободой духа. Свобода духа! Все дыхание
человечества в этом сочетании слов» [5; с. 386-387].
По сравнению с другими двуязычными писателями
Набоков совершенно уникален. Он в одинаковой степени
хорошо владел русским, английским, французским языками. По
словам З. Шаховской, «история литературы не знает другого
примера писателя, достигшего мастерства, создавшего
персональный стиль и своеобразный ритм на двух разных
языках» [10; с. 99]. Уникальность языкового сознания писателя
заключалась в его многомерности, что было обусловлено его
многоязычным воспитанием. Координативный билингвизм
Набокова, – это двуязычие, при котором нет доминирующего
языка, и каждому из языков писатель отводит определенную
роль в творчестве: «Я американский писатель, рожденный в
России, получивший образование в Англии, где я изучал
французскую литературу перед тем, как на пятнадцать лет
переселиться в Германию... Моя голова разговаривает поанглийски, мое сердце – по-русски, и мое ухо – пофранцузски...» [6; с. 162]. Жан Бло писал об английском языке
Набокова: «Язык этот очень своеобразен и, разумеется, помечен
происхождением его носителя, то есть как по форме, так и по
интеллектуальной насыщенности имеет довольно сильный
131
русский акцент, - в том же самом смысле, в каком у Фолкнера
акцент писателя Миссисипи, у Джойса дублинский, у Зингера
бруклинский. Набоков выиграл пари: его вселенная, его стиль
чувствовать и мыслить смеются над языками и географией,
вознося личность на уровень не только транснациональный и
транскультурный,
но
и
транслингвистический,
трансцендентный» [2; с. 168].
Множество вопросов возникает при автопереводе
литературных произведений (проблемы эквивалентности,
адекватности и переводимости, а также семантические,
прагматические аспекты перевода, проблемы соотношениях
автоперевода (как текста) и перевода и т.д.). Примеров
автоперевода в мировой литературе немало, и все они
свидетельствуют о трудностях этого процесса. Когда писатель
Дж. Грин попытался перевести одну из своих книг с
французского языка на английский, вместо перевода была
создана новая книга. Он утверждал, что когда писал поанглийски, становился другим человеком. Ж. Риссе в статье,
посвященной автопереводу романа Джойса «Поминки по
Финнегану» на итальянский язык, утверждает, что, в отличие от
переводов в обычном смысле слова, переводы Джойса не
стремятся стать эквивалентами оригинального текста, но
представляют собой своего рода расширение, более смелый
вариант рабочего текста. Набоков писал о переводе романа
«Другие берега»: «Недостатки объявились такие, так
отвратительно таращилась иная фраза, так много было и
пробелов и лишних пояснений, что точный перевод на русский
язык был бы карикатурой Мнемозины. Удержав общий узор, я
изменил и дополнил многое. Предлагаемая русская книга
относится к английскому тексту, как прописные буквы к
курсиву» [4; с. 134].
Переводчик всегда вынужден учитывать социальнокультурный барьер, связаный с различиями между культурой
отправителя текста и культурой воспринимающей среды.
Невозможно сделать просто перевод с одного языка на другой,
вместе с языком происходит «перевод» с одной культуры на
другую. Отсюда вывод о «бикультурности» текста перевода,
132
поскольку требование «перевод должен читаться как оригинал»
в полном объеме едва ли выполнимо (по крайней мере,
применительно к художественному переводу), так как оно
подразумевает полную адаптацию текста к нормам другой
культуры [11; с. 183]. Язык находится в постоянном
взаимодействии с мышлением, познанием, культурой.
«Циклическая природа взаимоотношений между культурой и
языком позволяет сделать вывод, что ни одну культуру нельзя
полностью понять без понимания ее языка, равно как и
наоборот» [3].
Исследования
билингвизма
свидетельствуют
о
непосредственной связи между языком и культурой. Она
оказывает значительное влияние на процессы кодирования и
декодирования информации. В настоящее время многие
вопросы билингвизма в связи с мышлением, познанием,
усвоением языка и культуры по-прежнему остаются открытыми.
Для более полного представления о процессах формирования и
функционирования билингвима, о его влиянии на развитие
человека, о его роли в художественном творчестве необходимо
междисциплинарное исследование с привлечением данных
нескольких
областей
знания
(теории
перевода,
этнопсихолингвистики,
психолингвистики,
когнитивной
лингвистики и др.).
Литература
1. Берберова Н. Курсив мой / Серебряный век: Мемуары – М.:
Известия, 1990.
2. Бло
Ж.
Набоков.
–
СПб.:
Русско-Балтийский
информационный центр БЛИЦ, 2000.
3. Мацумото Д. Психология и культура. – СПб.: Питер, 2003.
[Электронный
ресурс].
URL:
http://www.gumer.info/bibliotek_Buks/Psihol/Mats/index.php
(дата обращения: 30.05.2013)
4. Набоков В. Другие берега / Собр. соч.: В 4 т. – М.: Правда,
1990. Т. 4.
133
5. Набоков В. Постскриптум к русскому изданию
«Лолиты» / Набоков В. В. 6. Американский период.
Собр. соч. в 5 т. СПб.: Симпозиум, 2000. Т. 3.
6. Набоков о Набокове и прочем: Интервью. Резенции. Эссе. –
М.: Независимая газета, 2002.
7. Напцок М. Р. Дискурс В. Набокова: билингвизм и
проблемы
перевода
/
Вестник
Адыгейского
государственного университета. Серия 2: Филология и
искусствоведение. 2008, №6. [Электронный ресурс]. URL:
http://cyberleninka.ru/article/n/diskurs-v-nabokova-bilingvizmi-problemy-perevoda (дата обращения: 30.05.2013)
8. Стефаненко Т. Этнопсихология. – М.: Институт психологии
РАН, Академический проект, 1999.
9. Хроленко А.Т. Основы лингвокультурологии. – М.: Флинта,
Наука, 2005.
10. Шаховская З.А. В поисках Набокова. Отражения. – М.:
Книга, 1991.
11. Швейцер А.Д. Перевод в контексте культурной традиции /
Литературный язык и культурная традиция. – М.: Стелла,
1994.
134
Секция 10. Педагогические науки
ЭЛЕМЕНТЫ ДИСКУССИИ
НА ПРАКТИЧЕСКОМ ЗАНЯТИИ
ПО ТЕРАПЕВТИЧЕСКОЙ СТОМАТОЛОГИИ
В. Д. Молоков, О. П. Самойлова, С. Ю. Бывальцева
ГБОУ ВПО ИГМУ, г. Иркутск, Россия [email protected]
Способность студентов грамотно общаться с пациентами,
выходить из сложных ситуаций, все эти значимые моменты
может
формировать
коммуникативная
компетенция.
Коммуникативная компетенция: способность вступать в
контакт, высказывать свою точку зрения, слушать и понимать
точку зрения собеседника, вести дискуссию и т.д.; готовность
решать коммуникативные задачи, адекватно вести себя в
различных социальных ситуациях, компетенции; владение
устным и письменным общением, несколькими языками [3].
Для взаимодействия во время общения с пациентом, врач
должен четко представлять значимость информированного
согласия,
пути
достижения
поставленных
целей.
Информированное согласие пациента — обязательное условие
для выполнения любого медицинского вмешательства. От того,
как оно написано, нередко зависит здоровье, а иногда и жизнь
пациента. Выбирать метод диагностики и лечения должен
пациент, а доктор обязан в простой и доступной форме
объяснить ему все возможные осложнения и последствия
процедур, которые он предлагает провести, а также указать
альтернативные варианты лечения и их эффективность. В какой
форме - устно или письменно - объяснить пациенту все
возможные риски медицинских манипуляций, решает врач. Но в
информированном согласии должны быть четко прописаны
объем манипуляций, риск осложнений и эффективность
процедуры. Выбрав наиболее оптимальный способ лечения,
человек ставит свою подпись. Для исключения разногласия и
конфликтов в общении врач - пациент студенты должны иметь
представление о важной (ключевой) коммуникативной
135
компетенции, которая должна быть сформирована в
медицинском ВУЗЕ для обеспечения профессионального и
личностного самоопределения студентов.
Дискуссионный метод обучения, основанный на обмене
мнений по определенной проблеме, является классическим
методом,
позволяющим
развить
многосторонне
коммуникативную компетенцию у студентов. Точка зрения,
высказывания студентами в ходе дискуссий, может отражать как
его собственное мнение, так и опираться на мнение других
лиц[2].Хорошо проведенная дискуссия имеет большую
обучающую и развивающую ценность, учит более глубокому
пониманию проблемы, умению защищать свою позицию,
считаться с мнением других. В любом случае на подобном
практическом занятии должен присутствовать характерный
признак - межличностный конфликт, где каждый защищает
свою позицию. В последние годы заметное влияние в
педагогической практике получили дискуссии на основе
групповой работы. На дискуссионных занятиях каждый ищет
свою истину, свое решение проблемы. При этом студенты
овладевают важнейшими ораторскими умениями и искусством
доказательной полемики, что уже само по себе является
важным. В самом общем виде, используя общепедагогические
классификации, все дискуссии можно поделить на несколько
групп и подгрупп в зависимости от принципов их проведения,
задач и направленности обсуждения.
Первый
тип
это
структурированная,или
регламентированная дискуссия. На практическом занятии
студенты имеют четкий план, структуру и регламент
обсуждения. Смысл дискуссии такого типа заключается в том,
что «малые» группы изучают какую-либо «частную» проблему
вопрос, как часть какой-либо общей глобальной проблемы,
которую предстоит решить студентам.В начале занятия
преподаватель формулирует общие задачи перед всеми
студентами и даже в ряде случаев выдвигает возможные
гипотезы по ее решению. Преподаватель определяет и
регламентирует и структуру занятия.Состав группы может
быть примерно такой: ведущий, задача которого состоит в том,
136
чтобы организовать обсуждение проблемы и привлечь всех
членов группы; аналитикзадает вопросы студентам в ходе
обсуждения, подвергая сомнению высказываемые взгляды и
идеи; протоколист фиксирует все, что относится к решению
проблемы, он же представляет позицию студентов в
заключительной
части
практического
занятия;
наблюдательдает оценку участия каждого студента[1].
Вторым типом дискуссии является дискуссия с
элементами игровогомоделирования.Смысл этого занятия, в
отличие от предыдущего, заключается в том, чтобы взглянуть
на поставленную проблему не просто с позиций пациента, а
под углом зрения представителей определенной точки
зрения.Суть практического занятия такого типа заключается в
обсуждении проблем, вопросов с позиций «очевидцев»
событий, как бы абстрагируясь от учебников и
дополнительной литературы. Часть студентов представляют
экспертов. Сочетание оценок прошлого времени и
современных создает своеобразие данной дискуссии.
Третий тип дискуссии – проектная. Она основана на
методе подготовки и защиты проекта по определенной теме. За
одну - две недели студентам объявляется тема и модель
анализа проблемы:
1. Клиническая ситуация.
2. Выявление трудностей, определяемых контекстом
проблем.
3. Разделение изучаемой проблемы на отдельные вопросы.
4. Поиск и разработка частных задач одной общей
проблемы.
5. Предположение гипотезы по решению проблемы в
определенной стадии заболевания.
Проект
позволяет
приобщить
студента
к
самостоятельной работе, научить говорить его перед
аудиторией. Подготовка проекта ставит студента на место
преподавателя,
наглядно
демонстрируют
некоторые
особенности и трудности в его работы.Дискуссия требует
специальной подготовки студента, выбирается очень острая
тема, определяется авторитетный и эрудированный ведущий
137
дискуссии, разрабатываются вопросы, которые побуждали бы
студентов спорить[4].В ходе занятия студенты выявляют
предпосылки возникновения данной проблемы, ее истоки.
Суть дискуссии состоит в том, что в результате исследования
вопроса, темы и выявления трудностей в его решении
студенты в ходе обсуждения намечают возможные попытки
выхода, благоприятного исхода по разрешению проблемной
ситуации. Так рождаются проекты -различные гипотезы по ее
решению. Каждая группа готовит свой вариант решения
проблемы, и они обсуждаются в дискуссии.
Дискуссии классификацируются по формам проведениядебаты на основе соперничающих команд. Эти команды ведут
спор вокруг четко сформулированного тезиса, который
опровергает одна команда и защищает другая.От одной
команды выделяются три «спикера» утверждающей стороны:
один
утверждает
тезис,
представляет
аргументы
утверждающей стороны, второй усиливает утверждающую
линию в споре, представляет доказательства, третий
представляет финальный ответ соперникам, опровергает их
доводы, усиливает доказательства утверждающей линии. Три
«спикера» отрицающей стороны выдвигают все возможные
отрицающие аргументы, опровергают аргументы противников,
усиливают отрицающую линию в споре, третий готовит
финальный ответ соперникам, опровергает их доводы,
усиливает доказательства отрицающей стороны. Тайм-кипер
следит за временем дискуссии[5].
Следующая модель дискуссии- вертушка, целью
которой является вовлечение буквально всейгруппы в
обсуждение. Дискуссия направлена на одновременное
включение всех студентов в активную полемику с разными
партнерами по общению.Стулья для студентов расставляются
в два больших круга. Внутренний круг заполняют студентами
спиной к центру круга, во внешнем круге студенты
располагаются лицом к центру круга. Таким образом, каждый
студент сидит напротив другого. Внутренний круг неподвижный, внешний - подвижный. По сигналу
преподавателя все студенты внешнего круга пересаживаются
138
на стул вправо и оказываются перед новым партнером.В
данной дискуссии студенты внутреннего круга условно
являются сторонниками одной точки зрения, а внешнего другой. Студенты одновременно ведут в парах дискуссию.
Встречаясь с новым партнером, они слышат новые доводы,
аргументы, а, значит, и подбирают новые контраргументы. К
концу круга студенты, как правило, оттачивают свою систему
аргументов, а также приобретают опыт общения с разными
партнерами[6].
Целый ряд дискуссионных уроков может быть построен
на основе работы ключевой группы сильных студентов и
аудитории. К ним относится занятие по типу круглого
стола,где небольшая группа студентов дискуссии обсуждает
проблему, всягруппа участвует в обмене мнениями.
Преподаватель также может провести заседание экспертной
группы, где студенты выступают с сообщениями по проблеме,
затем всягруппа обменивается мнениями об их сообщениях.
Более широкомасштабную дискуссию можно провести по типу
симпозиума, когда готовятся серьезные доклады с
противоположными оценками проблемы, а весестуденты
следит за ходом выступлений и участвует в обсуждении. На
этом занятии возможны и выступления содокладчиков.
Существуют и другие формы дискуссий, различающиеся по
принципу их организации: занятия -митинги, занятия -суды,
занятия -диспуты и др. В ходе проведения дискуссии
преподаватель устанавливает порядок в группе, конструктивно
формулирует проблему обсуждения, предлагает перечень
обсуждаемых вопросов. По ходу обсуждения преподаватель
поясняет студентам задачи, задает стимулирующие вопросы,
подбадривает
студентов
в
обсуждении,
суммирует
высказывания, выявляет разногласия в оценках групп,
пытается найти вместе с ними компромисс, включает в
действие пассивных студентов и обращается к мнению
меньшинства,
добиваясь
всесторонности
и
глубины
обсуждения проблемы группой. Преподаватель, организуя
дискуссионное занятие, должен помнить определенные
правила. Он избегает неопределенных и двусмысленных
139
вопросов; дает время на обдумывание ответов; обращает
внимание студентов на каждый ответ; изменяет ход
рассуждений студента, по-иному сформулировав мысль или
дав прямо противоположное мнение; уточняет и проясняет
высказывания студента для всей группы; задает конкретизирующие вопросы. Преподаватель во время дискуссии
предостерегает студентов от чрезмерных обобщений,
побуждает их к углублению мысли, держит паузу, когда это
необходимо; останавливает тех, кто много говорит во время
дискуссии в ущерб другим выступающим. Если дискуссия
отклоняется от темы обсуждения, ведет к явно неправильному
выводу
или
«топчется
на
месте»,
то
преподаватель,безусловно,помогает
студентам
найти
правильное решение[7].
На кафедре терапевтической стоматологии ИГМУ активно
используются
дискуссионные
формы
обучения
в
преподавании.Преподавателями
кафедры
терапевтической
стоматологии ставятся определенные цели формирования у
студентов основных параметров клинического мышления: умение
информировать пациента, целостное восприятие клинической
ситуации;постановка диагноза во взаимодействии с разной
соматической патологией; утверждение в сознании студентов
поколения приоритета общечеловеческих, общекультурных
ценностей; признание ценности, уникальности человеческой
жизни; отрицание принуждения как способа решения проблем;
открытость личности к новому; мобильность, преодоление
стереотипов,
критичность
и
гибкость
мышления,
толерантность.Дискуссионный метод используется в обучении
студентов на практических занятиях кафедры терапевтической
стоматологии, позволяет более четко представить клинику данной
патологии, правильно составить план обследования, лечения и
понять последовательность назначения лекарственных препаратов
пациенту.
Таким образом, одной из ведущих педагогических идей, в
учебно-воспитательном
процессе
стала
ориентация
жизнедеятельности кафедры терапевтической стоматологии на
выработку у студентов позиции самос-тоятельного и
140
ответственного принятия решения в постановки диагноза и
назначение лечения пациенту.1 этап дискуссионного метода –
подго-товительный,в ходе которого происходит формулирование
проблемы, определение основных вопросов для обсуждения,
устанавливались правила, условия, регламент, распределялись
роли. «Ведущий» (организатор) – его задача состояла в том, чтобы
организовать обсуждение вопроса, проблемы, вовлечь в него всех
студентов
группы.«Докладчики»
–
составленные
дома
презентации
студентов демонстрировались
и
подробно
разбирались, в виде дискуссии задавались вопросы, подвергая
сомнению высказываемые идеи, формулировки.«Наблюдатель» –
в его задачи входила оценка участия каждого члена группы на
основе заданных критерий. «Таймкипер»– человек, следящий за
соблюдением правил и регламента дискуссии. Раздавался
дидактический материал. Студентам представлена была
клиническая ситуация с описанием жалоб, анамнеза пациента,
предоставлен фото – слайд с данной патологией. К занятию
студенты: описали стоматологический статус на основании жалоб,
анамнеза, фото – слайда, составили план обследования пациента,
составили
план
лечения.
Представили
презентацию
лекарственных препаратов, выписанных данному пациенту с
подробным описанием, дозировками и сроками назначения.
2 этап – слайд – тестирование, дискуссия, на занятии
студентам предлагается слайд – тестирование лекарственных
препаратов, которые назначает врач по данному диагнозу. Слайды
пронумерованы, и студенты заполняли таблицу, в которой
отражены название действий лекарственных препаратов. Для
разных диагнозов может быть от 5 – 16 действий лекарственных
препаратов (местное лечение и общее). Затем, проверялись тесты,
неправильные ответы анализировались.Составленные дома
презентации студенты демонстрировали и подробно разбирались.
Студенты в виде дискуссии поочередно докладчику высказывали
свои замечания и задавали дополнительные вопросы.
3 этап – этап подведения итогов, в ходе которого делалось
резюме, суммировались высказанные мнения, обсуждались
варианты лечения, а затем оценивался ход обсуждения, участие
каждого в решении проблемы.
Задача преподавателя не
141
допустить ошибок в формировании клинического мышления
студентов в описании стоматологического статуса, назначении
плана обследования, лечения по данной патологии. В конце
занятия преподавателем подводились итоги, и записывался
алгоритм лечения данной клинической ситуации. Выступления
проходили организованно, в обсуждении
предоставлялось
каждому
участнику
возможность
высказаться.
Каждое
высказывание, позиция были внимательно рассмотрены.В ходе
обсуждения
студентам
объяснялось,
что
недопустимо
«переходить на личности», навешивать ярлыки, допускать
уничижительные высказывания и т. п.
Вывод: использование дискуссионного метода на кафедре
терапевтической стоматологии позволило студентам правильно
представить клиническую ситуацию, составлять план лечения,
высказывать свою точку зрения и пользоваться мыслями других
лишь для поддержки своих измышлений кратко и по содержанию.
Используемая реальная клиническая ситуация сопровождалась
интеллектуальным затруднением, возбуждением познавательной
активности,
желанием
разобраться
и
высказаться
студенту.Недостатки дискуссионного метода: занимает много
времени, требуется предварительно объяснить правила, можно
уйти в сторону от темы обсуждения, при узко поставленной теме
возможны
повторения,
возможность
превращения
в
«говорильню», можно «перегореть» ожидая выступления.
Достоинства дискуссионного метода: привлекает к активному
участию всех присутствующих, дает возможность представить,
услышать и сопоставить разные точки зрения, можно быстро
собрать много аргументов, побуждает к самоанализу,
возможности использования дополнительных материалов,
воспитывает терпимость, учит слушать других.
Литература
1. Смирнова С.А. Педагогика, педагогические теории,
системы, технологии.- М.: Академия, 2009.- С.196.
2. Смирнова А.С. Педагогика, педагогические теории,
системы, технологии.- М.:Академия, 2011.- С.317.
3. Справочник по педагогическим инновациям (В. Н,
142
Михелькевич, Л. И.Полушкина, В.
4. М. Мегедь) Самара. 1998 – С.14.
5. «Методические семинары»/ составитель – Норенко И.Г. –
Волгоград, Издательство «Учитель», 2007 –С.24.
6. «Педагогические советы». Выпуск 2 – Волгоград,
Издательство «Учитель», 2011.-С.17.
7. « Педагогические советы». Выпуск 6 – Волгоград,
Издательство «Учитель», 2009. -.С.12.
СТРАТЕГИЧЕСКИЙ АСПЕКТ
ФУНКЦИОНИРОВАНИЯ
КОЛЛЕДЖА ФИЗИЧЕСКОЙ КУЛЬТУРЫ
Е. М. Старикова1, А. М. Стариков2
ФГБОУ ВПО «Уральский государственный университет физической
культуры», г. Челябинск, Россия, [email protected]
2
ФГБОУ ВПО «Южно-Уральский государственный университет»
(НИУ), г. Челябинск, Россия, [email protected]
1
Успешность
функционирования
образовательного
учреждения, в том числе и колледжа физической культуры, во
многом определяется своевременностью и адекватностью
реакции на изменения в потребностях абитуриентов и
работодателей.
В
условиях
нестабильностиспроса
на
образовательные услуги и предложения на рынке труда,
существенно возрастает значимость механизмов управления
устойчивостью и эффективностью учебных заведений,
определяющих дальнейшее качество жизни общества и его
социально-экономическое развитие.
Управление
образовательным
учреждением
предусматривает выработку стратегий, нацеленных не только на
конкуренцию за выпускников школ, но и на взаимодействие
учебных заведений с целью укрепления и расширения научной
базы, что необходимо учитывать в стратегическом
планировании.Само понятия «стратегия» используется в
научной литературе [1] в нескольких содержательных
143
направлениях: 1) план, руководство, направление развития;
2) принципы поведения; 3) позиция; 4) перспектива; 5) прием, с
целью опередить соперника.
Исходя из содержания стратегии, можно заключить, что
одним из основных компонент стратегического планирования, в
том числе и для колледжа физической культуры, является
поддержание его конкурентоспособности. Исходя из этого, на
основе анализа сети Интернет, справочников для поступающих,
журналов и др. источников, были выделены конкуренты
колледжу физической культуры УралГУФК на рынке
образовательных услуг (вузы и колледжи, имеющие кафедры,
обучающие в направлении физической культуры и спорта).
Опираясь
на
выделенные
показатели
и
критерии
конкурентоспособности применительно к учебным заведениям с
направленностью нафизическую культуру и спорт, построены:
1) сравнительный
граф
конкурентоспособности
образовательных
учреждений,
позволяющий
проиллюстрировать слабые позиции исследуемого учебного
заведения по сравнению с другими (рис. 1);
2) сравнительный граф-лидера, который построен на
модели наилучших показателей конкурентоспособности в
образовательной сфере и данных колледжа УралГУФК (рис. 2);
3) диаграмма слабых и сильных позиций, сочетающая в
себе
модель
усредненных
значений
показателей
конкурентоспособности по образовательной отрасли и данных
объекта исследования (рис. 3).
144
с моделью лидераРисунок1 - Сравнительный
конкурентоспособности
образовательных учреждений
145
граф
Рисунок 2 - Сравнительный граф
конкурентоспособности колледжа УралГУФК
Сайт
ППС
Материальная база
Популярность
Условия обучения
Рисунок 3 - Диаграмма слабых и сильных позиций
для колледж УралГУФК и
модели усредненных
показателей
146
ППС
Анализ сравнительных графов и диаграммы иллюстрирует
такие сильные стороны колледжа УралГУФК, как:приемлемые
стоимость обучения и условия поступления. Слабой стороной
являются информационные ресурсы (сайт). В связи с этим
одним из направлений повышения конкурентоспособности
колледжа УралГУФК является работа с информационными
ресурсами.
С
целью
повышения
конкурентоспособности
исследуемого учебного заведения, разработана стратегия его
дальнейшего развития, которая представлена системой
рекомендаций. В частности, предлагается осуществить
кооперацию профессорско-преподавательского состава (ППС) с
информационно-вычислительным центром (ИВЦ), введя
дополнительные параметры, которые должны быть отслежены
отделом системы менеджмента качества (СМК) и переведены в
часы методической работы ППС. Распределение часов может
быть осуществлено на основе коэффициентов поощрения
кафедры, а также индивидуально и т.д. На основе данных
параметров отделом СМК должна быть выработана стратегия
нейтрализации слабых сторон кафедр и в целом
функционирования колледжа в области конкурентоспособности,
учитывая рейтингобразовательных учреждений, ведущих набор
абитуриентов по направлению физическая культура и спорт.
В основе выделения дополнительных параметровлежит
метод экспертной оценки сайтов И.П. Мистюковой. В
частности, использованы следующие параметры: 1) индекс
популярности сайта учебного заведения путем анкетного опроса
по 10 балльной шкале, возможно оценивание и для отдельной
кафедры; 2)простота в работе (оценка аналогична пункту№1);3)
доступность в использовании (потребность в установлении
дополнительных программ) – оценка со стороны ППС;
4) оптимизация под поисковые системы (поиск сайта по
минимальной
информации
об
учебном
заведении);
5) использование счетчиков для определения количества
пользователей, посещающих страничку; 6)наличие новостных
лент Интернет–ресурса учебного заведения. Блок новостей
может включать в себя общие новости, в которых отражены
147
события учебного заведения и комментарии к ним. Для
ознакомления пользователей с событиями учебного заведения
на главную страницу могут выноситься новости, которые
отражают планируемые и проводимые мероприятия с
возможностью их комментирования. Новостной блок в сфере
информационных
технологий
учитывает
направление
деятельности структурного подразделения учебного заведения,
отдельных преподавателей; 7)обеспеченность и удобство
использования учебно-методических материалов. Наиболее
важной частью сайта учебного заведения, определяющей цель
его создания и поддержки являются сборники информационных
ресурсов. Они могут включать аннотации к учебным пособиям,
электронные издания учебно–методических комплексов и
публикации
авторов,
видеоматериалы
(презентации).
Размещение на сайте учебных пособий, учебно-методических
комплексов, статей и рекомендаций позволяет в короткие сроки
доводить до студентов и слушателей необходимую информацию
в ходе учебного процесса. При этом не затрачивается время на
прохождение данного материала в типографии для издания на
бумажном носителе или тиражирования. Время для подготовки
и издания данного материала ограничено работой над
материалом, редакторской обработкой и публикацией на
сервере.Развитие сайта позволит размещать и поддерживать на
его страницах электронные учебные комплексы, включающие
помимо текстовых материалов интерактивные структурнологические схемы, тестовые модули и деловые игры (решение
ситуационных задач). Применение современных программных
оболочек, в том числе ориентированных на сеть Internet, дают
новые возможности по разработке и использованию тестового
контроля. При этом преподаватель может осуществлять
контроль за работой обучаемых в аудиторное и внеаудиторное
время. 8) Наличие каталога ссылок на Internet-ресурсы. Он
может включать в себя каталоги образовательных и научных
сайтов, сайтов сферы информационных технологий. В него
можно включать и ссылки на сайты средств массовой
информации и др. Наличие данного блока позволит
оптимизировать работу пользователя по поиску необходимой
148
информации или выход на необходимые ему ресурсы.
9) Наличие форума на сайте учебного заведения. Активной и
востребованной частью ресурса является форум, который
используется студентами для общения, обмена мнениями по
различным вопросам. Обмен мнениями по научной, учебной и
общей тематике позволяет организовывать и поддерживать
дискуссионные клубы. Форум дает возможность проводить
социологические исследования. 10) Наличие системы поиска по
сайту.11) Наличие чата, видеоконференций.12) Создание групп
на таких сайтах, как одноклассники, в контакте с целью скрытой
рекламы колледжа в виде научной работы студентов
соответствующих направлений (связи с общественностью).
Таким образом, стратегическое планирование в
функционировании учебного заведения, в том числе и колледжа
физической культуры, включает в себя проведение
рейтингового исследования в области конкурентоспособности
отделом СМК и разработке мер по нейтрализации слабых и
укреплению лидирующихпозиций.
Литература
1. Минцберг Г. Школы стратегий /
Б. Альстренд, Д. Лэмпел . – Спб.: Питер, 2000.
149
Г. Минцберг,
ФОНЕТИЧЕСКАЯ ЗАРЯДКА НА УРОКАХ
АНГЛИЙСКОГО ЯЗЫКА КАК МОТИВАЦИОННОЕ
НАЧАЛО НА МЛАДШЕМ И СРЕДНЕМ ЭТАПАХ
Н. А. Харченко
Федеральное государственное бюджетное учреждение
высшего профессионального образования «Таганрогский
государственный педагогический институт имени А. П. Чехова»,
г. Таганрог, Россия, [email protected]
Мотивация – (от лат. movere) – побуждение к действию;
динамический
процесс психофизиологического плана,
управляющий
поведением человека,
определяющий
его
направленность, организованность, активность и устойчивость;
способность
человека
деятельно
удовлетворять
свои
потребности.[1]
Мотивация
–
это
внутренняя
психологическая
характеристика личности, которая находит выражение во
внешних проявлениях, в отношении человека к окружающему
миру, различным видам деятельности.
Сознаём мы это или нет, но каждый момент своей жизни
мы мотивированы что–то делать: удовлетворять ли
физиологические потребности (кушать, спать) или потребности
духовные (писать стихи, ходить в театр, рисовать пейзажи).
Если же мотивация отсутствует вообще, то это значит, что
человек мёртв. Если человек знает, что ему нужно чего-то
достичь, то есть, он мотивирован удовлетворить свою
потребность – он может свернуть горы. В драке победит не тот,
кто сильнее по физическим параметрам, а тот, кто больше хочет
победить. В спортивной команде могут быть талантливые
игроки, но играть серо и блекло. Чтобы выиграть, нужна воля к
победе, то есть, мотивация.
Проблема повышения мотивации является одной из
наиболее важных и сложных проблем психологии и педагогики,
поскольку обусловлена поиском путей пополнения средств
обучения иностранному языку на основе пересмотра
компонентов содержания обучения с целью их оптимизации в
целом.
150
Особую важность имеет вопрос о мотивации именно на
начальной ступени обучения, так как основы для того, чтобы
дети умели и имели желание учиться, закладываются в младшем
школьном возрасте. Но не менее важную роль вопрос о
мотивации имеет на среднем и старшем уровнях. Именно мотив
является источником деятельности и выполняет функцию
побуждения и смыслообразования. И.А.Зимняя: «Мотивация
является «запускным механизмом» всякой человеческой
деятельности: будь то труд, общение или понимание».
Проблема мотивации в учении возникает по каждому
школьному предмету. Однако особо остро стоит проблема
мотивации изучения иностранных языков в средней школе.
Исследователи вопроса мотивации приводят данные о снижении
ее от класса к классу. При этом примечательно, что до момента
изучения иностранного языка и в самом начале у учащихся, как
правило, высокая мотивация. Им хочется изъясняться на
иностранном
языке
со
сверстниками;
заманчивой
предоставляется возможность декламировать стихотворения и
петь песни на иностранном языке; читая, узнавать о других
странах. Многие ребята усматривают в изучении иностранного
языка что-то «приключенческое», проникновение в новый
незнакомый
мир;
привлекательной
предоставляется
возможность перевоплощаться: "Я – говорящий на родном
языке", "Я – говорящий на иностранном языке". Словом, почти
у всех есть желание владеть иностранным языком, уметь
общаться непосредственно, через книгу и переписку. Но вот
начинается процесс овладения иностранным языком, и
отношение учащихся меняется, многие разочаровываются. Ведь
этот процесс предполагает период накопления «строительного
материала», стадию неизбежно примитивного содержания,
преодоления разнообразных трудностей, что отодвигает
достижение целей, о которых мечталось.
Успешное начало обучения иностранному языку
способствует созданию высокой мотивации к изучению
иностранных языков. Успех обучения и отношение учащихся к
предмету во многом зависят от того, насколько интересно и
эмоционально учитель проводит уроки.
151
Фонетическая зарядка может являться одним из способов
повышения мотивации. Фонетическая зарядка – это тренировка
произнесения конкретного звука в разном окружении.
Виды фонетической зарядки:
1.
Лексико–фонетическая зарядка
Данная
фонетическая
зарядка
направлена
на
фонетическую отработку вокабуляра по определенной теме с
одной стороны, и на закрепление лексики с другой. В результате
лексико – фонетической зарядки отрабатывается произношение
не только отдельных слов, но учащиеся запоминают
коммуникативно-ценные фразы и клише, которые в дальнейшем
они смогут использовать в своей речи.
E.g.: turning, the first turning, the first turning to the left.
2.
Грамматико– фонетическая зарядка
Данный
вид
фонетической
зарядки
позволяет
отрабатывать различные грамматические структуры и явления.
Как правило, эти явления уже знакомы учащимся и не требуется
дополнительных объяснений со стороны учителя.
Например,
грамматико-фонетическая
зарядка
по
закреплению употребления оборота "There is/are " по теме
"The living room” (6 класс) выглядит следующим образом:
E.g.: There is a sofa. Is there a sofa?
3.
Фонетическая зарядка на ритм
К сожалению, интонационной стороне речи уделяется
мало внимания при обучении английскому произношению в
школе, поэтому данные фонетические зарядки проводятся очень
редко.
E.g.: Kate took care of her sister. Kate took care of her
sister.
4.
Фонетическая зарядка, относящаяся к
интонационному оформлению речи
Для английского языка характерно чередование ударных
слогов через равные промежутки времени в определенной
мелодической последовательности. Хорошими примерами
английского ритма являются рифмовки или небольшие
стихотворения. При предъявлении стихов рекомендуется
отбивать ритм.
152
E.g.: Good – better – the best;
Never have a rest;
Whether the weather is fine
Or whether the weather is not
Whether the weather is cold
Or whether the weather is hot
We’ll weather the weather
Whatever the weather
Whether we like it or not.[3]
Практику мы проходили в городе Таганроге, на базе
Гимназии № 2 имени А. П. Чехова, в 6 «В» классе. Как показала
практика, фонетическая зарядка играет не менее важную роль в
обучении иностранному языку. На каждом уроке мы с
учащимися использовали различные виды фонетических
зарядок. После них у учащихся заметно повысился уровень
мотивации. На каждый урок ученики заходили в кабинет с
одним и тем же вопросом: «Будем ли мы сегодня петь песенки
или рассказывать считалочки?». После фонетической зарядки у
учащихся заметно улучшалась работоспособность, желание
говорить на изучаемом языке и желание вообще отвечать на
уроке. Учащиеся приходили полным составом на уроки, никто
не прогуливал. Это говорит о том, что учащимся нравилось
посещать уроки студентки. Мне кажется, мы смогли зажечь тот
огонек, который нужно сохранить на протяжении всего
обучения иностранному языку.
Литература
[1] http://ru.wikipedia.org статья «Мотивация»
[2] Рогова Г.В. Методика обучения иностранным языкам. –
М. 1991. –460с.
[3] http://festival.1september.ru/articles/571090/
153
Секция 11. Социологические науки
СОЦИАЛЬНЫЕ ПРОБЛЕМЫ ВЫПУСКНИКОВ
ПЕДАГОГИЧЕСКИХ ВУЗОВ.
ОЖИДАЕМЫЕ РЕЗУЛЬТАТЫ И РЕАЛЬНОСТЬ.
Н. Д. Конева
ФГБОУ ВПО «Волгоградский государственный университет»,
г. Волгоград, Россия, [email protected]
Российские и зарубежные учёные сегодня обращают
внимание на глубокие изменения в системах культуры, науки и
образования. Произошло снижение статуса народной, высокой и
массовой культуры. Наука и образование также переживают не
лучшие времена. Источником этих проблем всё чаще называют
глобализацию. Этот термин впервые был озвучен более 30 лет
назад американским социологом Дж. Маклином. На данном
этапе не сформировалось единого мнения ученых по поводу
глобализации, но разностороннее рассмотрение этого процесса
привело к возникновению большого числа глобализационных
концепций [1; с. 153]. По словам Павлова В.И.,
доктора педагогических наук, профессора,
нарастание
процессов глобализации показало несоответствие системы
подготовки
российских
специалистов
мировым
образовательным
тенденциям,
для
них
характерны
академическая мобильность учащихся, индивидуализация и
либерализация учебного процесса, ориентация на свободу и
нужды развития личности, поддержку высокого статуса и
профессионального уровня преподавателей [2; с. 200]. Однако
основополагающие
принципы
отечественной
системы
образования сложившейся в условиях плановой экономики, в
последние годы значительно разнятся с социокультурными и
экономическими реалиями современности. Социокультурная
среда, в том числе и в образовательных учреждениях, должна
формировать общественно-личностные духовные потребности,
соответствующие социальным и культурным нормам; создавать
условия для самореализации выпускника, обеспечивая в
154
дальнейшем воспроизводство образовательного, научного и
культурного потенциала.
Самореализация молодого специалиста всегда связана с
преодолением определённых препятствий. Посткризисные
экономические процессы внесли в трудовую сферу образования
усложнения и нестабильность. Незащищённость учителей, в
особенности начинающих педагогическую деятельность,
невостребованность с высшим образованием, параметры
заработной платы – всё это провоцирует формирование
пессимизма, неверие в возможность реализовать свои лучшие
силы и способности в интересной и содержательной работе,
оплачиваемой в соответствии с затраченными усилиями. Такие
проблемы современных образовательных учреждений как
низкий престиж профессии и низкая закрепляемость учителей
по месту работы, являются важной предпосылкой для
целостного изучения этой социальной группы.
Статусно-ролевое положение учительства обусловлено
влиянием различных условий и факторов, отражающих
региональные особенности. В общеобразовательных школах
многих субъектов РФ ежегодно уменьшается количество
молодых преподавателей. При этом процент педагогов
пенсионного возраста является основным составом. Возросла
феминизированность педагогических коллективов. Как только
профессия становится менее доходной, оттуда идёт отток
мужской рабочей силы [3; с. 198]. На примере молодых
специалистов наблюдается рост миграции из сельских школ в
города и пригородные районы. И если ранее это происходило
из-за тяги молодёжи к проживанию и работе в более крупных
городах, то теперь процесс укрупнения и «оптимизации»
множества
школ
«работает»
в
этом
направлении.
Следовательно, происходят сокращения педагогических кадров,
пополняются ряды безработных, и, что современно, растёт
количество учителей работающих не по специальности. На
сегодняшний день проблем и противоречий в отечественной
образовательной системе накопилось немало, но актуальность
занятости выпускников педагогических вузов и молодых
специалистов сегодня является животрепещущей темой. Сейчас
155
около трети молодых людей не могут найти работу. Данная
проблема в России стоит очень остро и требует системных
изменений, т.к., у нас практически не налажен механизм
адаптации молодёжи на рынке труда. У молодых людей
слишком завышены ожидания. А работодатели совершенно не
спешат брать на работу человека без опыта. Данная проблема
провоцирует «эффект потерянного поколения». Поэтому
важнейшим элементом современной социальной экономики
должно стать управление занятостью молодёжи, которое будет
органично сочетаться с механизмами государственного
регулирования и саморегуляции. Существенную роль здесь
играют целевые программы различных уровней, способные
оказывать содействие созданию экономических, правовых,
организационных условий для социального становления и
развития молодого поколения России. Программы должны
разрабатываться на уровне глав администраций городов, глав
администраций сельских поселений, мэров городов и
утверждаться всенародно выбранными Советами депутатов.
Стратегия государственной молодежной политики
утверждена распоряжением
Председателя
Правительства
Российской Федерации М.Фрадковым от 18 декабря 2006 г. на
период до 2016 года N 1760-р и определяет совокупность
приоритетных направлений, ориентированных на молодежь,
включающих задачи, связанные с участием молодежи в
реализации приоритетных национальных проектов. Целью
государственной молодежной политики является развитие и
реализация потенциала молодежи в интересах России [4].
В соответствии с Концепцией долгосрочного социальноэкономического развития Российской Федерации на период до
2020 года, утвержденной распоряжением Правительства
Российской Федерации от 17 ноября 2008 г. N 1662-р,
стратегической
целью
является
достижение
уровня
экономического и социального развития, соответствующего
статусу России как ведущей мировой державы XXI века,
занимающей передовые позиции в глобальной экономической
конкуренции и надежно обеспечивающей национальную
безопасность и реализацию конституционных прав граждан.
156
При этом стратегической целью государственной политики в
области образования является повышение доступности
качественного образования, соответствующего современным
потребностям общества и каждого гражданина. Программа
представляет собой комплекс различных мероприятий,
направленных на достижение конкретной цели и решение задач,
стоящих перед российским образованием в 2011 - 2015 годах
[6].
В целях реализации потенциала молодежи вступил в силу
Федеральный закон о государственной молодежной политике в
Российской Федерации устанавливающий общие принципы
правовых, организационных, экономических и социальных
основ деятельности [7].
С 1 сентября 2013 года вступает в силу новый базовый
Федеральный закон от 29.12.2012 N 273-ФЗ «Об образовании в
Российской Федерации», который разработан в целях
совершенствования законодательства РФ в области образования
и является основополагающим нормативным правовым актом в
сфере образования[8]. Об этом, а также о преподавании
основных дисциплин, модернизации и компьютеризации школ,
и, в частности, о заработной плате учителей шла речь на
совещании в Кремле 06.06.2013г. и о многих других проблемах
школьного образования. Министр образования Д. Ливанов
сообщил о повышении заработной платы учителям в 13
субъектах РФ, небольшом отставании в 34 субъектах РФ.
Президент Путин В.В. сказал о том, что вопрос по зарплате
учителей должен быть закрыт в 2013 году. Министр
образования пообещал, что заработные платы учителей будут
доведены до среднего уровня по экономике во всех регионах.
Далее Владимир Владимирович говорил о детях родителей,
работающих в металлургии, на авиационных заводах, людях
рабочих профессий, которые хотят получить достойное
образование, получить свою путёвку в жизнь, о важности
будущего конкретного образованного человека, каждой семьи,
всей страны [9].
Подводя итог, надо сказать, что для преодоления
трудностей в вопросах труда молодых учителей необходимо
157
создать механизмы реализации таких жизненных перспектив,
как улучшение условий труда, комфортных жилищных условий,
достойного уровня материального положения и многое другое.
Над выполнением важной социальной роли в повышении
престижности учительского труда постоянно работает
профессиональное сообщество педагогов. И, конечно, надёжной
опорой государства и гражданского общества в достижении
целей общего образования и повышения его качества должны
стать ассоциативные объединения опытных и начинающих свой
трудовой путь преподавателей.
В заключении хотелось бы отметить, что исследование
проблемы занятости молодых учителей в условиях постоянных
преобразований в трудовой сфере необходимо для изучения и
знания ситуации в современной России.
Литература
1. Общество,
культура,
личность:
материалы Международной заочной научнопрактической конференции. 5 февраля 2013г. –
Прага: «Sociosfera-CZ», 2013. -221с.
2. Инновации и традиции современной школы: матери
алы Международной
3. заочной научно-практической конференции.
29 мая 2010г./Отв. ред.
4. М.В. Волкова Чебоксары: НИИ педагогики и психологии
, 2010.-204с.
5. Красова
Е.Ю.
Мозаика
социологических
исследований (региональная вопросно-ответная
коммуникация) / Е.Ю. Красова// – Воронеж:
Факультет журналистики, 2009. С. 198.
6. http://www.newparlament.ru/docs/view/2138
(дата
обращения 03.06.2013)
7. http://www.bestpravo.ru/federalnoje/hjgosudarstvo/m1w.htm (дата обращения 05.06.2013)
158
8. Постановление Правительства РФ от 07.02.2011 N
61(ред. от 20.12.2011) «О Федеральной целевой
программе развития образования на 2011 - 2015 годы».
9. http://www.consultant.ru/law/review/fed/fd2013-01-08.html;
Федеральный закон от 29.12.2012N273-ФЗ "Об
образовании
в
Российской
Федерации"
(дата
обращения 05.06.2013)
10. http://www.rg.ru/2012/12/30/obrazovanie-dok.html (дата
обращения 03.06.2013).
11. http://www.videokub.com/videos/2853/programma-vremya06-06-2013-pervyy-kanal/ (дата обращения 06.06.2013)
159
Секция 12. Экология
ИССЛЕДОВАНИЕ ДИНАМИКИ ХИМИЧЕСКОГО
ЗАГРЯЗНЕНИЯ ВОДНЫХ ОБЪЕКТОВ,
РАСПОЛОЖЕННЫХ ВБЛИЗИ Г. КАРАБАШ
ЧЕЛЯБИНСКОЙ ОБЛАСТИ
Т. Г. Князева1, И. В. Синявский2
Центр государственного санитарно-эпидемиологического надзора
Федерального казенного учреждения здравоохранения
«Медико-санитарная часть Министерства внутренних дел России
по Челябинской области», г. Челябинск, Россия
[email protected]
2
Д. б. н, Институт агроэкологии ( филиал Челябинской
агроинженерной академии), с. Миасское Челябинской области, Россия
1
Техногенное загрязнение биосферы - одна из главных
тенденций современных изменений в экологической среде
планет [1]. На протяжении последних десятилетий повышается
антропогенное воздействие на окружающую среду. Результатом
данного воздействия является химическое загрязнение
атмосферного воздуха, почвы, воды токсическими веществами.
В Федеральном законе Российской Федерации № 52-ФЗ
«О санитарно – эпидемиологическом благополучии населения»
в п. 1. ст. 18. сказано: «Водные объекты, используемые в целях
питьевого и хозяйственно-бытового водоснабжения, а также в
лечебных, оздоровительных и рекреационных целях, в том
числе водные объекты, расположенные в границах городских и
сельских населенных пунктов (далее - водные объекты), не
должны являться источниками биологических, химических и
физических факторов вредного воздействия на человека». [3].
Водные объекты Уральского федерального округа
характеризуются высоким уровнем загрязненности воды.
Наиболее загрязнены водные объекты на территории
Свердловской, Челябинской, Курганской областей и ЯмалоНенецкого АО, где не только высок процент пунктов,
характеризуемых качеством воды 4-го класса, разрядов "а", "б",
160
"в" и "г", но есть отдельные водные объекты, оцениваемые как
"экстремально грязные"; количество таких створов в 2010 г.
составляло соответственно 61,9 % и 3,6 % в Свердловской
области; 50,9 % и 3,7 % в Челябинской области; 93,5 % и 6,5 % в
Курганской [2].
На Южном Урале имеется много городов, в черте которых
протекают небольшие реки, являющиеся притоками крупных
магистральных рек. Русла этих малых рек пересекают жилые и
промышленные районы городов в различных направлениях и
являются, с экологической точки зрения, опасными зонами во
всех отношениях.
Челябинская область является крупным промышленным
регионом Южного Урала. В городах области развито
промышленное производство черной и цветной металлургии,
электроэнергетика, машиностроение, стройиндустрия и др.
Город Карабаш Челябинской области известен как база
меднорудной
промышленности,
центр
современного
медеплавильного производства. На его территории сложилась
искусственная
биогеохимическая
провинция,
основным
отличительным признаком которой является высокая степень
загрязнения атмосферного воздуха, почвы солями тяжелых
металлов.
Карабашский медеплавильный комбинат поставляет в
окружающую среду газообразные, твердые и жидкие отходы.
Наряду с диоксидом серы, пылью, другими составляющими
атмосферных выбросов, сбросами в речную систему
неочищенных производственных, рудничных, бытовых сточных
вод деятельность комбината привела к интенсивному
загрязнению почв, водных объектов, донных отложений,
атмосферы
токсичными
веществами
в
масштабах,
представляющих угрозу для проживающего здесь населения, к
исчезновению лесов в ближайших к городу окрестностях,
деградации почвенного покрова.
В окрестностях города Карабаш располагаются реках СакЭлга и Аткус, Карабашский и Богородский пруды, Аргазинское
водохранилище.
Мониторинг
химического
загрязнения
проводился в период 2009 -2011гг.
161
Карабашский пруд создан на р.Серебрянке, расположен в
санитарно-защитной зоне ЗАО «Карабашмедь». Качественный
состав воды пруда формируется под влиянием промливневых
сточных вод ЗАО «Карабашмедь», поступления загрязняющих
веществ с водосборной площади, в результате вторичного
загрязнения водной толщи химическими веществами из донных
отложений, а также атмосферных выпадений. По химическому
составу вода пруда относилась к сульфатному классу, группе
кальция. Минерализация воды в период наблюдения была
средней 210–620 мг/л. Кислородный режим в поверхностном
слое
водоема
был
удовлетворительным:
содержание
растворенного в воде кислорода изменялось от 7,3 мг/л до 12,0
мг/л, насыщение воды кислородом составило 47-110% (норма
>80%). Среди биогенных компонентов отмечено превышение
предельно допустимых норм азота аммония, в среднем, в 1,5
раза, среди органических соединений – нефтепродуктов – в 1,6
раза, ХПК – в 1,2 раза. Вода Карабашского пруда значительно
загрязнена ионами тяжелых металлов: концентрации свинца и
кадмия находились на уровне высокого загрязнения (>3 ПДК),
меди, свинца и марганца - на уровне экстремально высокого
загрязнения (>50 ПДК). Всего за анализируемый период
отмечено 180 случаев высокого (ВЗ) и экстремально высокого
загрязнения (ЭВЗ) тяжелыми металлами.
Богородский пруд является зарегулированной частью
верхнего течения р.Сак-Элги, вода используется ЗАО
«Карабашмедь» на технологические нужды. Под влиянием
р.Серебрянки, впадающей в пруд с левого берега и являющейся
проводником загрязненных тяжелыми металлами вод
Карабашского пруда, в воде Богородского пруда отмечались
высокие и экстремально высокие уровни содержания меди,
цинка и марганца; за период наблюдений 2009-2011гг.
количество случаев ВЗ и ЭВЗ достигло 18. Основной вклад в
загрязнение воды вносит цинк ( от 20,0 до 80,0 мг/л).
Источниками загрязнения реки Сак-Элга являются кислые
водоемы, образованные на месте отработанной шахты
«Южная», Рыжий ручей, собирающий ливневые стоки с
производственной площади ЗАО «Карабашмедь» и горы
162
Золотой, пиритные отложения в речной пойме, дренаж
шламонакопителей и хозбытовые сточные воды г.Карабаша.
Загрязнению реки способствует и местный ландшафт: ложе
Соймоновской долины, где расположен город, имеет уклон в
сторону долины р.Сак-Элги.
В настоящее время река полностью утратила
рыбохозяйственное значение; перед впадением в р.Миасс она
представляет собой коллектор загрязненных сточных вод. Под
действием кислорода воздуха и атмосферных осадков при
участии микроорганизмов происходит окисление сульфидного
материала на поверхности шламового поля и смыв продуктов
окисления в р.Сак-Элгу и далее в северную часть Аргазинского
водохранилища. Загрязнение р.Сак-Элги происходит также
через дренаж со шламонакопителя, расположенного на правом
берегу реки на 1 км ниже впадения Рыжего ручья. За период
2009-2011 гг. зафиксировано 194случая высокого и
экстремально высокого загрязнения речной воды химическими
веществами; основную долю загрязнения вносят тяжелые
металлы. За исследуемый период содержание в воде ионов
тяжелых металлов варьировало: цинка – от 10 до 25135 ПДК,
меди – от 7 до 6290 ПДК, марганца – от 27 до 1532 ПДК, никеля
– от 1,9 до 33,7 ПДК, железа общего – от 2,0 до 307ПДК.
Концентрации тяжелых металлов достигали пиковых значений
преимущественно в летне-осенний период, когда высокие
температуры,
низкое
количество
дождевых
осадков
способствовали
уменьшению
водности
р.Сак-Элги
и
накоплению загрязняющих веществ, поступающих из
различных слоев почвенно-грунтовой толщи водосбора. Под
действием этих природных и техногенных факторов ежегодно в
период с июля по сентябрь, как правило, в реке возрастала
минерализация (максимальная – 1280 мг/л – в 2010 году) и
наблюдалось снижение водородного показателя до значений
3,0–4,5 единиц рН, что свидетельствовало о закислении воды в
летний период.
Река Сак-Элга оказывает негативное влияние на качество
р.Миасс. Наиболее заметно это прослеживается на
зарегулированном участке реки – Аргазинском водохранилище,
163
расположенном в 5 км северо-восточнее г.Карабаша. Основное
назначение – использование его в качестве резервного водоема
для обеспечения хозяйственно-питьевой водой г.Челябинска. В
период 2009–2011 гг. в верхнем бьефе водохранилища
отмечалось повышенное содержание в воде ионов тяжелых
металлов, содержание которых в отдельные годы достигало
уровня высокого загрязнения. Среднегодовая концентрация
меди возросла с 10 ПДК в 2009г. до 27 ПДК в 2005г, цинка – с
4,2 ПДК до 16,5 ПДК соответственно (уровень высокого
загрязнения медью >30 ПДК, цинком >10 ПДК). Среднегодовое
содержание марганца в 2011г. приблизилось к уровню высокого
загрязнения (ВЗ >30 ПДК) и составило 22,3 ПДК. Увеличилось
и количество случаев высокого загрязнения воды ионами
металлов с 3 в 2009г. до 7 в 2011г.
В приплотинной части Аргазинского водохранилища,
благодаря высокой самоочищающей способности, наблюдается
снижение содержания металлов до уровня природного фона:
меди и цинка – до 2-3 ПДК, марганца – до 6-7 ПДК.
Река Аткус берет начало из оз.Агардяш в 4 км севернее г.
Карабаша и впадает в Аргазинское водохранилище. На
расстоянии 2 км от устья в нее впадает р.Ольховка.
Качественный состав воды реки формируется под влиянием
загрязненных вод притока – р.Ольховки, на которой расположен
пруд –отстойник шахтных вод, а также поступления
загрязняющих веществ с водосборной площади, в значительной
степени загрязненной ионами тяжелых металлов. В течение
исследуемого периода концентрации в воде ионов тяжелых
металлов оставались повышенными и изменялись в пределах:
меди – 1,5-20 ПДК, цинка – 3,2-5,8 ПДК, марганца – 15-50 ПДК.
Таким образом, в результате антропогенного воздействия
по-прежнему сохраняется высокий и экстремально высокий
уровень химического загрязнения ионами металлов реки СакЭлги. Наибольший уровень экологической деградации и
глубоких необратимых изменений выявлен на участке р.СакЭлга после впадения Рыжего ручья до устья, который является
зоной бедствия. Прослеживается также отрицательное
воздействие р.Сак-Элги на качественный состав Аргазинского
164
водохранилища: его вода в верхнем створе (г.Карабаш) не
удовлетворяет требованиям нормативов для водоемов
рыбохозяйственного назначения по содержанию тяжелых
металлов.
Одной из самых острых и неотложных проблем
современности
является
совершенствование взаимоотношений человека с природой. В
комплексе мероприятий по снижению загрязнения окружающей
среды важное место должно занимать рациональное
использование
вод
и
охрана
водных
ресурсов.
И в настоящее время отчистка поймы реки Сак – Элга является
самой актуальной темой, с целью предотвращения попадания
тяжелых металлов и реагентов в реку Миасс.
Литература
1. Добровольский В.В. География микроэлементов. Глобальное
рассеяние./ М.: «Мысль», 1983-272с.
2. Качество поверхностных вод Российской Федерации.
Информация о наиболее загрязненных водных объектах
Российской Федерации (приложение к Ежегоднику за 2010 г.)/
Под редакцией члена-корреспондента РАН А.М Никанорова Ростов-на-Дону,2011-132с.
3. Федеральный закон РФ № 52-ФЗ « О санитарноэпидемиологическом благополучии населения» от 30.03.1999г.,/
М., 1999г.
165
Скачать