МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ
ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ
УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ
«БАШКИРСКИЙ ГОСУДАРСТВЕННЫЙ АГРАРНЫЙ УНИВЕРСИТЕТ»
СОВРЕМЕННЫЕ ОСНОВЫ
РАЦИОНАЛИЗАЦИИ
ТЕХНОЛОГИИ ВОСПРОИЗВОДСТВА
СЕЛЬСКОХОЗЯЙСТВЕННЫХ ЖИВОТНЫХ
В УСЛОВИЯХ ИНДУСТРИАЛЬНОЙ
СИСТЕМЫ ПРОИЗВОДСТВА В АПК
Материалы
всероссийской молодежной научной школы
в рамках Федеральной целевой программы
«Научные и научно-педагогические кадры
инновационной России» на 2009-2013 годы
(Уфа, Россия, 11-14 сентября 2012 г.)
Уфа
Башкирский ГАУ
2012
УДК 636
ББК 45/46
С 56
Ответственный за выпуск:
канд. с.-х. наук, доцент,
проректор по научной и инновационной деятельности
ФГБОУ ВПО Башкирский ГАУ И.Г. Асылбаев
Редакционная коллегия:
канд.с.-х.н., доцент Ф.Р. Валитов
д-р с.-х.н., профессор Р.Р. Султанова
канд.с.-х.н., доцент Л.В.Герасимова
канд.с.-х.н., ассистент А.Г. Ильясов
С 56
Современные основы рационализации технологии воспроизводства сельскохозяйственных животных в условиях индустриальной
системы производства в АПК. Материалы всероссийской молодежной
научной школы в рамках Федеральной целевой программы «Научные и
научно-педагогические кадры инновационной России» на 2009-2013 годы
(Уфа, Россия, 11-14 сентября 2012 г.). – Уфа: Башкирский ГАУ, 2012. –
216 с.
ISBN 978-5-7456-0314-3
В сборнике опубликованы доклады выступлений участников всероссийской молодежной научной школы «Современные основы рационализации технологии воспроизводства сельскохозяйственных животных в условиях индустриальной системы
производства в АПК» в рамках Федеральной целевой программы «Научные и научнопедагогические кадры инновационной России» на 2009-2013 годы.
Материалы сборника посвящены актуальным проблемам научных исследований
в области биотехнологии, современных проблем ветеринарного акушерства и биотехники репродукции животных, совершенствованию воспроизводства и селекции сельскохозяйственных животных.
Статьи приводятся в авторской редакции. Авторы опубликованных статей несут
ответственность за патентную чистоту, достоверность и точность приведенных фактов, цитат, экономико-статистических данных, собственных имен, географических
названий и прочих сведений, а также за разглашение данных, не подлежащих открытой публикации.
УДК 636
ББК 45/46
ISBN 978-5-7456-0314-3
© Башкирский ГАУ, 2012
УДК 619:636.1
СОСТОЯНИЕ И ПЕРСПЕКТИВЫ ТЕХНОЛОГИИ
ТРАНСПЛАНТАЦИИ ЭМБРИОНОВ В КОНЕВОДСТВЕ
Л.Ф.Лебедева
ГНУ Всероссийский научно-исследовательский
институт коневодства, г. Рязань
Технология трансплантации эмбрионов лошадей начала развиваться в начале 70-х годов прошлого столетия. Метод трансплантации эмбрионов позволяет получать по 10 и более жеребят в год от
одной ценной племенной кобылы; а также от выдающихся спортивных кобыл без выключения их из режима соревнований, либо от ценных кобыл, способных к зачатию, но по разным причинам не способных выносить плод. Эмбрионы можно перевозить в течение 1-2-х суток в специальных средах при температуре (+37)ºС или (+ 5)ºС с целью последующей пересадки, а также неопределенно долго хранить и
транспортировать их в замороженном виде в жидком азоте (-196ºС).
Жеребят-трансплантатов, родившихся от одной кобылы и разных жеребцов-производителей в ставке года можно испытывать в одной возрастной группе (экспресс-оценка жеребцов по качеству потомства).
Сущность метода сводится к тому, чтобы избавить ценную кобылу от 11-месячного процесса вынашивания плода и передать эту миссию суррогатной матери. Для этого из матки кобылы-донора нехирургическим методом извлекают 7-8-суточный эмбрион и пересаживают
его в матку синхронизированной по фазе полового цикла кобыле-реципиенту. В следующем половом цикле кобыла-донор снова будет готова к зачатию и очередной процедуре трансплантации эмбриона.
Таким образом, удается более эффективно работать с маточными
семействами и тиражировать удачные сочетания подобранных пар,
способствуя селекционному прогрессу. Современные технологии
предусматривают работу со свежими, охлажденными и замороженными эмбрионами. Процент приживляемости свежих и охлажденных
эмбрионов несколько выше, чем замороженных (70-85% против 5560% [1].
В настоящее время ведущее положение в области трансплантации эмбрионов занимают США, Аргентина и Бразилия. К странам,
использующим эмбриопересадки в коневодстве в меньших масштабах, относятся Австралия, Канада и большинство европейских государств, в частности Австрия, Франция, Италия, Греция, Финляндия,
Швеция, Дания, Германия, Венгрия.
В сравнении с другими отраслями животноводства, особенно со
скотоводством, где индустрия трансплантации эмбрионов располагает сетью криобанков, в которых хранятся зародыши с определенным
происхождением и полом, наша отрасль сильно отстает и сопоставима с козоводством (Таблица 1).
Таблица 1 Статистика пересадок эмбрионов сельскохозяйственных животных в странах Европы по годам [2]
Год
Количество эмбрионов (получено/пересажено)
Лошади
КРС
овцы
свиньи
козы
1999
222/194
170451/143168 6744/6330
3995/534 303/176
2000
563/226
151525/119769
847/440
816/619 243/145
2001
309/260
122725/107342/
613/441
302/184 198/103
2002
115/74
114080/102176
501/398
1338/995 76/53
2003
413/344
116907/98918
326/167
1221/816 61/52
2004
446*/387
110148/98130
99/70
389/387
2005
509*/711
115178/93034
83/61
271/192 160/76
2006
2007
428*/884 (IVP**- 12) 106857/95030
292
110/105
123739/108841
138/212
621/32 134/128
2008
1043/1014 (IVP-48) 123176/101149
419/375
736/28
83/75
2009
1024*/1037 (IVP-69) 114148/100678
197/143
716/20
-
273/476
-
-
2010
764/622 (IVP-32)
161/196
41/41
289/123
109646/114976
*некоторые страны не представили данные
** эмбрионы получены методом искусственного оплодотворения
(IVP- In Vitro Production)
- нет данных
Данные таблицы 1 наглядно демонстрируют наращивание темпов
использования технологии эмбриотрансплантации в европейском коневодстве, за исключением 2010 года, очевидно отражающего последствия мирового экономического кризиса. В скотоводстве, напротив, бурный всплеск интереса к новым репродуктивным технологиям
на рубеже ХХ-ХХI веков постепенно сменяется стабильным уровнем
использования метода эмбриопересадок в рутинной практике воспроизводства. Следует уточнить, что в массе ежегодно трансплантируемых в Европе эмбрионов КРС, примерно, 50-60% составляют замо-
роженные эмбрионы и 5-10% - эмбрионы, полученные методом искусственного оплодотворения (IVP- In Vitro Production). В европейском коневодстве сообщения о пересадках эмбрионов «из пробирки»
появляются лишь с 2006 года.
Причин такого положения дел в коневодстве несколько. Проблема вызова суперовуляции у кобыл выражается в дефиците эмбрионов
для работы (например, у коров после гормональной обработки можно
в одном половом цикле извлечь до 30 эмбрионов, а у кобыл, в силу
физиологических особенностей, лишь 1-2 эмбриона [3]. Продолжительная охота и непредсказуемость сроков овуляции создают проблемы синхронизации половых циклов донора и реципиента. Процедура извлечения и пересадки эмбрионов требует высокой квалификации исполнителей и существенных материальных затрат (средняя
стоимость эмбриопересадки в Америке сегодня составляет от 2000$
до 5000 $). Но главная причина состоит в системе ограничений (арабская, американская стандартбредная порода и др.) и запретов (английская чистокровная верховая порода, Palomino Ponies, American
Suffolk Horse и др.) некоторых породных регистров/ассоциаций на
выдачу племенных документов для жеребят-трансплантатов. Тем не
менее, большинство Советов ведущих спортивных, рысистых и выставочных пород мира допускают жеребят-трансплантатов к записи в
племенные книги. В их числе тракененские, голштинские, ахалтекинские, практически все «теплокровные» западноевропейские лошади.
Под натиском научно-технического прогресса, передовых технологий
и здравого смысла консерваторы постепенно сдают свои позиции и
включают эмбриопересадки в селекционные программы разведения
лошадей. В России первый жеребенок-трансплантат родился в феврале 1982 года в лаборатории физиологии размножения лошадей ВНИИ
коневодства [4]. Автором отечественной технологии эмбриопересадки С.Г.Лебедевым было получено около 40 жеребят-трансплантатов.
После научно-исследовательского «застоя» и экономического кризиса времен перестройки сотрудники лаборатории продолжили изыскания в области трансплантации эмбрионов лошадей. В числе последних разработок: методы культивирования in vitro и криоконсервации
ранних (6-8 суток) эмбрионов, нехирургического извлечения эмбрионов предимплантационных стадий (вплоть до 40-х суток развития).
Проведены фундаментальные исследования в области раннего эмбриогенеза лошадей на основе гистологии и электронной микроскопии. Начата работа по выделению и исследованию регенерационных
возможностей эмбриональных стволовых клеток лошадей. В последнее время оживляется интерес коневладельцев к эмбриотрансплантации, растет квалификация российских специалистов. Эта тенденция
обнадеживает и внушает надежду на дальнейшее развитие отечественной коневодческой науки и практики.
Литература:
1.Squires, EL, McCue, PM and Vanderwall, D (1999) The current status of equine embryo transfer. Theriogenology 51 91-110
2. www.aete.eu/publications
3. Niswender, KD, Alvarenga, MA, McCue, PM, Hardy, QP and
Squires EL (2003) Superovulation in cycling mares using equine follicle
stimulating hormone (eFSH). J Equine Vet Sci 23 487-500
4.Лебедев, С.Г. Трансплантация эмбрионов лошадей [Текст]
//Дисс. на соиск. уч. ст. д.б.н. ВНИИК. Дивово,1994.
УДК 636.52/58.082.2
АЛЛЕЛЬНЫЕ ВАРИАНТЫ ГЕНОВ, КОНТРОЛИРУЮЩИХ
ХОЗЯЙСТВЕННО-ПОЛЕЗНЫЕ ПРИЗНАКИ
У КУР ГЕНОФОНДНЫХ ПОРОД
В.П. Терлецкий, Д.О. Доронин, В.И. Тыщенко, А.Б. Вахрамеев
ГНУ Всероссийский научно-исследовательский институт
генетики и разведения сельскохозяйственных животных,
г. Санкт-Петербург-Пушкин
Хозяйственно-полезные признаки контролируются многими генами, полиморфизм которых можно изучить, используя метод полимеразной цепной реакции (ПЦР). Цель наших исследований заключалась в выявлении генетической изменчивости по аллельным вариантам кур 10-ти генофондных пород с использованием двух генов – интрона 2 гена гормона роста (GHR) и гена инсулиноподобного фактора
роста (IGF-1).
Известно, что эти гены связаны со скоростью роста у птиц и млекопитающих [1,2]. Кроме того, есть данные, что продукт гена инсулиноподобного фактора роста связан с воспроизводительными качествами кур [3]. Материалом исследования служили образцы крови,
взятой из подкрыльцовой вены кур 10-ти пород и экспериментальных
популяций (по 12 образцов в каждой группе). ДНК из крови выделяли
по общепринятым методикам.
Следующим этапом работы была амплификация последовательностей ДНК в интроне 2 гена гормона роста (GHR) и гена инсулиноподобного фактора роста (IGF-1). Последовательность нуклеотидов
праймеров и некоторая другая информация представлена в таблице 1.
Праймеры подбирались с таким расчетом, чтобы продукт амплификации имел сайт рестрикции для ферментов HindIII и PstI для генов
GHR и IGF-1, соответственно [4].
Таблица 1 Последовательности праймеров для амплификации интрона 2 гена гормона роста (праймеры 1 и 2) и гена инсулиноподобного фактора роста (праймеры 3 и 4)
Праймер
5'-3'
1) прямой
GGCTCTCCATGGGTATTAGGA
2) обратный
GCTGGTGAACCAATCTCGGTT
3) прямой
GACTATACAGAAAGAACCCAC
4) обратный
TATCACTCAAGTGGCTCAAGT
ПЦРпродукт
рестриктаза
718 п.н.
HindIII
621 п.н.
PstI
После синтеза отобранных праймеров нами были подобраны оптимальные условия проведения полимеразной цепной реакции (ПЦР)
с этими праймерами. Реакцию проводили в 25 мкл реакционной смеси, содержащей 67 мМ трис -HCl pH 8,6 - 2,5 мM MgCl2 - 16,6 мM
NH4OH - 0,125 мМ каждого из дезоксирибонуклеотидтрифосфатов
(dATP, dGTP, dCTP, dTTP) -0,5 мкМ праймера - 50-100 нг геномной
ДНК и 2,5 ед Taq-полимеразы ("Силекс М", Москва или ООО "Биолаб", Санкт-Петербург). Реакцию проводили на амплификаторе "Терцик". Использовали режим, состоящий из 35 циклов: 30 сек - 94˚С, 1
мин 37˚С, 1 мин - 72˚С.
В качестве способа выявления аллельных вариантов был использован метод ПЦР-ПДРФ, когда продукт специфической амплификации подвергался расщеплению ферментом рестрикции. Наличие или
отсутствие сайта расщепления определяет размер фрагмента ДНК. В
пробирку помещали 25 мкл амплификата непосредственно в ПЦРбуфере, добавляли 0,5 мкл рестриктазы HindIII/PstI, перемешивали и
ставили инкубировать на 3 часа при 37оC.
После завершения расщепления ДНК ферментами рестрикции
проводили электрофорез. Для электрофореза использовали 0,8% агарозные гели, содержащие флуоресцентный краситель бромистый этидий. Электрофорез проводили в течение 1 часа при рабочем напряжении 150 В. В качестве маркера, позволяющего оценить длину фрагментов ДНК на геле использовали фрагменты ДНК FastRuler Middle
Range (размер фрагментов 100 п.н - 5000 п.н.). После расщепления
продуктов амплификации ферментом HindIII/PstI и разделения полученных фрагментов ДНК в агарозном геле, флуоресцентный сигнал
фотографировали в системе гель-документации фирмы Bio-Rad. Амплификация гена и расщепление фрагмента ДНК приводит к выявлению аллельных вариантов генов, как в гомозиготном, так и в гетерозиготном состоянии (рисунок 1).
М
1
2
3
4
5
6
7
8
9
10
11
12
Рисунок 1 Результаты рестрикции (фермент PstI) ДНК Царскосельской породы кур по гену IGF-1. (М-маркер, № 2 и 8 – гомозиготный генотип С1С1, № 3 и 11 – гетерозиготный генотип С1С2,
№ 1,4,5,6,7,9,10,12 – гомозиготный генотип С2С2).
Метод ПЦР-ПДРФ, использованный на 10 породах и популяциях
кур (Голошейная, Пушкинская, Фавероль, Аврора, Род-Айланд, Орловская, Царскосельская, Кохинхин, Узбекская бойцовая, Брама) по
интрону гена GHR не выявил достоверных различий по частотам
встречаемости аллельных вариантов. В то же время, анализ образцов
ДНК по аллелям гена IGF-1, проведенный на 7 генофондных породах
кур показал наличие достоверных различий между породами (таб. 2).
Таблица 2 Генотипы 7 пород и популяций кур, выявляемые методом
ПЦР-ПДРФ по гену IGF-1 (12 голов в каждой группе).
Название породы/популяции
Голошейная
Пушкинская
Фавероль
Аврора
Род-Айланд
Орловская
Царскосельская
Количество
генотипов
С1С1
3
0
2
3
0
0
2
Количество генотипов
С 2С 2
6
8
5
8
12
11
8
Количество
генотипов
С1С2
3
4
5
1
0
1
2
Были обнаружены гомозиготные варианты организации этого гена С1С1 (621 п.н., отсутствие рестрикции) и С2С2 (257 и 364 п.н.), а
также гетерозиготный вариант С1С2 с длинами фрагментов ( 257, 364
и 621 п.н. )
Таким образом, метод ПЦР-ПДРФ можно использовать для выявления аллельных вариантов гена инсулиноподобного фактора роста
в генофондных породах и популяциях кур с целью их генетической
характеристики
Литература:
1. C. Beccavin, B. Chevalier, L.A. Cogburn, J. Simon, M.J. Duelos.
Insulin-like growth factors and body growth in chickens divergently selected for high or low growth rates. J. Endocrinol., 2001, v. 168, p. 297306.
2. Feng, X.P, Kuhnlein, U., Aggrey, S.E., Gavora, J.S., Zadworny, D.
Trait association of genetic markers in the growth hormone and the growth
hormone receptor gene in a White Leghorn strain. Poult. Sci., 1997, v76,
p.1770-1775.
3. E. Decuypere, L.M. Huybrechts, E. Kuhn, M. Tixier-Boichard, P.
Merat. Physiological alterations with the chicken sex-linked dwarfing
gene. Crit.Rev.Poult.Biol., 1991, v.3, p.191-221.
4. H.F.Li, W.Zhu, K.W.Chen, X. Wu, Q.P. Tang, Y. Gao. Associations between GHR and IGF-1 Gene Polymorphisms, and Reproductive
Traits in Wenchang Chickens. Turk.J.Vet.Anim.Sci., 2008, v. 32, p.281285.
УДК 619:616.5:636.1
ВЫЯВЛЕНИЕ МИКОПЛАЗМЕННОЙ ИНФЕКЦИИ
У ЛОШАДЕЙ МЕТОДОМ ПОЛИМЕРАЗНОЙ
ЦЕПНОЙ РЕАКЦИИ
В.П. Терлецкий, А.А. Крутикова, Е.В. Никиткина,
Д.О. Доронин, В.И. Тыщенко
ГНУ Всероссийский научно-исследовательский институт
генетики и разведения сельскохозяйственных животных,
г. Санкт-Петербург-Пушкин
Снижение репродуктивных качеств у животных, в том числе лошадей, сейчас становится все более актуальной проблемой. Связано
это с тем, что у племенных животных значительные ресурсы организма отвлекаются на формирование селектируемых признаков, в то
время как защитные свойства иммунной системы ослабляются.
Условно-патогенные микроорганизмы получают шанс не просто на
выживание, но и на активный рост, который сопровождается накоплением продуктов их жизнедеятельности.
Эти продукты вместе с бактериальными токсинами изменяют
свойства слизистых оболочек половых путей, что сказывается на репродуктивных качествах животных.
Вступая в синергические отношения с вирусной, бактериальной и
условно-патогенной микрофлорой, микоплазмы создают условия для
ее активного роста и развития, что усиливает тяжесть течения данного заболевания [1,2,3]. Особенностью организма микоплазм является
чрезвычайно малый физический размер (до 1 микрометра) и малый
размер генома [4].
Биологические свойства микроорганизмов, обитающих в половых путях таковы, что инфекцию трудно выявить на ранних стадиях
заболевания, в связи с тем, что она протекает бессимптомно. Даже в
случае появления симптомов, доказать природу вызывающих их патогенов классическими методами крайне затруднительно, так как
многие инфекции протекают со сходными симптомами.
Ранние сроки выявления возбудителя означают более высокую
эффективность лечения. Молекулярно-генетический метод полимеразной цепной реакции (ПЦР), в отличие от многих других методов,
способен выявлять ничтожно малое число бактериальных клеток (несколько десятков микробных клеток в 1 мл биологического материала) на ранних сроках развития инфекции. Своевременное выявление
животных-носителей инфекции позволяет более эффективно проводить лечебные и профилактические мероприятия, направленные на
повышении репродуктивной функции у животных и лечения бесплодия. Данный метод хорошо зарекомендовал себя в медицине. В последние годы метод ПЦР, включая ПЦР в реальном времени (realtime PCR) активно начинает использоваться и в ветеринарной практике [5]. За рубежом метод ПЦР давно уже стал стандартным в практике животноводства.
Цель исследования состояла в выяснении распространенности
микоплазменной инфекции в группе лошадей. Исследуемый материал
отбирали у племенных лошадей ФХ Маланичевых и ООО «Ковбой».
Слизь из половых путей самок собирали в пробирки и замораживали
до использования. ДНК выделяли согласно инструкции к набору
«Мик-Ком» ФГУН ЦНИИЭ Роспотребнадзора.
В пробирки с лизирующим раствором вносим 100 мкл пробы.
Образец тщательно перемешиваем на вортексе и прогреваем 5 мин
при температуре 65˚С. Центрифугируем 5 секунд при 5000 об/мин на
микроцентрифуге. В каждую пробирку затем вносим 25 мкл универсального сорбента. Перемешиваем на вортексе, оставляем инкубироваться 2 минуты, затем еще раз перемешиваем на вортексе, инкубируем дополнительно 5 минут. Осаждаем сорбент центрифугированием при 5000 об/мин в течение 30 секунд. Удаляем надосадочную
жидкость, затем вносим по 300 мкл раствора для отмывки №1. Перемешиваем на вортексе, осаждаем сорбент центрифугированием, удаляем надосадочную жидкость. Вносим 500 мкл раствора для отмывки
№2, перемешиваем на вортексе, центрифугируем, удаляем надосадочную жидкость. Повторяем процедуру отмывки с использованием
раствора для отмывки №2. Подсушиваем сорбент универсальный после удаления надосадочной жидкости в термостате при 65˚ градусах
по Цельсию в течение 5-10 минут. В пробирки вносим по 50 мкл ТЕбуфера для элюции ДНК. Перемешиваем на вортексе, инкубируем в
термостате при 65˚С в течение 5 минут с периодическим встряхиванием. При этом ДНК отделяется от сорбирующих шариков и переходит в раствор. Центрифугируем пробирки на максимальных оборотах
микроцентрифуги в течение 1 минуты. Надосадочная жидкость содержит очищенную ДНК, которая в последующем используется в реакции ПЦР.
1
2
3
4
5
6
7
М
8
9
10 11 12 13 М
14
15
ПК
509 п.о.
Рисунок 1 Электрофореграмма продуктов полимеразной цепной реакции на выявление носительства микоплазменной инфекции у 15
лошадей ФХ «Маланичевых» (1- Бессарабия, 2-Альянс, 3-Баллада,
4-Дельба, 5-Варвара, 6-Румба, 7-Графита, 8-Улыбка) и ООО «Ковбой» (9-Пихта, 10-Дзинтари, 11-Капля, 12-Малахия, 13-Лия, 14-Хибара, 15-Лолита). ПК – положительный контроль. М – маркер. Наличие
полосы на уровне полосы у положительного контроля (509 пар оснований ДНК, указано стрелкой) означает присутствие микоплазменной
ДНК в образце
ПЦР проводим в объеме 25 мкл. Используя прилагаемые к набору «Мик-Ком» пробирки, вносим на поверхность воска 10 мкл ПЦРсмеси-2 blue. Сверху прибавляем 1 каплю стерильного минерального
масла. Затем вносим по 10 мкл выделенной ДНК и ставим пробирки
вместе с положительным и отрицательным контролями в термоциклер. Условия проведения ПЦР описаны в инструкции к набору. После
окончания ПЦР пробы отбирались из нижней фазы и вносились в
лунки 2% агарозного геля, содержащего флуоресцентный краситель
бромистый этидий. Выявление продуктов амплификации проводили
после 30 минутного электрофореза при напряжении 150 вольт (Рисунок 1).
Ранее нами было проведено тестирование 30 голов коров из племенных хозяйств Ленинградской области, которое показало наличие
микоплазм во всех образцах. В отличие от коров, микоплазменная
инфекция была выявлена не у всех лошадей. Не обнаружена микоплазма у кобылы, которая ни разу не была в случке и искусственном
осеменении, и у трех кобыл, регулярно приносящих жеребят. Почти
все кобылы, у которых выявлена микоплазма, имеют проблемы с
воспроизводством: низкая зажеребляемость, особенно у кобыл Дзинтари и Бессарабии, у Хибары – аборт на позднем сроке жеребости, у
Пихты – эндометрит. Исключение составляет только Румба, которая
регулярно приносит жеребят. Скорое всего это связано с хорошим
иммунитетом этой кобылы, который подавляет микоплазму. Микоплазмоз может быть одной из причин низкого уровня воспроизводства у лошадей.
Таким образом, молекулярно-генетический метод выявления микоплазменной инфекции позволяет достоверно выявить инфицированных животных. На примере лошадей прослеживается четкая связь
между микоплазмозом и репродуктивными качествами кобыл.
Литература:
1. Прозоровский, С.В.и др. Персистенция микоплазм в инфицированном организме: наблюдения, причины и механизмы, диагностика. [Текст]:// ЖМЭИ.-1997.-№4.-С. 47-51.
2. Андреев, Е.В. Смешанная вирусомикоплазменная инфекция
[Текст] / Е.В.Андреев,П.П/ Фукс //Ветеринария.- 1980.- №8.-C. 30 -32.
3. Шкиль, Н. Н. Эпизоотологические и иммунологические аспекты микоплазмоза телят во взаимосвязи с бруцеллезом и другими инфекциями [Текст]: Автореф. дис…. канд. ветеринар. Наук. - Новосибирск, 2000.- 23 с.
4. Маркина, О.С. Сравнительное изучение геномов микоплазм,
инфицирующих рогатый скот [Текст]: Автореф. дис…. канд. ветеринар. наук.// Казань, 1995. -22 с.
5. Bashiruddin, J.B., Frey J., Konigsson M.N. Evaluation of PCR systems for the identification and differentiation of Mycoplasma agalactiae
and Mycoplasma bovis: a collaborative trial // Vet. J.- 2005.-v. 169.-P.
268-343.
УДК 636.1.082.2
ИСПОЛЬЗОВАНИЕ ГЕНЕТИЧЕСКИХ МАРКЕРОВ
В СЕЛЕКЦИИ ЛОШАДЕЙ
д.с.-х.н. Л.А. Храброва
ГНУ ВНИИ коневодства Россельхозакадемии, г.Рязань
Современные генетические подходы к совершенствованию пород
основаны на более полной оценке генотипа животных и генетического разнообразия популяций с помощью разных маркерных технологий, включая контроль происхождения, маркер-вспомогательную селекцию и интрогрессию (межвидовой перенос генов). Использование
маркерных генов для генетической экспертизы происхождения лошадей уже вошло в практику коннозаводства многих стран и стало обязательным элементом племенной работы с заводскими породами лошадей [1]. На сегодня наиболее актуальной задачей является изучение возможностей использования маркер-вспомогательной селекции
и внедрения результатов научных исследований в коневодческую
практику.
Благодаря успешному завершению международного проекта по
изучению генома лошади, уже изучена структура всех хромосом и
известна локализация многих сотен генов, участвующих в сложных
биохимических реакциях. С помощью ДНК-технологий были выявлены мутантные гены, вызывающие у лошадей серьезные наследственные заболевания, такие как саркомы, комбинированный иммунодефицит (SCID), церебральная атрофия (СА), гиперкалиемический
паралич (HYPP) и многие другие. Общее число определяемых у лошадей маркерных генов уже превысило несколько десятков, что позволяет надежно контролировать значительную часть ее генома. Более
того, систематическое тестирование всего поголовья лошадей заводских и местных пород создает реальную основу для внедрения генетического мониторинга и других методов маркерной селекции в
практику коневодства. Связь между аллельными генами и селекционируемыми признаками животных теоретически возможна через разные генетические механизмы, включая детерминацию структурных
генов и их плейотропное действие на формирование хозяйственнополезных признаков. Данные модельного анализа свидетельствуют,
что отбор животных по генетическим маркерам эффективен даже при
отсутствии плейотропии и сцепления. Такие корреляции могут быть
постоянными в ряде поколений, если они поддерживаются отбором,
подбором и закрепляются инбридингом. В любом случае даже временные связи маркерных генов с хозяйственно-полезными признаками могут быть использованы в племенной работе с конкретными популяциями животных. Важным следствием открытия полиморфизма
структурных генов и ДНК у сельскохозяйственных животных, в том
числе лошадей, явилась возможность оценки степени гетерозиготности как конкретной особи, так и родственной группы животных и
каждой популяции. Это очень важно для практической селекции, так
как, при интенсивной селекции такие признаки, как работоспособность, крепость конституции, приспособленность, выраженность типа
и экстерьера фенотипически проявляются при достаточно высоком
уровне гетерозиготности. Сохранение большого количества аллелей
даже у малочисленных пород указывает на существование механизмов, препятствующих сужению генетической изменчивости [3,4].
Обобщение литературных данных и результатов собственных исследований по изучению и использованию полиморфизма систем
крови и ДНК лошадей, проведенных у нас в стране и за рубежом, показывает, что основными направления использования маркерной селекции в коневодстве являются следующие:
 Изучение генетической структуры пород и популяций лошадей, включая оценку степени биоразнообразия и других популяционных характеристик;
 Оценка степени генетических различий, изучение происхождения и микроэволюции пород;
 Проведение генетического мониторинга в породах лошадей,
сохранение оригинальности и гетерогенности аллелофонда малочисленных пород;
 Совершенствование метода линейного разведения. Генетическая оценка степени дифференциации генеалогической структуры
породы, определение генетического сходства с родоначальником линии;
 Контроль использования родственного разведения, включая
мониторинг за нарастанием гомозиготности и оценку результатов инбридинга;
 Селекция лошадей по маркерам, определяющими хозяйственно-полезные признаки;
 Диагностика наследственных дефектов и заболеваний, в том
числе SCID, СА, LES, HYPP и др.
Систематическое тестирование лошадей в РФ позволяет не только проводить генетическую экспертизу происхождения, но и дает
возможность селекционерам использовать имеющуюся информацию
о типах полиморфных систем крови и микросателлитах ДНК в качестве маркеров генотипа животных при решении всех задач теоретической и практической селекции.
В настоящее время Государственный реестр селекционных достижений включает 44 породы и 5 типов лошадей, и практически все
из них прошли генетическую паспортизацию во ВНИИ коневодства.
Оказалось, что практически все изученные породы имеют своеобразный аллелофонд, отражающий происхождение, направление их хозяйственного использования и степень генетического родства. Обще-
признанно, что степень разнообразия полиморфных генов в настоящее время является объективным и информативным критерием оценки генетической изменчивости и самобытности популяций и пород.
При изучении молекулярно-генетических характеристик разных
пород лошадей было установлено, что каждая из них имеет особую
генетическую структуру. Кластерный анализ выявил, что изученные
породы четко подразделяются на два субкластера, в один из которых
входят только заводские, а во второй – преимущественно местные
породы лошадей.
Генетический мониторинг в коневодстве особенно актуален в
связи с небольшой численностью племенного поголовья многих отечественных пород, включая буденовскую, владимирскую, донскую,
терскую и др. Он дает возможность дополнить традиционную селекцию новыми технологиями и позволяет вести отбор и подбор не
только на фенотипическом, но и на генотипическом уровне. Одна из
основных задач генетического мониторинга - это поддержание в породах генетического разнообразия, что является необходимым условием для творческой селекционной работы [2].
Мониторинг аллелофонда 6 заводских пород показал, что динамика генетических процессов в группах жеребцов и маток не всегда
имеет однонаправленный характер. В целом в течение последних десятилетий у жеребцов-производителей пяти заводских пород шел
процесс снижения генетического разнообразия и элиминации редких
аллелей. Это привело к тому, что в настоящее время у продуцирующих жеребцов верховых и рысистых пород (за исключением орловского рысака) преобладают одни и те же типы белков: TfFF, TfDF,
EsII и аллели Ddk и Dcgm.
Современные методы изучения ДНК обусловили реальную возможность системного поиска генов и участков хромосом, определяющих скаковую работоспособность лошадей. Недавно было установлено, что на скаковую карьеру и дистанционные способности лошадей оказывает влияние структура гена миостатина (MSTN), локализованного в 18-й хромосоме.
Для лошадей уже разработаны генетические чипы, позволяющие
одновременно проводить ДНК-типирование нескольких десятков
важных генов, что создает реальную основу для внедрения методов
маркерной селекции и геномной оценки в коневодстве.
Литература:
1. Дубровская, Р.М. Методические рекомендации по использованию полиморфных систем белков и групп крови при контроле достоверности происхождения лошадей [Текст]/Р.М.Дубровская / ВНИИ
коневодства, 1986. - 39с.
2. Храброва, Л.А. Методические рекомендации по ведению генетического мониторинга местных пород лошадей [Текст] /Л.А. Храброва и др./ Дивово, 2005, - 50 С.
3. Храброва, Л.А. Руководство по использованию микросателлитов ДНК при генотипической оценке лошадей [Текст]/Л.А. Храброва,
Н.В. Блохина/ Дивово, 2012, - 20с.
4. Храброва, Л.А. Метод оценки генетического разнообразия и
степени генотипического сходства лошадей заводских и местных пород [Текст]/Л.А. Храброва и др. – Дивово, 2011. – 25 с.
УДК 638.12
ЗАВИСИМОСТЬ КАТАЛАЗНОЙ АКТИВНОСТИ
РЕКТАЛЬНЫХ ЖЕЛЕЗ У МЕДОНОСНЫХ ПЧЕЛ
ОТ ДЛИНЫ И ВЕСА ПРЯМОЙ КИШКИ.
Н.М. Абдулгазина, А.Б. Сафаргалин, Ф.Г. Юмагужин
ФГБОУ ВПО Башкирский государственный агарный университет
(Зауральский филиал), г. Сибай
Важнейшим признаком медоносных пчел в условиях продолжительной зимы является – зимостойкость. Зимостойкость – это сложное биологическое явление, определить которое по одному какомунибудь значению невозможно. В связи с этим важным является установление косвенных значений зимостойкости пчел, по которым ее
можно было бы прогнозировать. Следует отметить, что результаты
зимовки пчел зависят от различных факторов: степени подготовленности пчел к зиме, качества корма, условий зимовки. Но в основном
под зимостойкостью понимается способность пчел длительное время
противодействовать гнилостным процессам в прямой кишке и не
опонашиваться [1]. А это напрямую зависит от активности каталазы
ректальных желез.
Каталаза - это фермент класса оксиредуктаз, катализирует разложение перекиси водорода до воды и кислорода, является одним из
основных ферментов разрушения активных форм кислорода. Ато-
марный кислород, который получается при окислении перекиси водорода, препятствует развитию гнилостных микроорганизмов. Итак,
активность каталазы ректальных желез является важным показателем
интенсивности обмена веществ и является важным адаптационным
механизмом зимостойкости медоносных пчел [2].
Нами рассматривались различия уровня активности каталазы
ректальных желез от сезона года, связь активности каталазы с длиной
прямой кишки, ее весом и значением кубитального индекса у местных медоносных пчел в горно-лесной и степной зонах Зауралья Республики Башкортостан. Сравнивали результаты с идентичными данными, полученными с бортевых пчелиных семей бурзянской популяции заповедника «Шульган-Таш» и заказника «Алтын Солок». Исследования проводились в 2009 – 2011 годах. Пробы пчел для анализа
отбирали по 20-25 штук. В каждой группе исследовали по 20 пчелиных семей. Анализ активности фермента проводили перманганатометрическим методом, данные выражали в единицах мкмоль/мин/мг.
Зависимость активности каталазы ректальных желез от длины и
веса прямой кишки в весенний период представлена в таблице 1.
Длина и вес прямой кишки напрямую зависят от его наполненности
каловыми массами. Из таблицы 1. видно, что с увеличением длины
прямой кишки не происходит пропорциональное увеличение ее веса.
К примеру, в 2009 году у пчелиных семей с бортей при длине прямой
кишки 8,2 мм, вес ее составил 0,86 мг, 2010 году 8,45 мм и 0,39 мг, а
2011 году 7,65 мм и 0,63 мг, соответственно.
Таблица 1 Зависимость активности каталазы ректальных желез
от длины и веса прямой кишки (выборки пчел весенней генерации)
Годы
2009
2010
2011
Выборки пчелиных семей
бортевые
горно-лесные
степные
бортевые
горно-лесные
степные
бортевые
горно-лесные
степные
Длина прямой
кишки, мм
8,2
8,17
8,04
8,45
8,05
8,22
7,65
8,05
7,75
Вес, мг
0,86
0,29
0,36
0,39
0,44
0,91
0,63
0,31
0,91
Активность каталазы
34,50
48,13
49,26
45,50
47,63
20,29
40,25
49,50
133,83
У пчелиных семей с рамочных ульев с горно-лесной зоны в 2009
году данные значения составили 8,17 мм и 0,29 мг, 2010 году – 8,05
мм и 0,44 мг, a 2011 – 8,05 мм и 0,31 мг, соответственно.
В выборках пчелиных семей со степной зоны также прямая зависимость длины прямой кишки от ее веса не проявляется. Если в 2009
году длина прямой кишки у медоносных пчел со степной зоны составил 8,04 мм, ее вес 0,36 мг, то 2010 году – 8,22 мм и 0,91 мг, а 2011
году – 7,75 мм и 0,91 мг, соответственно.
В то же время следует подчеркнуть, что активность каталазы ректальных желез медоносных пчел различной выборки в пределах Зауралья Республики Башкортостан зависит от веса и длины прямой
кишки. При этом выявляется отрицательные соотношения данных
параметров.
Наиболее информативно вышеизложенное мнение представлено
на рисунках 1 и 2.
8,6
160,00
8,4
140,00
120,00
8,2
100,00
8
80,00
7,8
60,00
7,6
40,00
2009
длина кишки
2010
степные
горнолесные
бортевые
степные
горнолесные
бортевые
0,00
степные
7,2
горнолесные
20,00
бортевые
7,4
2011
активность каталазы
Рисунок 1 Соотношение активности каталазы ректальных желез
от длины прямой кишки (пчелы весенней генерации)
Из рисунка 1 видно, что наименьшей активности каталазы ректальных желез приходится наибольшая длина кишечника у всех выборок пчел весенней генерации по соответствующим годам и наоборот. Лишь у выборок пчел со степной зоны в 2011 году наблюдается
отрицательная тенденция. Видимо, это связано с начинающимися
процессами брожения в прямой кишке.
Как видно из рисунка 2 соотношение веса прямой кишки от каталазной активности ректальных желез также противоположное и
наоборот. Это ярко видно у выборок медоносных пчел из бортей в
2009 году и со степной - в 2010 году. У выборок пчел с горно – лесной зоны зависимость сильно не проявляется. А у выборок пчел со
степной зоны в 2011 году наибольшему весу прямой кишки соответствует высокая активность каталазы, что подтверждает мнение о процессах брожения, происходящих в прямой кишке.
160,00
1
140,00
0,9
0,8
120,00
0,7
100,00
0,6
80,00
0,5
60,00
0,4
0,3
40,00
0,2
20,00
0,1
2009
2010
активность каталазы
степные
горнолесные
бортевые
степные
горнолесные
бортевые
степные
горнолесные
0
бортевые
0,00
2011
вес
Рисунок 2 Соотношение активности каталазы ректальных желез
от веса прямой кишки (пчелы весенней генерации)
Для медоносных пчел осенней генерации вышеизложенное
утверждение остается также верным, то есть наблюдается зависимость каталазной активности ректальных желез от длины и веса прямой кишки или наполненности ее каловыми массами.
Таким образом, чем больше длина и вес прямой кишки, тем
меньше каталазная активность ректальных желез и наоборот чем
меньше длина и вес прямой кишки, тем больше активность данного
фермента. То есть наполненность прямой кишки напрямую регулирует физиологические процессы выделения фермента каталазы.
Литература
1. Лебедев, В.И. Биология пчелы медоносной и пчелиной семьи
[Текст] / В.И. Лебедев, Н.Г. Билаш. – М.: КолосС, - 2006. – С. 232 –
234.
2. Жеребкин М.В. Зимовка пчел [Текст] / М.В.Жеребкин. – М.:
Россельхозиздат, 1979. – 151 с.
УДК 638.121.1
НОВЫЕ ТЕХНОЛОГИИ ПО ЗАМЕНЕ ПЧЕЛИНЫХ МАТОК
Г.Г. Абдуллина, А.Н. Талипов, Ф.Г.Юмагужин
ФГБОУ ВПО Башкирский государтвенный аграрный университет
(Зауральский филиал), г. Сибай
Пчеловодство – единственная отрасль животноводства, где нет ни
одной заводской породы пчел, выведенной человеком. В практике используются естественные породы, сложившиеся под влиянием природно-климатических условий определенных зон. Они обладают огромным
генетическим разнообразием показателей, характеризующих качество и
продуктивность не только отдельных семей, но и пасек в целом.
В пчеловодстве низкая эффективность селекции пчел объясняется тем, что она основана на методах племенного отбора, аналогичных
классическим методам селекции животных, рассчитанных на изменение индивидуальных свойств отдельных особей. При этом родительские пары имеют свою известную родословную, смена поколения
растянута на несколько лет. Один производитель в животноводстве
может использоваться несколько лет. В пчеловодстве эти методы не
приемлемы. Трутни после спаривания погибают, оставляя после себя
только одно поколение. За сезон от одной матки можно получить несколько поколений. Испытать полученное потомство можно в этом
же году. Помесные матки не могут быть использованы, как надежный
производитель, способный передать потомству все характерные для
них хозяйственно полезные и биологические признаки. Результатом
является большая разнородность семей на пасеке.
Если в середине прошлого века не было таких понятий, как «метизированные» или «генетически засоренные» пчелы, то в настоящее
время в связи с постоянным завозом с юга пакетов пчелиных семей
смешивание пород пчел стала обычным явлением. Данный процесс
приобрел масштабный характер. Это привело к тому, что мы не имеем практически чистопородных пасек, в том числе в таком обширном
регионе, как Башкирское Зауралье. В то же время в данном регионе
есть все условия для отбора племенного материала и вывода племенных чистопородных маток. Для решения этой проблемы необходимо
применении новой технологии по замене маток.
Безусловно, здесь есть свои нюансы, нужны чистопородные матки. Пакеты с чистопородными плодными матками приобретаем в заповеднике «Шульган-Таш», где сохранились чистопородные пчелы.
После весенней ревизии, выделяются все семьи, отстающие в
развитии и занимающие от 2 до 4 рамок. Эти семьи надо утеплить,
обеспечить достаточным количеством корма и оставить их в покое до
получения первый партии молодых маток. Поэтапной замене подлежат все матки, которые не смогли обеспечить достаточное наращивание силы пчелиных семей. В семье воспитательнице, с наступлением
благоприятных погодных условий приступаем выводу молодых маток. Первый этап замены проводим 15 - 20 мая на зрелый маточник.
За три дня до выхода молодых маток, во всех отмеченных семьях
уничтожаем старых маток. Вместо заложенных свищевых маточников поставляем маточники на выходе. Прием маточников почти
100%. Для страховки формируем несколько нуклеусов с запасными
матками. После выхода и брачного облета молодые матки начинают
работать. Эти семьи с молодыми матками быстро набирают силу,
участвуют в медосборе с донника с середины июля и в августе.
Второй этап замены маток проводим в период роения. В семьях
воспитательницах выводим вторую партию маток. После роения в
основной семье убираем роевых маточников, даем молодую матку
или маточник на выходе.
Третий этап замены маток проводим в конце июля по мере возможности. За пчеловодный сезон замене подлежат 70-75% маток.
Только после начало откладки яиц молодыми матками, для подсиливание пчелосемьи рекомендуем дать расплод от сильных семей.
Благодаря последовательной поэтапной замене маток добились
стабильности морфологических признаков. Кубитальный индекс на
пасеках достиг 58,6%, а в отдельных семьях этот показатель составляет от 59,91% до 62,56%. Добились удовлетворительной зимовки
пчелосемей. Доля слабых семей после зимовки составляет не более
10-12%, вместо 35%. Соответственно, через замены малопродуктивных маток идет селекция и одновременно создается трутневой фон из
чистопородных трутней для следующего поколения молодых маток.
Литература:
1. Буренин, Н.Л. Справочник по пчеловодству [Текст] / Н.Л. Буренин, Г.Н. Котова.- Краснодар: СОВЕТСКАЯ КУБАНЬ, 1988. –
С. 89-91.
2. Черевко, Ю.А. Учебник Пчеловодство [Текст]/ Ю.А.Черевко,
Л.И.Бойценюк И.Ю. Верещака. - Москва: КолосС, - 2008. - С. 239241: 247 -251.
УДК 636 .082.21
АНАЛИЗ ВОСПРОИЗВОДСТВА КРУПНОГО РОГАТОГО
СКОТА СИММЕНТАЛЬСКОЙ ПОРОДЫ АВСТРИЙСКОЙ
СЕЛЕКЦИИ ООО ПХ «АРТЕМИДА»
В.В.Алимгафаров1, С.М. Лукманов2
1
ООО ПХ «Артемида»,2 ФГБОУ ВПО Башкирский государственный
аграрный университет, г. Уфа
Симментальская порода относится к наиболее известным и широко распространенным породам крупного рогатого скота в мире. По
данным Всемирной Федерации симментальского скота, в настоящее
время в мире насчитывается около 40 млн. голов симментальской породы.
Создание двух континентальных организаций: в 1962 г. – Европейской федерации скотоводов пятнистого (симментальского) скота
(EVF – Europaischen Vereinigung der Fleckviehzuchter) организациями
Германии, Франции, Италии, Югославии, Австрии Швейцарии и в
1974 г. – Всемирной федерации симментальского скота (WSFF –
World Simmental-Fleckvieh Federation) способствовало её известности
и росту масштабов использования. Главная цель международных
объединений – популяризация и содействие племенному улучшению
симментальского скота посредством сотрудничества национальных
организаций по племенному делу в выработке общих зоотехнических
правил ведения учета и регистрации, оценки племенных и продуктивных качеств животных, унификации систем оценки скота и др.
Всемирная федерация объединяет аналогичные структуры 27 различных стран 5 континентов: Европы, Африки, Северной и Южной Америки, Австралии.
По ряду объективных причин, во всем мире сохраняется устойчивый интерес к симментальской породе. В Европе симменталов разводят, как правило, в молочно-мясном направлении продуктивности,
а численность молочных коров составляет около 6 млн. Ареал породы охватывает всю Европу. Симментальская порода относится к
наиболее известным и широко распространенным породам крупного
рогатого скота в мире. По данным Всемирной Федерации симментальского скота, в настоящее время в мире насчитывается около 40
млн. голов симментальской породы.
Создание двух континентальных организаций: в 1962 г. – Европейской федерации скотоводов пятнистого (симментальского) скота
(EVF – Europaischen Vereinigung der Fleckviehzuchter) организациями
Германии, Франции, Италии, Югославии, Австрии Швейцарии и в
1974 г. – Всемирной федерации симментальского скота (WSFF –
World Simmental-Fleckvieh Federation) способствовало её известности
и росту масштабов использования.
Главная цель международных объединений – популяризация и
содействие племенному улучшению симментальского скота посредством сотрудничества национальных организаций по племенному делу в выработке общих зоотехнических правил ведения учета и регистрации, оценки племенных и продуктивных качеств животных, унификации систем оценки скота и др. Всемирная федерация объединяет
аналогичные структуры 27 различных стран 5 континентов: Европы,
Африки, Северной и Южной Америки, Австралии.
По ряду объективных причин, во всем мире сохраняется устойчивый интерес к симментальской породе. В Европе симменталов разводят, как правило, в молочно-мясном направлении продуктивности,
а численность молочных коров составляет около 6 млн. Ареал породы охватывает всю Европу. Широк ареал распространения симментальского скота и у нас, как в России, так и в республике Башкортостан. Стадо коров симментальской породы ООО ПХ «Артемида»
сформировано за счёт покупки нетелей из Австрии.
Симменталы – единственная порода в мире, относящяяся к широколобому типу в краниологической классификации и отличается от
других пород по ряду хозяйственно-полезных признаков, конституции и экстерьеру и, поэтому изучение их биологических особенностей, продуктивности и воспроизводительных качеств имеет большое
практическое значение.
Сравнительная продуктивность и биотехнологическая характеристика мясных пород крупного рогатого скота России красноречиво
показывают на превосходство симментальского скота относительно
многих классических пород Европы.
В концепции развития молочного и мясного скотоводства симментальская порода является одной из прогрессивных пород и при
наличии такого поголовья хорошо приспособленного к местным
условиям нет никакой надобности делать ставку на импорт мясных
пород скота, какими бы красивыми и заманчивыми они не казались.
В таблице представлен анализ воспроизводительных качеств симменталов австрийской селекции.
Таблица 1 Воспроизводительные качества коров
симментальской породы
Продолжительность,
дней
Количество, Возраст,
Показатель
гол
отёлов
мёртвоабор- стельсервисрожденных тов
ности
периода
Количество
Нетели
233
-
5
4
282,83
-
Первотёлки
141
1
6
1
286,51
125,52
Коровы
114
2
7
-
285,95
139,93
Коровы
77
3
6
-
284,39
125,63
В среднем
565
-
24
5
284,92
130,36
Анализ показал, что симменталы отличаются более продолжительной стельностью на 6,86 суток больше чем у голштинов и на
много короче сервис-период на 58,32 дня. У них меньшее количество
мёртворожденных и случаев абортов. Всё это красноречиво показывает о более высоких репродуктивных показателях симменталов в
условиях ООО ПХ «Артемида» Кармаскалинского района. Но это
лишь лишний раз подчёркивает о необходимости вести селекцию
крупного рогатого скота по воспроизводительным качествам и актуальности ведения селекции на крупноплодность.
Литература:
1. Гордон, А. Контроль воспроизводства сельскохозяйственных
живот-ных. [Текст] /А.Гордон. - М.: Агропромиздат, 1988. – 415 с.
2. Костомахин, Н.М. Воспроизводство стада и выращивание ремонтного молодняка в скотоводстве [Текст] / Н.М.Костомахин.–М.:
«Колос», 2009. -109 с.
3. Gerhard Raganitsch.Das Osterreichische Fleckvieh und seine
Genetik. Zwettl «Eigenverlag», 2001. - 368 s.
4. Stefan Tröst, Karl Zottl. Fleischrinderabschluss 2006/2007.
Wieselburg: No Genetik Rinderzuchtverband, 2008, №1, seite 7-8.
5. Dr Josef Miesenberger. Rinderzucht Austria in Moskau erfolgreich
«Rieder Fleckvieh in alle Welt». / Mitteilungen. Ried, 2008. - s 4.
УДК 636.2:637.5
ВЛИЯНИЕ ГЛИЦИРРИЗИНОВОЙ КИСЛОТЫ
НА ВЕТЕРИНАРНО-САНИТАРНЫЕ ПОКАЗАТЕЛИ МЯСА
ВО ВРЕМЯ ХРОНИЧЕСКОЙ ИНТОКСИКАЦИИ
ФОСФОРОРГАНИЧЕСКИМИ СОЕДИНЕНИЯМИ
Г.В. Базекин, А.Ф. Исмагилова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
Прогресс фармакологической науки характеризуется постоянным поиском и созданием новых, более совершенных препаратов.
Потребность в высокоэффективных лекарственных средствах обусловлена широким распространением различных болезней среди животных и человека. Во многих странах мира уделяется большое внимание проблемам окружающей среды, кормов и продуктов питания
от загрязнений различными опасными химическими веществами антропогенного и естественного происхождения, изучению их влияния
на сельскохозяйственных животных и птиц, санитарному качеству
продуктов питания [5].
В настоящее время все большее значение среди средств детоксикационной терапии приобретают лекарственные растения, поскольку в отличие от многих синтетических препаратов они действуют на организм комплексно.
Особое внимание заслуживают солодка голая и уральская, антитоксические свойства которых имеют научное подтверждение [2,3].
Доказано, что ядовитые химические соединения, бактериальные токсины быстро обезвреживаются благодаря сапонину глицирризиновой
кислоты (ГК), содержание которой в корнях и корневищах солодки
колеблется от 8,0 до 24,0% [4]. Антидотное действие ГК, обусловлено
наличием в ее молекуле двух фрагментов глюкуроновой кислоты, в
три раза выше защитного действия глюкуроновой кислоты, выделяемой печенью [1].
В связи с этим, дальнейшее изучение свойств ГК для обоснования применения в ветеринарной практике, как средства детоксикационной терапии в условиях загрязнения природной среды остатками
фосфорорганических соединений, а также с целью улучшения качества и безопасности продуктов питания животного происхождения
является актуальным.
В течение 2 месяцев была изучена способность ГК (в дозе 50,0
мг/кг) улучшать качество получаемого мяса на 18 дойных коровах
при хроническом отравлении малыми дозами Рогор – С.
Дойных коров разделили на три группы по 6 голов в каждой с
учетом возраста, живой массы, продуктивности.
Коровам всех групп, в течение 2 месяцев, с комбикормом задавали Рогор – С в дозе 1/100 ЛД0, что составило 1,75 мг/кг массы тела.
Первая группа служила контролем, во второй группе для профилактики отравления за 3 – 5 часов до дачи комбикорма с ядохимикатом
выпаивали 1 литр водного раствора ГК (50,0 мг/кг), коровам третьей
группы водный раствор ГК выпаивали в той же дозе через 3 – 5 часов
после затравки. Отбор проб мяса для органолептического, ского и
физико – химического анализа проводили по ГОСТ 7269 – 79 («Мясо.
Методы отбора образцов и органолептические методы определения
свежести»), 23392 – 78 («Методы химического и микроскопического
анализа свежести»).
Статистическую обработку полученных результатов проводили
общепринятыми методами вариационной статистики с использованием компьютера. Доверительную вероятность (Р) находили с учетом
числа имеющихся наблюдений по таблице Стьюдента. Различия считали статистически достоверными при Р≤ 0,05.
При визуальном осмотре мяса животных опытных групп отмечено различное обескровливание туш. Мясо животных 1 группы было
темно – красного, а жир – розового цвета, у животных второй и третьей групп – мясо розово – красное, а жир слегка желтоватый.
Признаки плохого обескровливания были видны по заполнению кровью сосудов плевры и брюшины. При определении степени
обескровливания по Родеру в первой группе отмечено плохое обескровливание мяса, во второй и третьей – хорошее. Корочка подсыхания поверхностных слоев мяса животных после хронического отравления Рогор – С слабо выражена, мясо животных, которым выпаивали ГК, имело хорошую выраженную корочку подсыхания.
Характер процесса созревания и степень микробной обсемененности мяса взаимосвязаны. При интоксикации обсемененность
мяса и внутренних органов микрофлорой являются следствием прижизненной бактериемии в результате ослабления организма.
При одинаковых условиях взятия материала для микроскопического исследования в поверхностных мазках-отпечатках в мясе первой
группы было обнаружено 68-143 кокков и палочек в одном поле зре-
ния микроскопа, во второй и третьей группах – единичные кокки. При
микроскопии мазков – отпечатков с глубоких слоев мяса животных 1
группы насчитывалось до 34 микроорганизмов в поле зрения микроскопа, животных 2 и 3 групп микрофлора не обнаружена.
Об изменениях физико-химических показателей мяса животных, получавших длительное время Рогор – С, можно судить по
наличию продуктов первичного распада белка, изменению кислотно –
щелочного равновесия, отрицательной реакции на пероксидазу, положительной формоловой пробе
Результаты проведенных исследований представлены в следующей таблице.
Показатели
Реакция среды
Реакция на пероксидазу
Летучие жирные кислоты, мг КОН/100,0
Реакция с сернокислой
медью
Формоловая проба
Аминоаммиачный азот,
мг/100,0
Коэффициент кислотность – окисляемость, ед
Группы животных
Первая
Вторая
Третья
6,70±0,08
6,20±0,06
6,22±0,04
отрицательная положительная положительная
8,79±3,59
3,21±1,80
3,08±2,78
Хлопья
в бульоне
Желеобразный
сгусток
Бульон прозрачный
Фильтрат мутноватый
Бульон прозрачный
Фильтрат прозрачный
148,2±12,50
64,79±3,58
69,97±5,92
0,22±0,03
0,47±0,10
0,45±0,20
Физико-химические показатели мяса животных 1 группы соответствуют недоброкачественному. Так, реакция среды, через 24 часа
созревания, в мясе животных 1 группы выше по сравнению с другими
группами, фермент пероксидаза не активен, увеличено содержание
летучих жирных кислот.
Об изменениях обменных процессов в организме животных 1
группы свидетельствуют результаты амино-аммиачного азотаи реакция на первичные продукты распада белка.
Вследствие накопления недоокисленных продуктов белкового
метаболизма в мясе первой группы показатель кислотность – окисляемость снижался на 46,8 – 48,9% в сравнении с мясом животных
твторой и третьей групп.
Таким образом, ГК, назначаемая при хроническом отравлении
с лечебной и профилактической целями существенно улучшала физи-
ко - химические показатели мяса и позволяла получить продукт, соответствующий ветеринарно-санитарным требованиям.
Литература:
1. Балтина, Л.А. Мурамилпептиды. [Текст] / Л.А. Балтина, Г.А.
Толстиков - Екатеринбург 1998. –347с.
2. Балтина, Л.А. Получение глицирризиновой кислоты из экстракта солодки. [Текст] / Л.А. Балтина, Н.Г. Сердюк, Л.В. Краснова //
Хим.фарм.ж. – 1994.- №9.-С.51-54.
3. Базекин, Г.В. Научно-экспериментальное обоснование применения глицирризиновой кислоты и её производных в ветеринарии
[Текст] / Г.В. Базекин, А.Ф.Исмагилова, - Уфа, БГАУ 2010 – 86 с.
4. Толстиков, Г.А. Комплексы В - глицирризиновой кислоты как
новые транспортные формы [Текст] / Г.А.Толстиков, Ю.И.Муринов,
Л.А.Балтина,: Хим.фарм.ж. – 1990.-№8.-С.26-27.
5. Толстиков, Г.А., Балтина, Л.А., Шульц, Э.Э. Глицирризиновая
кислота [Текст] / Г.А.Толстиков, Л.А.Балтина, Э.Э.Шульц // Биоорган. Химия. – 1997. – Т23. - №9. – С.691 – 709
УДК 619:616.34:636.4.053
КОРРЕКЦИЯ МИКРОБИОЦЕНОЗА КИШЕЧНИКА
ПОРОСЯТ В РАННИЙ ПОСТНАТАЛЬНЫЙ ПЕРИОД
КАК БИОТЕХНОЛОГИЧЕСКИЙ ПРИЁМ ПРОФИЛАКТИКИ
ЖЕЛУДОЧНО-КИШЕЧНЫХ ЗАБОЛЕВАНИЙ
Г.И. Баишева, А.В. Андреева
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
В настоящее время в связи с резким сокращением поголовья животных остро стоит вопрос о воспроизводстве стада, который включает в себя не только вопросы получения полноценного приплода и
его сохранности, но и интенсификации выращивания молодняка с
одновременным увеличением среднесуточного прироста живой массы при меньших затратах труда и средств.
Наиболее перспективной в данном отношении отраслью животноводства является свиноводство, так как свиньи – наиболее скороспелые и многоплодные животные, позволяющие обеспечить продовольственную независимость страны. Однако выполнению этой зада-
чи могут помешать различные заболевания, к числу которых относятся желудочно-кишечные болезни поросят в ранний постнатальный
период. Кишечный нормобиоз поросят характеризуется доминирующей численностью бифидо- и лактобактерий. Они активно участвуют
в поддержании неспецифической защиты организма, в выработке витаминов, в обмене аминокислот, выделяют некоторые ферменты, однако главная их роль заключается в поддержании колонизационной
резистентности слизистой кишечника к контаминации условнопатогенными микроорганизмами.
При желудочно-кишечных заболеваниях поросят наблюдается
уменьшение в кишечнике абсолютного количества, относительного
содержания и частоты обнаружения бифидо- и лактобактерий. Из доминирующей микрофлоры эти бактерии становятся малочисленными
представителями кишечного биоценоза. Освобождаемая ими экологическая ниша занимается патогенными микроорганизмами.
Механизм действия пробиотиков широко известен и направлен
на принудительное заселение кишечника конкурентоспособными
штаммами бактерий-пробионтов, которые осуществляют неспецифический контроль за численностью условно-патогенной микрофлоры,
вытесняя ее из состава кишечной популяции и сдерживая усиление
факторов патогенности у ее представителей.
В связи с этим целью работы явилось изучение микробиоценоза
кишечника поросят в ранний постнатальный период и его коррекция
пробиотиками «Споровит», «Ветоспорин» в комплексе с кормовой
добавкой «Микровитам» и прополисным молочком.
Научно-производственные опыты проведены в условиях ООО
«Шаранагрогаз» Шаранского района Республики Башкортостан. По
принципу аналогов были подобраны поросята и разделены на восемь
групп (n=10). Животные первой группы (контрольные) находились на
основном рационе – ОР), второй группы – получали пробиотик «Споровит»; третьей – пробиотик «Ветоспорин», четвертой – пробиотик
«Ветоспорин»+ кормовую добавку «Микровитам»; пятой – пробиотик «Ветоспорин»+ прополисное молочко; шестой – пробиотик «Ветоспорин»+кормовую добавку «Микровитам»+ прополисное молочко; седьмой – прополисное молочко; восьмой – кормовую добавку
«Микровитам» Разовая доза кормовой добавки «Микровитам» составила 1 г на 1 кг корма, пробиотиков «Споровит» и«Ветоспорин» - 1
мл на 10 кг массы тела и прополисного молочка – 10 мл внутрь на одно животное. Качественное и количественное исследование микро-
флоры кишечника проводили по Э. П. Касаткиной с соавт. (1996).
Выделение бифидобактерий проводили посевом больших разведений
фекалий в среду Блаурокка. Посевы инкубировали при температуре
37ºС в течение 24 часов. Лактобактерии выращивали на среде МРС.
Для выделения стафилококков использовали селективные среды - солевой кровяной МПА (с 8 - 10% натрия хлорида и 5% дифибринированной крови); клостридий - на мясо - пептонный -печеночный бульон (МППБ), среду Китта – Тароцци, энтерококки – ДИФ – 3; кишечная палочка – агар Эндо, Плоскирева, Левина. Микрогрибы из рода
Candida выделяли на среде Сабура. Результаты переводили в десятичные логарифмы (lg) и определяли относительное соотношение
различных групп микроорганизмов в кишечной популяции.
В кишечнике поросят содержание бифидобактерий за период
опыта находилось на уровне 6,22 - 9,2 lg КОЕ/г.
Фоновый показатель бифидобактерий в кишечнике поросят в
ранний постнатальный период колебался от 6,22 до 6,81 lg КОЕ/г. У
поросят пятой и четвертой опытных групп содержание бифидобактерий в кишечнике на 10-й день исследования превышало показатели
фона: - в 1,13 (на 0,9 lg КОЕ/г) и 1,11 раза (на 0,72 lg КОЕ/г); на 30-й
день – в 1,18 (на 1,2 lg КОЕ/г) и 1,16 раза (на 1,07 lg КОЕ/г) и 60-й
день – в 1,23 (на 1,5 lg КОЕ/г) и 1,26 раза (на 1,72 lg КОЕ/г). В кишечнике поросят седьмой и восьмой опытных групп также наблюдалась тенденция к повышению количества бифидобактерий: к 10-му
дню исследования - в 1,09 (на 058 lg КОЕ/г) и 1,12 раза (на 0,8 lg КОЕ/г);
к 30-му дню – в 1,15 (на 0,98 lg КОЕ/г) и 1,18 раза (на 1,2 lg КОЕ/г) и
к 60-му дню – в 1,23 (на 1,48 lg КОЕ/г) и 1,22 раза (на 1,4 lg КОЕ/г).
У поросят шестой опытной группы содержание бифидобактерий
было выше фоновых показателей: на 10-й день опыта в 1,1 раза (на
0,58 lg КОЕ/г), на 30-й день – в 1,32 раза (на 2,17 lg КОЕ/г), на 60-й
день – в 1,37 раза (на 2,47 lg КОЕ/г), соответственно.
Содержание лактобактерий в кишечнике поросят контрольной и
опытных групп находилось на уровне 3,65 - 4,42 lg КОЕ/г.
Максимальное содержание лактобактерий в кишечнике поросят
наблюдалось в шестой опытной группе, что превысило фоновые показатели на 10-й день в 1,35 раза (на 1,49 lg КОЕ/г), на 30-й – в 1,68
раза (на 2,89 lg КОЕ/г), на 60-й – в 1,91 раза (на 3,85 lg КОЕ/г). На 60
– й день исследований содержания лактобактерий у второй и седьмой
опытных групп был на одном уровне, что превысило показатели первой контрольной группы в 1,42 раза (на 2,11 lg КОЕ/г).
Содержание в кишечнике поросят кишечной палочки за период
опыта находилось на уровне 3,6-6,9 lg КОЕ/г.
Фоновый показатель кишечной палочки у поросят колебался от
6,2 до 6,9 lg КОЕ/г. Выраженное уменьшение кишечной палочки
наблюдалось в кишечнике животных второй и шестой опытных
групп: к 10-му дню от начала исследования – в 1,1 (на 0,6 lg КОЕ/г) и
1,01 раза (на 0,8 lg КОЕ/г); к 30-му дню – в 1,6 (на 2,6 lg КОЕ/г) и 1,5
раза (на 2,3 lg КОЕ/г) и к 60-му дню – в 1,91 (на 3,3 lg КОЕ/г) и 1,6
раза (на 2,6 lg КОЕ/г).
У поросят, содержавшихся на обычном рационе (контрольная
группа) количество стафилококков, выделенных из кишечника за весь
период исследований изменялось от 4,48±0,06 до 3,39±0,04 lg КОЕ/г.
Значение стафилококков в кишечнике поросят пятой, четвертой,
седьмой и восьмой опытных групп динамично понижалось до 30-го
дня исследований в 1,07; 1,06; 1,06 и 1,1 раза (на 0,57; 0,24 и 0,2 0,58
lg КОЕ/г) по отношению к фоновому показателю.
В кишечнике поросят контрольной группы количество энтерококков находилось на уровне 3,64 - 3,11 lg КОЕ/г. Содержание энтерококков в кишечнике поросят третьей опытной группы имело незначительную тенденцию к понижению. На 60-й день исследований уровень энтерококков был ниже показателей контрольной группы в 1,2
раза (на 0,64 lg КОЕ/г). Фоновое содержание клостридий в первой
контрольной группе находилось на уровне 6,1 lg КОЕ/г, у остальных
опытных групп (вторая - восьмая) колебалось от 4,5 до 5,1 lg КОЕ/г.
Уровень клостридий во всех опытных группах к концу исследований
имел тенденцию к значительному понижению.
Содержание дрожжеподобных грибов в первой контрольной
группе колебалось от 3,16 до 3,84 lg КОЕ/г. Максимальное снижение
количества грибов рода Candida наблюдалось у второй и шестой
групп. Так, на 10-й день опыта их уровень в данных группах был ниже в 1,47 и 1,34 раза (на 1,26 и 1 lg КОЕ/г), на 30-й день - в 1,95 раза
(на 1,66 lg КОЕ/г), на 60-й день - в 2 и 2,05 раза (на 1,6 и 1,62 lg
КОЕ/г).
Таким образом, применение пробиотиков «Споровит», «Ветоспорин» в комплексе с кормовой добавкой «Микровитам» и прополисным молочком поросятам в ранний постнатальный период способствует восстановлению микробиоценоза с активным повышением
бифидобактерий, которые обладают антиаллергическим действием,
участвуют в формировании иммунологической реактивности и явля-
ются мощным биосорбентом, инактивирующим экзо- и эндотоксины,
а также лактобактерий, обладающих выраженным бактерицидным
действием, что приводит к повышению колонизационной резистентности кишечника, при усиленном понижении условно-патогенных
микроорганизмов.
Литература:
1. Антипов, В.А. Эффективность и перспективы применения
пробиотиков [Текст] / В. А. Антипов, В. М. Субботин // Ветеринария.- 1990. -С. 55-57.
2. Субботин, В.В. Новые пробиотики [Текст] / В. В. Субботин,
Н.В. Данилевская // Животновод.-1998.-№4.-С.20.
3 Тараканов, Б. В. Механизмы действия пробиотиков на микрофлору пищеварительного тракта и организма животного / Б. В. Тараканов, Т.А. Николичева // Ветеринария. – 2000. - № 1 – С. 47.
УДК 636.4(489)
ОСОБЕННОСТИ ТЕХНОЛОГИИ ВЫРАЩИВАНИЯ СВИНЕЙ
В ДАНИИ
Г.И. Баишева, А.В. Андреева
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
В современных условиях эффективность свиноводства зависит от
использования технологий, способствующих созданию комфортных
условий содержания свиней, как важного фактора повышения продуктивности животных. Применение современных технологий в свою
очередь возможно лишь при правильных, соответствующих условиях
содержания.
Дания является одним из мировых лидеров в свиноводстве, ведущим поставщиком технологий и ноу-хау в этой области. Главное
достоинство датских ферм состоит в том, что вся технология выращивания свиней подчинена требованию минимизации затрат ручного
труда.
На сегодняшний день технологии датского свиноводства успешно адаптируется и в России.
Известно, что качество ветеринарного обслуживания определяется профилактическими мероприятиями. Чем лучше профилактика,
тем меньше расходов на лечение. Поэтому технология выращивания
свиней в Дании направлена на профилактику и соблюдение карантинных правил.
Отличительной чертой датской системы ветеринарного обслуживания является то, что на фермах в Дании работает высококвалифицированный персонал, с хорошими навыками ведения хозяйства. От
датского фермера требуется расширенное, многоуровневое образование. Работники высоко ценятся на ферме и вместе с управляющим
составляют основу фермы, разрабатывая планы достижения намеченных целей. Каждый работник трудится сугубо в своей сфере, но понимает весь механизм работы фермы: влияние срока отъёма на стоимость продукции, здоровье откормочного стада и плодовитость, производительность фермы в целом.
Также обслуживающий персонал осуществляет регулярные профилактические ветеринарные мероприятия: кастрацию поросят, купирование хвостов. В целях предотвращения распространения заразных заболеваний на комплексе очень жестко придерживаются карантинных правил.
Датская технология выращивания свиней предусматривает лечение животных при частичном параличе, диарее, воспалении легких и
мозга, в остальных случаях – вынужденный забой. Умерщвляют животных только в тех случаях, когда лечение не дает результата в течение двух недель.
В расчете на одну свиноматку в Дании в среднем получают 28
поросят приплода. Отлучают поросят через 21-28 дней в зависимости
от индивидуальной массы животного. Минимальный срок отъёма - 28
дней, в среднем по стране - 31 день. Среднесуточный прирост живой
массы свиней на откорме (30 – 106 кг) составляет 890 грамма. Кондиционного веса для забоя (100 килограммов) - свиньи достигают в возрасте 160 - 165 дней. Откорм свиней производят до 110-120 кг. Дальнейшее содержание, считают датчане, очень невыгодно: увеличивается прослойка жира, на образование которого расходуется значительно
больше корма. Датчане не подсчитывают процент здорового молодняка, в них фигурирует показатель ухода, потери должны сводиться к
минимуму: не более двух поросят от свиноматки за опорос.
Процесс кормления механизирован и происходит автоматически
по заданной программе. Поросята на доращивании получают корма
из самокормушек при свободном доступе в течение суток. Гулевые и
супоросные свиноматки получают комбикорм два раза в сутки, а под-
сосные свиноматки - три раза. Из дозатора кормов, смонтированного
на шайбовом транспортере, корма самотеком поступают в кормушку
свиноматке или самокормушку поросятам. Кормушка датской конструкции спасает животных от стрессов, обеспечивает снижение непроизводительных затрат корма вследствие разбрасывания его животными, снижает нежелательные последствия конкурентных отношений
между животными, упрощает и облегчает раздачу комбикорма в случае группового содержания свиней, позволяет рационально использовать производственные площади животноводческих помещений.
Вода в станки для животных подается автоматически, круглосуточно и бесперебойно. Доступ к воде у свиноматок и поросят свободный, здесь используют поилки уровня и сосковые.
Удаление навоза из станков происходит через щелевые полы.
Конструкция станков спроектирована и выполнена так, что навоз и
навозная жижа поступают только на щелевую часть пола. Щелевые
решетки двух типов. В тех блоках, где находятся только свиноматки,
применяют чугунные решетки с шириной щели 22 миллиметра. В тех
блоках, где происходит опорос, подсос и доращивание поросят, на
полах применяют стальные решетки с шириной щели 10 миллиметров. Под всеми решетками по длине корпуса с уклоном на середину
выполнены навозные каналы. В них устроены приемники, через которые жидкий навоз поступает в трубу, которая идет к насосу, выкачивающему его в резервуары. Стоки животноводческих ферм категорически запрещено сбрасывать на открытую почву. Из животноводческих помещений жидкий навоз насосом перекачивается в резервуары. По мере накопления в установленное время года жидкий навоз из
этих резервуаров специальным разбрасывателем, агрегатируемым с
трактором, вносится поверхностно на поля.
Цели индивидуальных фермеров различны, но поиск лучших
способов управления и быть лучшими заставляет всех производителей заботиться о технологиях выращивания поросят, так как все показатели продуктивности свиней зависят большей частью от состояния здоровья молодняка и в этом заключается основной интерес производителей.
УДК 619:618.39:636.2
ПРОФИЛАКТИКА ПОСЛЕРОДОВЫХ ОСЛОЖНЕНИЙ
У КОРОВ В УСЛОВИЯХ ИНТЕНСИВНОЙ ТЕХНОЛОГИИ
ПРОИЗВОДСТВА МОЛОКА
М.Х. Баймишев, О.Н. Пристяжнюк
ФГБОУ ВПО Самарская государственная сельскохозяйственная
академия, г. Самара
В последние годы для профилактики и лечения все больше используют препараты, имеющие растительное или животное происхождение, т.к. при их применении больное животное получает целый
комплекс природных соединений и они действуют на организм мягче,
чем химические, синтетические средства, лучше переносятся и не обладают кумулятивными свойствами, они также оказывают положительное влияние на обменные процессы и реактивность организма
животных [1, 3, 4].
Цель исследований – профилактика послеродовых осложнений
при использовании СТЭМБ (стимулятор эмбриональный) и настой
крапивы двудомной.
Исследования проводились на коровах черно-пестрой породы.
Для чего по принципу аналогов было сформировано три группы коров в количестве 20 голов в каждой группе. Все животные были по
законченной первой лактации. Животные исследуемых групп находились в одинаковых условиях кормления, содержания. Контролем
служили животные контрольной группы. Животным опытной группы
1 вводили настой крапивы двудомной в область седалищно-прямокишечной ямки в рыхлую соединительнотканную клетчатку на глубину 4-9 см с двух сторон по 120 мл, трехкратно. Первое введение за
месяц до отела, последующие с интервалом 7 суток.
В процессе исследований у животных были изучены следующие
показатели: течение родов (у пяти голов из каждой группы) и послеродового периода, продолжительность инволюции матки, сроки проявления полового цикла после родов, индекс осеменения, оплодотворяемость в первую и последующие половые охоты, продолжительность сервис-периода, регрессия желтого тела.
В результате исследований установлено, что применение адаптогенов влияет на характер течения актов родов и сроки инволюции половых органов у коров.
Продолжительность подготовительной стадии у коров контрольной группы составила 6,13±1,12 часа, в то время как у животных
опытных групп соответственно 4,04±0,85 часа; 4,02±0,91 часа, что
достоверно меньше на 2,09; 2,11 часа (Р<0,05). У животных контрольной группы, которым перед родами не вводили адаптогены,
снижается активность родовой деятельности, а именно более короткие сокращения маточной мускулатуры и длинные паузы между ними, вследствие функционального напряжения организма из-за снижения естественной резистентности [2].
При изучении стадии выведения плода в контрольной группе четырем коровам была оказана акушерская помощь, а в группах коров
инъецированных адаптогенами вышеуказанная патология не наблюдалась, что свидетельствует об ослаблении родовой деятельности у
коров контрольной группы, вызванное функциональным напряжением организма во время предыдущей лактации и нарушением метаболизма (Болотин В.М. и др., 2009).
Продолжительность послеродовой стадии у животных контрольной группы составила 8,84±1,42 часа, что достоверно (P<0,01) больше, чем у животных третьей группы, которым в качестве адаптогена
вводили СТЭМБ. Процент задержания последа в контрольной группе
составил 20%, в опытной 1 группе 5,0%, а в опытной группе 2 случаев задержания последа не отмечено.
Инволюция тела и рогов матки у контрольных животных протекала медленнее, чем в опытных группах и завершилась к 29,73±0,73
дню послеродового периода. В группе коров, которым трехкратно
вводили настой крапивы двудомной, инволюция матки закончилась к
23,55±0,65 суткам (P<0,001), а у коров, которым вводили СТЭМБ уже
к 20,27±0,41 дню послеродового периода (P<0,001).
Таким образом, двукратное введение препарата СТЭМБ и настоя
крапивы двудомной сокращают сроки инволюции половых органов
коров, причем стимулятор эмбриональный (СТЭМБ) влияет на течение процессов инволюции эффективнее, чем настой крапивы двудомной. Поскольку сроки процесса инволюции половых органов коров
контрольной группы отличаются от таковых у опытных животных, то
и частота возникновения послеродовой патологии у них выше.
Нарушение инволюционных процессов репродуктивных органов
встречается у коров контрольной группы в 50,0% случаев, из которых
у 8-ми коров (40,0%) наблюдалась субинволюция матки в легкой
форме и у 2-х коров (10,0%) – в тяжелой. У животных, которым при-
меняли настой крапивы двудомной нарушение инволюционных процессов зафиксировано в 35,0% случаев, из них у 6-ти коров (30,0%)
субинволюция половых органов протекала в легкой форме и у одного
животного (5,0%) – в тяжелой.
Эффективность трехкратного применения препарата СТЭМБ до
родов для профилактики возникновения субинволюции половой сферы составила 80,0%, при этом тяжелой формы субинволюции матки у
опытных коров не наблюдалось, а небольшие отклонения в течении
инволюционных процессов зафиксировали у 4-х (20,0%) животных.
По результатам наших экспериментов, оплодотворяемость у коров после родов, получавших с профилактической целью СТЭМБ,
была достаточно высокой и составила от первого осеменения 50,0%,
от второго 35,0%, а от третьего и последующих – 10,0%.
Это свидетельствует о том, что применение СТЭМБ повышает
оплодотворяемость коров в первые два половых цикла, когда животные массово приходят в охоту и 95,0% из них были плодотворно осеменены. Оставшиеся 2 коровы (15,0%) были осеменены при проявлении последующих половых циклов. Количество дней бесплодия в
данной группе составило в среднем 59,73±6,04 дня, при индексе осеменения – 1,8. При использовании с профилактической целью фитопрепарата крапивы двудомной оплодотворяемость коров от первого
осеменения составила 45%, от второго – 30,0%, от третьего и последующих 10,0%. Дней бесплодия насчитывалось в среднем
68,36±10,08, что на 8,63 дня больше показателей второй опытной
группы, при индексе осеменения 2,0. В контрольной группе оплодотворяемость составила 20,0% 35,0% и 15,0% соответственно, в
первую, вторую и последующие охоты; количество дней бесплодия –
93,82±11,53, что на 34,09 дня; 25,46 дня больше соответственно, чем у
животных опытной группы 1 и опытной группы 2, а индекс осеменения – 2,56.
Введение адаптогенов СТЭМБ, крапивы двудомной позволило
нам повысить оплодотворяемость коров и снизить количество дней
бесплодия. Высокий профилактический эффект применения адаптогена СТЭМБ объясняется тем, что он стимулирует обменноэнергетические процессы, обеспечивая воздействие на ферментные
системы, а также данный препарат обладает свойствами повышения
активности иммунной системы и усиливает секреторную активность
и регенеративную способность клеток репродуктивной сферы, что
видимо, и обеспечивает ее высокую эффективность применения. Ис-
пользование настоя крапивы двудомной имеет также эффект, обусловленный содержанием биологически активных веществ в водных
экстрактах, стимулирующих защитно-адаптационные возможности
организма животных.
Литература:
1. Багманов, М.А. Акушерско-гинекологическая патология коров
(диагностика, комплексная терапия и профилактика)[Текст] – Ульяновск, 2005. – 207 с.
2. Болотин, В.М. АйСиДивит для профилактики послеродовых
осложнений у коров [Текст]/ В.М. Болотин, А.М. Кобольков, Д.Д.
Новиков, Т.И. Кучелева // Ветеринария. – 2009. – №4. – С. 35-36.
3. Нежданов, А.Г. Бетаадреноблокаторы для профилактики послеродовых осложнений и повышения оплодотворяемости коров
[Текст]/ А.Г. Нежданов, В.А. Сафонов, К.А. Лободин, С.В Советкин //
Ветеринария. – 2007. – №8. – С. 32-34.
4. Тимченко, Л.Д. Краткая характеристика препарата «СТЭМБ» и
перспективы его использования [Текст] / Л.Д. Тимченко, И.В. Ржепаковский // Биоресурсы, биотехнологии, инновации Юга России: Материалы междун. науч.-практ. конф. – Ставрополь-Пятигорск. – 2003.
– Ч. 2. – С. 163-165.
УДК 619:599.323.4
СТРУКТУРНАЯ ОРГАНИЗАЦИЯ СЕТЧАТКИ ГЛАЗ КРЫС
ЛИНИИ WAG/Rij, ИМЕЮЩИХ РАЗЛИЧИЯ ГЕНОТИПА
ПО ЛОКУСУ Taq 1A DRD2
1
Л.Х.Балхиева, 1Т.М.Табанакова, 1З.Р.Хисматуллина,
2
Л.А.Мусина
1
Кафедра морфологии и физиологии человека и животных биологического факультета Башкирского государственного университета,
2
отдел морфологии Всероссийского центра глазной и пластической
хирургии, г. Уфа.
Существует множество экспериментальных моделей животных с
пигментной дегенерацией сетчатки, в том числе линии собак, кошек,
кур, свиней, мышей и крыс [4]. Разнообразие моделей связано с разнообразием генетических форм заболевания.
Из немногочисленных научных публикаций известно, что крысы
линии WAG/Rij также характеризуются врожденной двусторонней
дегенерацией пигментного эпителия сетчатки [5]. Дегенерация пигментного эпителия сетчатки глаза крыс WAG/Rij – это новая уникальная система и потенциально очень полезная модель животного,
как для фундаментальных исследований, так и в прикладном аспекте
для разработки методов лечения.
На основе поведенческих и электрофизиологических исследований рядом авторов сделан вывод о функциональной недостаточности
дофаминэргической системы мозга крыс линии WAG/Rij [1]. Вполне
вероятно, что различные по выраженности нарушения в деятельности
дофаминэргической системы у крыс, различающихся генотипом по
двуаллельному локусу TAG 1A DRD2, могут отражаться и на структурной организации сетчатки глаза.
Целью исследования было зучение особенностей структурной организации сетчатки гомозиготных крыс линии WAG/Rij, различающихся генотипом по двуаллельному локусу TAG 1A DRD2.
Исследования были проведены на 100 гистологических срезах
сетчатки крыс линии WAG/Rij, имеющих различия аллельной структуры локуса TAG 1A DRD2. 50 срезов сетчатки глаз были от крыс,
содержащих в указанном локусе DRD2 два аллеля А1. 50 срезов сетчатки глаз были от крыс, содержащих в указанном локусе DRD2 два
аллеля А2. Эти линии крыс получены на кафедре морфологии и физиологии человека и животных Башкирского государственного университета путем скрещивания гомозиготных крыс, выявленных в исходной популяции генетическим анализом локуса TAG 1A DRD2.
К настоящему времени крысы прошли 20 поколений. Крысы содержались в одинаковых условиях со стандартным рационом питания. С соблюдением «Правил проведения работ с использованием
экспериментальных животных» (приказ Минвуза от 13 ноября 1984 г.
№724) животных выводили из эксперимента и энуклеировали глазные яблоки. Затем фиксировали их в 10% забуференном формалине
по Лилли, после обезвоживания в серии спиртов возрастающей концентрации заливали в парафин по общепринятой методике. Срезы готовили на микротоме LEICA RM 2145 и окрашивали гематоксилином
и эозином, по методам Ван-Гизон, по Нисслю.
Окрашенные гистологические срезы анализировали и фотографировали при помощи микроскопа AXIO IMAGER-Z1 фирмы «CARL
ZEISS» при увеличении Х100 (Германия). На фотографиях сетчатки
производили измерения толщины слоев в мкм. Для каждого слоя сет-
чатки крыс одной аллели сделано по 100 измерений. Математикостатистическая обработка результатов осуществлялась при помощи
программы «Statistica» версии 7. Для электронной микроскопии кусочки сетчатки фиксировали в 2%–ном р-ре глютарового альдегида
на какодилатном буфере (рH 7,2-7,4), постфиксировали в 1%–ном рре четырехокиси осмия на том же буфере.
Заливали в эпон-812. Cрезы получали на ультрамикротоме LKBIII 8800 (Швеция) и контрастировали 2%–ным водным раствором
уранилацетата и цитратом свинца по Рейнольдсу, изучали в электронном микроскопе JEM-СХ II (Япония).
Результаты нашего исследования показали, что кроме признаков
дегенерации клеток пигментного эпителия сетчатки глаза у крыс
WAG/Rij с генотипом А1А1 и с генотипом А2А2 по локусу TAG 1A
DRD2 выявляются выраженные признаки деструктивных процессов
нервных клеток и их отростков почти во всех слоях сетчатки. В сетчатке глаза крыс обоих генотипов изменениям подвергались фоторецепторные клетки, многие нейроны внутреннего ядерного слоя, менялась структура глиальных клеток Мюллера.
O'Steen W.K. и Donnelly J.E. [5] предполагают, что одной из причин дегенерации слоя пигментного эпителия сетчатки у крыс линии
WAG/Rij может являться недостаточное количество правильно функционирующих глиальных клеток сетчатки.
В свою очередь патологические изменения в глубоких слоях сетчатки могут обьясняться дисфункцией подвергшихся дегенерации
клеток пигментного эпителия [2, 3]. Выпадение любой из функций
клеток пигментного эпителия обычно приводит к патологическим
процессам в сетчатке и, как следствие, расстройству функций зрительной системы глаза. Исследование структурной организации сетчатки глаза крыс WAG/Rij с генотипом А1А1 и с генотипом А2А2 по
локусу TAG 1A DRD2 показало, что наряду с общими признаками гистологического строения можно отметить и ряд особенностей, по которым сетчатка глаза крыс отличаются друг от друга. Так нами выявлено, что процессы деструкции клеток во всех слоях сетчатки более
выражены у крыс с генотипом А2А2.
Хотя анализ полученных морфометрических показателей особо
выраженных различий между двумя аллелями не выявил. Достоверно
значимо отличались только наружный сетчатый слой и слой внешних
сегментов фоторецепторных клеток (p<0,001). Данные слои сетчатки
глаза были шире у крыс с генотипом А2А2.
Так как деструктивные процессы в данной группе морфологически были более выражены, то можно было полагать, что и увеличение
ширины названных слоев происходило за счет проявления отечных
процессов.
Таким образом, во всех слоях сетчатки крыс линии WAG/Rij с
генотипом А2А2 по локусу TAG 1A DRD2 морфологические признаки
деструктивных клеточных процессов, обычно приводящих к дисфункции тканей и органа, более выражены, чем у крыс с генотипом
А1А1. Это может быть связано с более выраженной функциональной
недостаточностью дофаминэргической системы нервной ткани крыс
генотипа А2А2 по сравнению с крысами генотипа А1А1.
Литература:
1. Ахмадеев, А.В., Калимуллина Л.Б. Морфогенез палеоамигдалы
крысы в раннем ювенильном периоде [Текст]/ А.В. Ахмадеев, Л.Б.
Калимуллина /Морфология, 2008, т.134, № 6, С.23-27.
2. Муслимов, С.А. Морфологические аспекты регенеративной
хирургии [Текст] / Уфа: Башкортостан, – 2000. – 168 с., илл. 48 с.
3. Панова,И.Г. Цитоструктура и цитохимия пигментного эпителия сетчатки [Текст]: Серия биологическая. №2. 1993. С. 165-190.
4. Rivas, M.A., Vecino, E. Animal models and different therapies for
treatment of retinitis pigmentosa ⁄⁄ Histol. Histopathol.– 2009.– Vol. 24.–
No. 10.– P. 1295-1322.
5. O´Steen, W.K., Donnelly, J.E. Chronologic analysis of variations in
retinal damage in two strains of rats after short-term illumination. Invest.
Ophthalmol. Vis. Sci. 1982 Feb; 22(2):252-255.
УДК: 636.087.74
ПРИМЕНЕНИЕ ПРОБИОТИКОВ НА ОСНОВЕ ШТАММОВ
BACILLUS SUBTILLIS В РАЦИОНАХ ТЕЛЯТ
А.А. Башаров, Ф.С.Хазиахметов
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
Современное состояние животноводческих отраслей в связи с
нарастающим требованием к условиям производства и качеству производимой продукции обусловлено научным подходом сплочения и
кооперирования технологических процессов с биологическими особенностями организма животных.
В этих условиях проблема повышения экологической безопасной
животноводческой продукции возможно за счет обоснованных знаний в области биотехнологий.
Поэтому ее последние достижения уже стали крайне важными
для здоровья и благополучия человека. Ведь значительную роль в создании продуктивного стада сельскохозяйственного скота определенное значение имеет целенаправленная и оздоровительная культура
выращивания молодняка.
Сравнительно недавно в практике по выращиванию молодняка
животных, в частности телят, находят решение от проблем расстройств и заболеваний пищеварительной системы - биологические
препараты, на основе живых и инактивированных бактерий, сторонников нормальной микрофлоры желудочно-кишечного тракта - пробиотики.
Исходя из поставленной нами цели было сформированы четыре
подопытные группы телят по 10 голов в каждой по принципу аналогов, где трем опытным группам задавали пробиотики с молоком, а затем с ЗЦМ в следующих дозах: 1-опытная - 2*107 КОЕ, 2-опытная 108 КОЕ и 3- опытная - 5*108 КОЕ на каждые 10 кг живой массы теленка. Длительность дачи препарата устанавливали сроком 6-7 дней,
с последующим недельным перерывом, потом снова вводили пробиотики циклами до 3 мес. жизни. В то же время во всех группах условия
кормления и содержании не различались.
Увеличение живой массы телят свидетельствовало в повышении
абсолютных и среднесуточных приростов телят опытных групп. Данные значение были наивысшие во 2 и 3 опытных группах, которые
соответственно превосходили по абсолютному приросту на - 4,4 кг (
10,6 %, Р<0,001) и 3,15 кг (7,6%, Р<0,01), по среднесуточному приросту на - 72,6 г или 10,6 % ( Р<0,001) и 52 г или 7,6 % (Р<0,01) аналогов в контрольной группе. В 1-ой опытной группе эти показатели были ниже на - 3,25 кг (7,1%) и 2,0 кг (4,5%); 53,6 г и 33 г, соответственно, по сравнению чем в 2 и 3 опытных группах, но больше контроля.
Благодаря чему телята опытных групп имели большее соответствие к
плану роста, что является результатом их целенаправленного выращивания.
Следовало отметить, что интенсивность роста телят зависело от
морфологических и биохимических состава крови, которые находился
во всех группах в пределах физиологических норм. Но все же телята
опытных групп отличались незначительным повышением в крови ко-
личества эритроцитов, содержания гемоглобина и высокой интенсивностью белкового обмена, однако эти отличия в были недостоверны.
Повышение содержание белка в сыворотке крови опытных телят
объяснялось, видимо, с большей пищевой активностью и лучшим перевариванием и использованием азотной части протеина. Что подтверждалось достоверным (Р<0,05) увеличением альбуминовой фракции
белка крови в 1 и 2 опытных группах на 5,7% и 6,9%, соответственно.
Более того, используемые пробиотики стимулируя в организме
телят биологически активные компоненты неспецифической резистентности, способствовали нормализации физиологических функций, уменьшая токсическое и дегидратационое влияние патогенных
бактерий, оказывая положительное действие на иммунный статус через гуморальные и клеточные факторы.
Клеточные факторы, которые в основном представлены Т-системами лимфоцитов и макрофагами, обеспечивали высокую ответную реакцию организма на проникновение инфекционного агента, что выражалось в повышении фагоцитарной активности в опытных группах в
среднем 2,3-7,7%, одновременном снижении количества Т-лимфоцитов
по сравнению с телятами контрольной группе. Изменения наблюдались
также в уровне иммуноглобулинов, что свидетельствовало в увеличении IgG и IgM, что обеспечивало хорошие адаптационные и защитные
свойства организма телят опытных групп. Циркулирующие иммунные
комплексы в опытных группах снизились в среднем 0,5-2,6%, что говорит о снижение воспалительных процессов в организме телят.
В заключении необходимо отметить, что выращивании телят с
использованием современных биопрепаратов на основе инновационных биотехнологий имеет важную практическое значение с целью
более полного реализации генетических задатков организма животного и формировании полноценного продуктивного стада для дальнейшего воспроизводства.
Литература:
1. Гимранов В.В. Состояние иммунного статуса у крупного рогатого скота при раневом процессе/В.В.Гимранов, И.З.Юсупов// Известия Оренбургского ГАУ .-2011.-№2(30).-С.81-82.
2. Данилевская, Н.В. Фармакологические аспекты применения
пробиотиков [Текст]/ Н.В. Данилевская //Ветеринария. -2005. - №11. С. 6-10.
3. Елинов, Н.П. Основы биотехнологии СПБ: Наука, 1995. - 168 с.
УДК 619:618.19+636.7:611.6
НЕОАДЬЮВАНТНАЯ ХИМИОТЕРАПИЯ РАКА МОЛОЧНОЙ
ЖЕЛЕЗЫ ТРЕТЬЕЙ СТАДИИ КОШЕК
И.В. Бекашева, А.Н. Мартынов, В.Г. Турков
ФГБОУ ВПО Ивановская ГСХА им. академика Д.К. Беляева,
г. Иваново
Рак молочной железы 3 стадии имеет высокий метастатический
потенциал и отличается неблагоприятным прогнозом с медианой
продолжительности жизни только при одном хирургическом лечении
4-9 месяцев [2,4]. В настоящее время рак молочной железы в ветеринарии рассматривается, как диссеминированный процесс, так как
субклинические микрометастазы могут определяться уже на ранних
этапах заболевания [3].
Проведение радикального оперативного вмешательства затруднено из-за объема и состояния опухолевой ткани, а также сроков обращения. Системный характер опухолевых поражений требует проведения системной химиотерапии в предоперационный и постоперационный период.
Неоадьювантная химиотерапия (НАХТ) нацелена на подавление
или уничтожение возможно существующих микрометастазов,
уменьшения размеров первичной опухоли, а также дает ряд преимуществ, в плане последующего оперативного лечения. НАХТ позволяет перевести опухолевое образование из нерезектабельного в резектабельное. На современном этапе развития онкологии НАХТ является
неотъемлемым компонентом лечения пациентов с нерезектабельными
новообразованиями, позволяет проводить оперативные вмешательства в более абластичных условиях и не влияет на частоту послеоперационных осложнений.
Цель и задачи исследования: Оценить эффективность НАХТ рака
молочной железы 3 стадии кошек, нерезектабельных форм.
Количество случаев рака молочной железы у кошек ежегодно
возрастает, так в 2009 году рак диагностировали у 0,83% (9) кошек и
0,084% (1) котов от общего числа принятых кошек и котов в лечебнопрофилактическом и лабораторно-диагностическом ветеринарном
центре «Ветасс» при ФГБОУ ВПО «Ивановской ГСХА имени академика Д.К. Беляева». В 2010 году этот показатель составил 1,39% (11)
кошек, а в 2011году – 4,92% (49) кошек и 0,082% (1) котов. Инвазивный протоковый рак составил 72,86% от общего числа злокачествен-
ных новообразований молочной железы у кошек и котов. Позднее обращение владельцев приводит к выявлению рака молочной железы на
поздних стадиях. Так основная масса образований приходилась на 3
стадию. Стадирование проводили по системе TNM [1] по результатам
комплексного исследования.
Исследование проведено на 9 кошках с диагнозом рак молочной
железы 3 стадии. При поступлении всем животным проводили стандартные исследования, которые включали в себя: осмотр, сбор
анамнеза, клиническое исследование, рентгенографию грудной клетки, УЗИ брюшной полости, гематологические, биохимические исследования и цитологическое исследование ткани молочной железы.
Гематологические исследования проведены на автоматическом
гематологическом ветеринарном анализаторе BC-2800Vet, биохимические исследования на биохимических полуавтоматических анализаторах BA-88A и BioChem BA. С целью достижения резектабельности опухоли перед операцией животным была проведена НАХТ в монорежиме, препаратом доксорубицин 30 мг/м2 , инфузия проводилась
в течение 1 часа однократно. Через 14 дней было проведено повторное клиническое исследование животных, гематологическое исследование крови и вторая НАХТ.
При повторном осмотре критерием эффективности было: снижение или отсутствие экссудации с изъязвлённой поверхности опухолевой массы, снижение объема опухолевой массы, состояние железистой
ткани молочной железы. Средний возраст исследуемых животных составил 13,94±3,64 лет (CV=26,11%). Количество короткошерстных
кошек в группе составило 77,78%. Породную предрасположенность
проследить трудно (1 кошка сиамской породы, 8 кошек метисы), т.к.
выборка кошек мала. Стерилизованых кошек в группе оказалось
44,44%, тогда как не стерилизованных 55,56%. Стерилизация кошек
проведена в возрасте старше 11 лет. У 44,44% кошек использовали
средство гормональной контрацепции. У 55,56% кошек в анамнезе беременность и роды. У 11,11% кошек отмечались осложнения после
родов – задержание последа. У 33,33% ранее выявлялись новообразования на молочной железе, больше года назад, которые были удалены
оперативно, без последующего гистологического исследования.
Всем кошкам был установлен диагноз РМЖ 3 степени. Средний
размер опухолевого узла составил 4,11±1,27 см (CV=30,9%). У
77,78% кошек поверхность образования была бугристая, ограниченная (55,56%), подвижная (66,67%), плотной консистенции (88,89%), В
55,56% случаев кожа над образованием не смещалась, была напряжена (44,44%) и изъязвлена (66,63%). Тотальное поражение молочной
железы наблюдалось у 33,33% кошек. Лимфатические узлы были поражены у 44,44% кошек.
Паховые лимфатические узлы были поражены у 25,0%, подмышечные лимфатические узлы у 25,0% кошек, и у 50,0% кошек были
поражены и подмышечные и паховые лимфатические узлы. Рентген
легких и УЗИ брюшной полости при первичном исследовании не выявили очагов метастазирования. При первичном исследовании у
22,22% кошек выявляли лейкоцитоз и нейтрофилию, увеличение общего белка у 55,56% и снижение количества альбумина у 66,63%,
щелочная фосфатаза была увеличена у 44,44% кошек.
После НАХТ была отмечена грануляция и уменьшение экссудации в области изъязвления опухолевых узлов, уменьшение опухолевой массы. У всех больных кошек с ранее выявленным лейкоцитозом
отмечалось снижение количества лейкоцитов в крови до нормальных
значений. Признаки гастро-токсичности у кошек выявлены не были.
Выводы: 1. Отмечена тенденция к росту случаев рака молочной
железы кошек. 2. Около 50% кошек с раком молочной железы 3 стадии на момент установления диагноза имели поражения лимфатических узлов. 3. Использование доксорубицина в дозе 30 мг/м2 с интервалом в 14 дней не вызывает у кошек с раком молочной железы 3
стадии признаков гемато- и гастро-токсичности. 4. Использование
НАХТ позволяет достигнуть резектабельности опухолей молочной
железы 3 стадии у кошек.
Литература:
1. Международная гистологическая классификация опухолей домашних животных [Текст]// Бюллетень Всемирной организации здравоохранения, 1977. – Т.53. - февраль №2 – 3, с. 121 – 264,
2. Фомичева, Д.В. Возможности таксотера в послеоперационной
химиотерапии рака молочной железы кошек [Текст ]/В кн. Сборник
тезисов 6 всерос.конф. по вопросам онкологии и анестезиологии домашних животных/ - 2010 – С. 19 – 21.
3. Якунина, М.Н. Рак молочной железы у собак и кошек [Текст] /
М.Н.Якунина, В.А.Голубева, Д.В. Гаранин// М.: ЗООМЕДЛИТ, КолосС, 2010. – 79с.
4. Mac Ewen E.G., Hayes A.A., Harvey H.J. et al. Prognostic factors
for feline mammary tumors//J. Am.Vet.Med.Assoc. – 1984. – V.185.P.201 – 204.
УДК 636.2.053.087.8
ЕСТЕСТВЕННАЯ РЕЗИСТЕНТНОСТЬ МОЛОДНЯКА
КРУПНОГО РОГАТОГО СКОТА ПРИ ИСПОЛЬЗОВАНИИ
ПРОБИОТИЧЕСКОЙ КОРМОВОЙ ДОБАВКИ
Вагапов Ф.Ф., Ибатова Г.Г.
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
Организм животного в процессе роста и развития подвергается постоянному воздействию факторов внешней среды. При помощи механизмов адаптации животное старается противостоять им. Способность
животного организма противостоять воздействию факторов внешней
среды, являющихся в отдельных случаях сильнодействующими стрессфакторами или стрессорами, называется естественной резистентностью.
Состояние естественной резистентности определяют неспецифические защитные факторы организма животных, органично связанные с их видовыми, конституциональными и индивидуальными особенностями и формирующими иммунитет. В оценке уровня резистентности большое значение имеет определение гуморальных факторов защиты, таких как бактерицидная активность сыворотки крови
(БАСК), содержание лизоцима и бета-лизинов, а также изменение их
количества и соотношения в связи с сезоном года и возрастом.
Согласно теме исследования научно-хозяйственный опыт проводили в 2011-2012 гг. в колхозе «Герой» Чекмагушевского района республики Башкортостан. Объектом исследования являлись бычки черно-пестрой породы, которые в 6-месячном возрасте по принципу
групп-аналогов были разделены на 4 группы по 10 голов в каждой. В
кормлении бычков I (контрольной) группы использовали основной
рацион. Бычкам II (опытной) группы дополнительно к основному рациону вводили 0,35 г пробиотической кормовой добавки «Биогумитель» на 1 кг корма, III (опытной) группы- 0,70 г на 1 кг корма, IV
(опытной) группы - 1,00 г на 1 кг корма.
Естественную резистентность организма бычков оценивали зимой (в феврале) и летом (в июле) путем определения бактерицидной
активности сыворотки крови (БАСК) по методике О.В. Смирновой,
Т.А. Кузьминой в модификации О.В. Бухарина, А.В. Созыкина
(1979), активности лизоцима-пробирочным методом по К.А. Каграмановой, З.В. Ермолаевой (1968) в модификации О.В. Бухарина
(1971), бета-лизинов – ускоренным фотонефелометрическим методом
по О.В. Бухарину, Б.А. Фролову, А.П. Лиде (1972).
Анализ полученных данных свидетельствует, что у бычков показатели бактерицидной активности сыворотки крови зимой были выше, чем летом. Это обусловлено активизацией иммунной защиты молодняка в зимний период в ответ на воздействие неблагоприятных
факторов внешней среды (таблица 1).
Таблица 1 Показатели естественной резистентности бычков
Группа
БАСК, %
X S
Cv, %
x
I
II
III
IV
70,8±1,78
73,8±1,82
75,6±1,91
77,0±1,92
3,56
3,50
3,57
3,53
Показатель
лизоцим, мкг/мл
X S
Cv, %
Зима
x
3,2±0,11
3,5±0,12
3,6±0,09
3,8±0,10
β-лизины, %
X S
Cv, %
x
4,88
5,01
3,63
3,82
16,6±0,52
17,0±0,58
17,4±0,50
19,2±0,53
4,46
4,85
4,08
3,93
4,92
6,81
6,29
5,81
15,6±0,27
15,8±0,35
17,0±0,25
17,1±0,26
2,46
3,17
2,06
2,17
Лето
I
II
III
IV
64,8±1,85
66,5±1,84
69,5±1,61
66,7±1,62
4,03
3,92
3,28
3,44
2,2±0,08
2,8±0,13
2,4±0,11
2,6±0,11
В летний период условия внешней среды более благоприятные и,
судя по уровню бактерицидной активности сыворотки крови, защитные
силы организма снижаются. При этом уменьшение величины изучаемого показателя у бычков I (контрольной) группы составляло 6,0%, II
группы -7,3%, III группы – 6,1%, IV группы – 10,3%. Характерно, что
преимущество по бактерицидной активности сыворотки крови во всех
случаях было на стороне бычков опытных групп, получавших в составе
рациона пробиотическую кормовую добавку «Биогумитель». Достаточно отметить, что бычки I (контрольной) группы уступали сверстникам II группы по уровню БАСК в зимний период на 3,0%, в летний период – на 1,7%, молодняку III группы соответственно на 4,8% и 4,7%,
IV группы – на 6,2 % и 1,9%. Характерно, что максимальной величиной
изучаемого показателя в зимний период отличались бычки IV группы,
которые превосходили сверстников II и III групп по уровню БАСК на
3,2% и 1,4% соответственно. В летний период лидирующее положение
занимали бычки III группы, получавшие в составе рациона пробиотическую кормовую добавку «Биогумитель» в дозе 0,70 г на 1 кг корма. Их
преимущество в анализируемый сезон года над сверстниками II группы
составляло 3,0%, молодняком IV группы – 2,8%.
Известно, что лизоцим является одним из важнейших факторов
естественного иммунитета животных. Полученные нами данные свидетельствуют о достаточно высоком его содержании в сыворотки
крови бычков всех групп. При этом отмечено снижение его уровня в
летний период по сравнению с зимним у молодняка всех групп. Так у
бычков I (контрольной) группы величина изучаемого показателя к лету снизилась на 1,0 мкг /мл (31,2%), II группы – на 0,7 мкг/мл
(25,0%), III группы – на 1,2 мкг/мл (50,0%), IV группы – на 1,2мкг/мл
(46,1%). Установлены и межгрупповые различия по уровню лизоцима, как в зимний, так и в летний периоды. Во всех случаях преимущество было на стороне бычков опытных групп. Достаточно отметить,
что молодняк I (контрольной) группы уступал им по величине изучаемого показателя в зимний период на 0,3-0,6 мкг/мл (9,4-18,7%), а летом – на 0,2-0,6 мкг/мл (9,1-27,3%). Характерно, что в зимний период
более высокой устойчивостью к микроорганизмам отличались бычки
IV группы, которые превосходили сверстников II и III групп по уровню лизоцима на 0,3 мкг/мл (8,6%) и 0,2 мкг/мл (5,5%) соответственно.
В летний период преимущество по величине изучаемого показателя
было на стороне бычков II группы, которое над молодняком III группы составляло 0,4 мкг/мл (16,7%) и 0,2мкг/мл (7,7%).
Сезонная динамика активности бета-лизинов аналогична изменениям бактерицидной активности сыворотки крови и лизоцима. В то
же время величина ее снижения у бычков всех групп была существенно ниже. Так у молодняка I (контрольной) группы активность
бета-лизинов в летний период по сравнению с зимним снизилась на
1,0%, II группы - на 1,5%, III группы – на 0,4%, IV группы – на 2,1%.
При этом лидирующее положение по величине изучаемого показателя занимали бычки опытных групп. Достаточно отметить, что молодняк I (контрольной) группы уступал в зимний период по активности бета-лизинов сверстникам II группы на 0,4%, III-группы на 0,8%,
IV группы – на 2,6%, а летом соответственно на 0,2%, 1,4% и 1,5%.
Характерно, что лидирующее положение по активности бета-лизинов
занимали бычки IV группы, получавшие в составе рациона пробиотическую кормовую добавку в дозе 1,0 г на 1 кг корма. Так сверстники II
и III групп уступали им по величине изучаемого показателя в зимний
период на 2,2% и 1,8%, а летом – на 1,2% и 1,3% соответственно.
Следовательно, введение в рационы кормления бычков черно-пестрой породы при интенсивном выращивании и откорме пробиотической
кормовой добавки «Биогумитель» способствует существенному повышению естественной резистентности, о чем свидетельствует уровень
бактерицидной активности сыворотки крови, лизоцима и бета-лизинов.
УДК 636.21.081.25
ИММУНОГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА
РАЗНЫХ ПОРОД КРУПНОГО РОГАТОГО СКОТА
РЕСПУБЛИКИ БАШКОРТОСТАН
Ф.Р. Валитов, Э.И. Ильясова, И.Ю. Долматова
ФГБОУ ВПО Башкирский государственный аграрный университет, г. Уфа
Обеспечение населения страны качественными продуктами питания невозможно без увеличения продуктивности сельскохозяйственных животных. Для этого, наряду с созданием надежной кормовой базы и прогрессивной технологии содержания животных необходимо использовать совершенные методы племенной работы при создании высокопродуктивных стад, типов, пород животных, устойчивых к различным заболеваниям, стрессам и пригодных к машинному
доению. Повышение генетического потенциала продуктивности животных невозможно без знания генотипа и его точной и надежной
оценки. Именно генотип определяет племенные качества сельскохозяйственных животных, так как они обусловливаются комплексом
унаследованных генов.
Для оценки генотипа животных привлекаются различные методы,
оказавшиеся возможными благодаря развитию популяционной, биохимической, цитогенетической и иммунологической генетики [1,2].
Целью настоящего исследования являлся сравнительный анализ
частот встречаемости эритроцитарных антигенов крови популяций
крупного рогатого скота разных пород.
Объектом изучения служили племенные коровы маточного поголовья черно-пестрой (n=6362), симментальской (n=2466), бестужевской (n=1145), голштинской (n=706), герефордской (n=414) и лимузинской (n=44) пород из 77 племенных хозяйств Республики Башкортостан.
Группы крови определяли стандартными серологическими тестами с использованием 54 моноспецифических сывороток. Частота
антигенов, аллелей и генотипов в популяциях животных вычислены
согласно методике А.М. Машурова и др [4].
Индекс генетического сходства популяции рассчитали при помощи формулы Маяла и Линдстерема [2].
Сравнивая генотипическую структуру 6 пород разводимых в
республике, можно наблюдать как сходство частот антигенов, так и
их различие (рис.1).
L
U
H…
S…
S…
Черно-пестрая
A…
A…Z'
U…Zn=6363
1.00
H…
B…
U…
0.80
0.60
J
0.40
V
F
0.20
М
L'
0.00
X…
X…
W
R…
E
C…
C…
G…
G…
B…
Y' G…
I'
Q…P… O…K' J…
B…
G…
G…
G…
I1
I2
K
O…
O…
P…
Q
P…
T…
T…
Y…
A…
B'
D…
E…
E…
G…
L
U
H…
S…
S…
L
J
H'
S…
S…
U
U'
Герефордская
A…
A…Z'
U…Zn=414
1.00
H…
B…
0.80
0.60
0.40
V
F
0.20
М
L'
0.00
X…
X…
W
R…
E
C…
C…
G…
G…
B…
Y' G…
I'
Q' P… O' K' J…
B…
G…
G…
G…
I1
I2
K
O…
O…
P…
Q
P…
T…
T…
Y…
A…
B'
D'
E…
E…
G'
0.80
0.60
0.40
V
F
0.20
М
L'
0.00
X…
X…
W
R…
E
C…
C…
G…
G…
B…
Y' G…
I'
Q…P… O…K…J…
B…
G…
G…
G…
I…
I…
K
O…
O…
P…
Q
P…
T…
T…
Y…
A…
B…
D…
E…
E…
G…
Голштинская
A…
n=706
A…Z'
U… Z
1.00
U…H…
B…B…
G…
G…
0.80
G…
I1
0.60
L
I2
J
K
0.40
V
O…
F
O…
0.20
М
P…
L'
Q
0.00
X…
P…
X…
T…
W
T…
R…
Y…
E
A…
C…
B'
C…
D…
G…
E…
G…
E…
B…
G…
Y' G…
I'
J…
Q… P… O…K'
U…
J
Бестужевская
A…
n=1145
A…Z'
U… Z
U
H…
S…
S…
Симментальская
A…
A…Z'
U…Z n=2466
1.00
H…
B…
H'
S…
S…
U
0.80
U' H…
0.60
L
0.40
J
V
F
М
L'
X…
X…
W
R…
E
0.20
0.00
C…
C…
G…
G…
B…
Y' G…
Q… P… O' K'
B…B…
G…
G…
G…
I1
I2
K
O…
O…
P…
Q
P…
T…
T…
Y…
A…
B'
D'
E…
E…
G'
J… I'
Лимузинская
A…
n=44
A…Z'
U…Z
1.00
B…B…
G…
G…
0.80
S2
G…
S1
I1
0.60
L
I2
J
K
0.40
V
O…
F
O…
0.20
М
P2
L'
Q
0.00
X2
P1
X1
T1
W
T2
R…
Y2
E
A…
C…
B'
C…
D'
G…
E…
G…
E…
B''
G'
Y' G…
I'
Q' P… O' K' J…
H'
U
U' H…
Рисунок 1 Частота антигенов групп крови крупного рогатого скота
разных пород Республики Башкортостан
По всем породам наблюдается высокая концентрация антигенов
F (0,76-0,98) и А2 (0,42-0,79). Черно-пестрая и бестужевская порода
отличаются от других сравниваемых пород высокой концентрацией
антигена С1 (0,46-0,55); симментальская порода - антигенов H', C2 и
А1 (0,44-0,62), герефордская порода - E,Y2,C2 (0,61-0,70) и лимузинская порода - H',E3' W (0,73-0,93).
Выявленное сходство и различие пород, выраженное индексом
сходства по антигенам групп крови, представлено в таблице 1.
Таблица 1 Индекс генетического сходства между породами, r
Порода
Симмен- Бестужев- Голштин- Герефорд- Лимузинтальская
ская
ская
ская
ская
Черно0,929±0,035 0,937±0,033 0,907±0,040 0,850±0,049 0,801±0,056
пестрая
Симменталь0,910±0,039 0,886±0,043 0,843±0,050 0,801±0,056
ская
0,886±0,043 0,853±0,049 0,790±0,057
Бестужевская
0,838±0,051 0,792±0,057
Голштинская
0,776±0,059
Герефордская
Установлено, что молочные черно-пестрая и голштинская породы по антигенной структуре ближе к комбинированным симментальской и бестужевской породам и более отдалены от мясных герефордской и лимузинской пород. Различия между породами по индексу генетического сходства достоверны (р<0,05).
Индекс генетического сходства показал, что породы молочного
и комбинированного направления продуктивности по сравнению с
мясным направлением имеют более высокие антигенные отличия
между собой, чем животные одного направления продуктивности.
В процессе селекции животных в каждой породе и популяции
формируется свой генофонд и определенные генотипы по группам
крови, характеризующие стадо.
Литература:
1. Гончаренко, Г.М. Генетика на службе у селекционеров
[Текст] / Г.М. Гончаренко // Сибирский вестник сельскохозяйственной науки.–2005.–№ 4.–С 57–63.
2. Деева, B.C. Группы крови крупного рогатого скота и их селекционное значение [Текст] / B.C. Деева, И.О. Сухова // РАСХН.
Сиб. отд-ние. СибНИПГИЖ. - Новосибирск, 2002. - 172 с.
3. Максимова, А. Использование иммуногенетических маркёров
при выведении внутрипородного типа айрширского скота [Текст] / А.
Максимова, И. Петрачкова, Т. Шульга // Молочное и мясное скотоводство. - 2008.-№5.-С.33-38.
4. Машуров, А.М. Алгоритмы иммунобиохимической генетики
[Текст]: учеб.-метод. пособие / А.М. Машуров, Н.О. Сухова, Р.О. Царев, Х.Х. Тхань. – Новосибирск, 1998. – 112 с.
УДК 619:591.156:636.2
ИЗУЧЕНИЕ ПОЛИМОРФИЗМА МИКРОСАТЕЛЛИТНЫХ
ЛОКУСОВ ЛОШАДЕЙ БАШКИРСКОЙ ПОРОДЫ
К.П. Гайнуллина, Л.Н. Юнусова, А.А. Юрьева
ГНУ Башкирский НИИ сельского хозяйства Россельхозакадемии, г. Уфа
По численности лошадей Республика Башкортостан занимает второе место после Республики Саха (Якутия) в Российской Федерации (по
данным Росстата на 1 января 2011 г.). Одной из плановых пород является башкирская порода лошадей [1]. Она сформировалась на территории
Южного Урала и в прилегающих степных районах. Свое происхождение башкирская лошадь ведет от низкорослых лошадей древних кочевников и местных лесных форм. Начиная с XIX века и до 50-х годов ХХ
века, на конское поголовье Башкирии заметное влияние оказывают заводские породы [2]. Это привело к формированию в различных регионах республики неоднородных в генетическом отношении массивов с
различным уровнем хозяйственных признаков, трудно поддающихся
селекционному прогнозу. В связи с этим изучение генетической структуры башкирской породы лошадей является актуальным и имеет основополагающее значение в совершенствовании этой породы. На сегодняшний день самым эффективным, информативным и достоверным методом, используемым в фундаментальных и прикладных исследованиях,
является применение ДНК-маркеров, в частности, микросателлитов [3].
Целью данной работы послужило изучение ДНК-полиморфизма
башкирской породы лошадей. Для достижения цели были поставлены
следующие задачи: 1) определить частоту встречаемости и выявить
генотипы, наиболее характерные для лошадей башкирской породы;
2) отобрать потенциально информативные микросателлитные локусы
для башкирской породы лошадей; 3) определить минимальное количество маркеров, необходимых для однозначной идентификации лошадей башкирской породы.
Работу проводили в лаборатории молекулярно-генетической
экспертизы ГНУ БНИИСХ. Материалом для исследования послужило
поголовье лошадей башкирской породы ООО «Башагроген» Кушнаренковского района РБ (n=60). Тотальную ДНК выделяли из лимфоцитов периферической венозной крови с помощью коммерческого
набора «Genomic DNA Purification Kit» («Fermentas») согласно инструкции производителя. Для анализа было использовано 6 микросателлитных локусов: HTG10, AHT4, HMS3, HMS7, HTG4, ASB2, входящих в панель микросателлитов, рекомендованную ISAG (International Society of Animal Genetics). Полимеразную цепную реакцию
проводили в амплификаторе «ДТ-322» фирмы «ДНК-Технология» по
программе: денатурация при 94°C - 10 мин.; 30 циклов: денатурация
при 94°С - 30 сек., отжиг праймеров при 55°С - 30 сек., элонгация при
72°С - 1 мин.; конечная элонгация при 72°С - 30 мин. Продукты амплификации разделяли электрофоретически в 8% неденатурирующем
полиакриламидном геле при 300 В в течение 3-3,5 часов. Гель-документирование осуществляли с помощью видеосистемы «Gel Imager».
В результате молекулярно-генетического исследования 60 образцов ДНК лошадей методом SSR-PCR были получены данные по аллельному состоянию 6 микросателлитных локусов. На рисунке 1 представлена электрофореграмма продуктов амплификации локуса AHT4.
←аллель 7
аллель 4→
аллель 2→
←аллель 1
←аллель 1
←аллель 1
1 2 3 4 5 6 7 8 9 10 11
Рисунок 1 SSR-спектры некоторых образцов,
полученные при амплификации локуса AHT4
←аллель 1
В каждом из изученных локусов идентифицировано до 7 аллелей,
в среднем 6,0 аллелей на локус. Индекс полиморфности менялся от
0,59 (HMS7) до 0,75 (ASB2).Средний уровень полиморфизма составил 68%. Таким образом, все изученные нами микросателлитные
маркеры обладали высоким уровнем полиморфности, что обеспечивает их эффективность в контроле достоверности происхождения
лошадей башкирской породы. В результате анализа полученных данных были выявлены генотипы, наиболее часто встречающиеся у лошадей башкирской породы. Так, было установлено, что по локусу
HMS7 преобладал генотип 36 (82%), HMS3 – генотип 36 (60%), AHT4
– генотип 14 (53%), HTG10 - генотип 35 (52%), HTG4 – 14 (47%). Для
локуса ASB2 было обнаружено относительно равномерное распределение генотипов. Установлено, что для однозначной идентификации
исследованных нами образцов, было достаточно использовать 6 микросателлитных маркеров, то есть сочетание аллелей по исследованным нами локусам было уникальным для каждого образца.
Литература:
1. Башкортостан: Краткая энциклопедия [Текст]: — Уфа: НИ
Башкирская энциклопедия, 1996. — 672 с.
2. Развитие мясного табунного коневодства в России. Методические рекомендации [Текст]: ФГНУ «Росинформагротех». - М., 2007.
— 176 с.
3. Храброва, Л.А. Методические положения по использованию
ДНК-анализа лошадей для оценки генетических ресурсов в коневодстве [Текст]: / Л.А. Храброва и др. – Дивово, 2011. – 28с.
УДК 636.598.082.2
МЕЖПОРОДНОЕ СКРЕЩИВАНИЕ – ОСНОВА ПОВЫШЕНИЯ
ПРОДУКТИВНОСТИ ГУСЕЙ
Р.Р. Гадиев, А.Р. Фаррахов, Ч.Р. Галина
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
Птицеводство – это важная, динамично развивающаяся и перспективная отрасль животноводства. Наряду с ростом производства
продукции птицеводства немаловажное значение имеет улучшение ее
качества и расширение ассортимента, что должно осуществляться как
за счет селекционной работы, направленной на совершенствование
продуктивных и племенных качеств, создание новых пород, линий и
кроссов всех видов сельскохозяйственной птицы, так и путем полноценного сбалансированного кормления, внедрения высокоэффективных и ресурсосберегающих технологий.
Одним из приемов повышения мясной продуктивности птицы является использование эффекта гетерозиса, который проявляется при
скрещивании различных пород [1]. Гибридное потомство, как правило, превосходит родительские формы и имеет лучшее, чем у родителей развитие, повышенную жизнеспособность и продуктивность.
В связи с этим, целью наших исследований явилось изучение
продуктивных качеств гусей различных генотипов и их помесей.
Исследования были проведены на гусях белой венгерской, кубанской породы и их помесях в период 2010-2011 гг. в условиях ООО
«Башкирская птица». Технологические параметры выращивания,
кормления и содержания птицы соответствовали рекомендациям
ВНИТИП.
Для изучения роста и развития гусят по принципу аналогов было
сформировано 4 группы по 100 голов суточных гусят. В первой группе находился молодняк белой венгерской породы, во второй – кубанской, в третьей – помеси, полученные при скрещивании гусаков белой венгерской с гусынями кубанской породы, и в четвертой – помеси белых венгерских гусынь и кубанских гусаков. Во всех группах
птица находилась в одинаковых условиях кормления и содержания.
Продолжительность опыта составила 63 дня.
Показатели сохранности поголовья гусят представлены в табл. 1.
Таблица 1 Сохранность подопытного молодняка гусей, %
Группа
1
2
3
4
1-10
97,0
97,0
98,0
99,0
Возраст, дни
11-30
31-63
98,0
99,0
99,0
100,0
99,0
100,0
99,0
100,0
1- 63
94,0
96,0
97,0
98,0
За период выращивания сохранность гусят была на достаточно
высоком уровне, однако лучшими показателями обладали помесные
гусята, полученные в результате скрещивания белых венгерских гусынь с кубанскими гусаками, где сохранность составила 98,0%, что
Живая масса, г
на 4 и 2% была выше, чем у чистопородных гусят 1-й и 2-й групп, соответственно, и на 1% - чем у четвертой помесной группы.
Таким образом, скрещивание гусаков кубанской породы с белыми венгерскими гусынями оказывает положительное влияние на показатели сохранности гусят.
Одним из наиболее значимых показателей, характеризующих
рост и развитие сельскохозяйственной птицы, является живая масса,
которая относится к количественным признакам и предопределяется
наследственными особенностями, при этом важную роль играют
условия кормления и содержания [2].
На рисунках 1,2 представлены показатели живой массы подопытных гусят.
6000.0
5000.0
4000.0
3000.0
2000.0
1000.0
0.0
Группа
Опытная 1
Опытная 2
Опытная 3
Опытная 4
Возраст, недель
Рисунок 1 Динамика живой массы самцов
Живая масса, г
Как видно из рисунка 1, живая масса самцов в 9-недельном возрасте составила 5067,5 г, что на 672,8, 1156,3 и 300,8 г оказалось
больше, по сравнению со сверстниками 1-3 опытных групп, соответственно.
Такая же тенденция была выявлена и по динамике живой массы
самок.
5000.0
4000.0
Группа
3000.0
Опытная 1
Опытная 2
Опытная 3
Опытная 4
2000.0
1000.0
0.0
Возраст, недель
Рисунок 2 Динамика живой массы самок
При этом самые высокие среднесуточные приросты у гусей были
выявлены в 5-недельном возрасте. Так, в 4-й группе у самцов в данном возрасте этот показатель составил 118,1г, что на 16,0; 27,3 и 6,7 г
выше, по сравнению с чистопородными гусятами и помесями третьей
группы.
При изучении роста и развития птицы важно не только исследование динамики их живой массы, но и линейного роста организма в
целом, равно как и отдельных его частей. Рост не всегда сопровождается увеличением живой массы. В процессе общего роста отдельные
части тела, ткани и органы растут неравномерно в разные периоды,
что влечет за собой изменение с возрастом пропорции телосложения[3]. Для изучения более полной характеристики экстерьерных
особенностей гусят в различные возрастные периоды были проведены измерения статей тела.
В ходе опытов установлено, что наиболее высокие показатели
промеров были выявлены у самцов той же 4-й опытной группы. Так в
9-недельном возрасте разница составила: по обхвату груди по сравнению с венгерской белой породой – 5,3% (р<0,001), кубанской 6,2%, помесями 3-й группы – 1,9% , длине туловища – 4,9 (р<0,01),
5,9 и 2,0%, длине киля - 6,1 (р<0,01), 8,9 и 3,5%, соответственно. У
самок выявлена та же тенденция в изменениях промеров тела, как и у
самцов. У гусят 4-й опытной группы были также более выражены
мясные формы телосложения, по сравнению со сверстниками родительских форм и помесями третьей группы, о чем свидетельствовали
вычисления индексов телосложения.
Таким образом, с целью повышения жизнеспособности и продуктивных качеств гусят, выращиваемых на мясо, имеется целесообразность в скрещивании белых венгерских гусынь с кубанскими гусаками.
Литература:
1. Давтян, А.Д. Рекомендации по племенной работе в птицеводстве [Текст] /А.Д. Давтян, К.В.Злочевская, А.В.Егорова, Я.С Ройтер и
др.- Сергиев Посад.-2003.-135с.
2. Кочиш, М. Организация селекционно-племенной работы в
птицеводстве [Текст] // Птицефабрика. – 2006.–№11. - С.19.
3. Бессарабов, Б.Ф. Птицеводство и технология производства яиц
и мяса птицы [Текст] / Б.Ф. Бессарабов, Э.И. Бондарев, Т.А. Столяр.Учебник. 2-е изд., доп. – СПб.: Издательство «Лань», 2005. – 352с.
УДК 636.597.087.7
САПРОПЕЛЬ В РАЦИОНАХ УТЯТ
Р.Р. Гадиев, О.Л. Михайлова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
Важнейшей проблемой современного птицеводства остается повышение продуктивности и удешевление продукции за счет более
высокой эффективности использования питательных веществ корма.
В настоящее время при производстве птицеводческой продукции
расходы на корма составляют около 70% от всех затрат.
Рациональное использование кормовых ресурсов предполагает
поиск и введение в рацион птицы нетрадиционных видов кормов. Для
этого необходимо проведение всесторонних исследований их влияние
на различные функциональные системы организма. В первою очередь
такому обследованию при апробации нового кормового средства
подвергаются системы, обеспечивающие жизнеспособность. Несмотря на большое количество работ по этой проблеме, вопросы, состояния непосредственно системы устойчивости, изучены крайне недостаточно.
Сапропель, или озерный, прудовый ил - это ценный резерв местных органических удобрений, продукт донных органических и минеральных пресноводных отложений. Состав сапропелей различных
месторождений состоит в основном из разложившихся и неразложившихся остатков водных растений и животных.
В сельском хозяйстве сапропель известен как хорошая подкормка
для животных и как органо-минеральное удобрение. В сапропеле
удачно сочетаются макро- и микроэлементы, витамины, гуминовые
кислоты, биостимуляторы и другие, физиологически активные вещества.
Многочисленные исследования, проведенные в разные годы, показали, что включение сапропеля в рационы животных повышает
скорость роста молодняка, резистентность организма к неблагоприятным факторам, снижает затраты корма, стимулирует воспроизводительную функцию самок и самцов.
Сапропель содержит каротин, витамины Д, Е, В1, В2, В6, В12, С,
Р, кальций,фосфор,серу,железо: микроэлементы – йод, кобальт, медь,
марганец, бром , биологически активные вещества, а так же протаины
и белок необходимые для хорого роста животных. В составе сапропе-
лей содержаться вещества, стимулирующие пищеварение, сердечную
деятельность, усвоение и накопление питательных веществ, кроветворение, развитие здорового скелета и повышающие устойчивость
организма против болезней.
В тоже время данных по применению сапропеля в утководстве
недостаточно.
В связи с этим целью наших исследований явилось изучение роста и развития, мясных качеств утят при включении в состав комбикормов различных доз сапропеля.
Исследования проведены на утятах кросса «Благоварский» в период 2008 - 2009 гг. в условиях ГУП «Племптицезавод Благоварский».
Уровень кормления и содержания птицы соответствовали рекомендациям ВНИТИП.
Для изучения роста и развития, а также мясных качеств утят по
принципу аналогов было сформировано 5 групп по 100 голов суточных утят в каждой. В рацион опытной 1-ой группы добавляли сапропель из расчета 1,5% от массы комбикорма, во 2-ой – 3,0 %, а в 3 и 4
опытных группах по 4,5 и 6,0 % соответственно. Утята контрольной
группы сапропель не получали. Продолжительность опыта составила
49 дня.
Основным показателем, характеризующим жизнеспособность
птицы, при промышленном производстве мяса является сохранность
поголовья. При включении в рацион кормления утят различных доз
сапропеля сохранность птицы была на достаточно высоком уровне.
Наиболее высокая жизнеспособность птицы была отмечена во 3 и 4
опытных группах и составила 96%, против 94 % в контрольной группе.
Таким образом, включение сапропеля в рацион утят не оказывал
отрицательного влияния на показатели сохранности.
Живая масса утят в конце выращивания в опытной 4 группе составила 3286,7 г, что на 6,8 % больше, чем в контрольной.
В ходе балансового опыта было установлено, что введение в рацион утят сапропеля, оказывало положительное влияние на переваримость питательных веществ корма.
С увеличением уровня сапропеля до4,5 % от массы комбикорма
переваримость питательных веществ корма повысилась. Однако
дальнейшее увеличение объема сапропеля в рационах утят незначительно снизило переваримость питательных веществ комбикорма.
Основными показателями, характеризующими мясные качества
являются масса потрошенной тушки, выход съедобных частей и количество жира.
Полученные результаты выявили межгрупповые различия по показателям мясной продуктивности. Абсолютная масса потрошенной
тушки в опытных группах была выше по сравнению с контрольной
группой на 0,7 – 6,3 %.
По выходу съедобных частей утята опытных групп превосходили
сверстников контрольной групп на 0,3- 6,1 %. Достоверные различия
по выходу съедобных частей были выявлены в опытных 3 – 4 группах.
Таким образом, включение сапропеля в рацион утят способствует
повышению сохранности, роста и развития утят. Более высокие продуктивные качества были выявлены в опытных 3 – 4 группах.
Исходя, из проведенных исследований, можно отметить целесообразности включения сапропеля в рацион утят в объеме 3,0 – 4,5 %
от массы комбикорма
Литература
1. Гадиев, Р.Р. Применение сапропеля при выращивании гусят на
мясо [Текст] / Р.Р Гадиев, А.Р. Фаррахов, С.Г. Булатов, // Актуальные
вопросы селекции, генетики, воспроизводства, технологии и кормления сельскохозяйственной птицы в Республике Башкортостан / Сб.
науч. тр. (по материалам конференции, посвященной 10-летнему
юбилею ГППЗ «Благоварский») – Уфа, 2005. – С.19-21.
2. Крымский, С.С. Действие сапропеля на продуктивные показатели и уровень естественной резистентности утят [Текст] / С.С.
Крымский, В.Н. Хаустов // Аграрная наука — сельскому хозяйству:
материалы Международной научно-практической конференции. Барнаул: Изд-во АГАУ, 2006. - С. 97-100.
3. Хаустов, В.Н. Влияние сапропеля на продуктивные качества
утят на откорме [Текст] / В.Н. Хаустов, С.С. Крымский // Вестник
Алтайского государственного аграрного университета. - Барнаул:
Изд-во АГАУ, 2006. - № 1. — С. 26-29.
УДК636.2.082.263.35
РОСТ, РАЗВИТИЕ МОЛОДНЯКА КРУПНОГО РОГАТОГО
СКОТА РАЗЛИЧНЫХ ГЕНОТИПОВ КАППА-КАЗЕИНА
А.Р.Галлямова, У.Р.Гумеров, С.Г.Исламова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
Мясная и молочная продуктивность, ростовые и репродуктивные
качества, степень выраженности иммунного ответа контролируются у
животных большим количеством различных генов. В настоящее время в мире активно ведется поиск участков генома, имеющих
наибольшее влияние на хозяйственно-полезные признаки и иммунитет животных.
Исследований, касающихся связи генотипа животных по каппаказеину с ростом и развитием молодняка и их последующей продуктивностью, в литературе очень мало. В связи с этим целью нашей работы являлось изучение роста и развития молодняка бестужевской и
черно-пестрой пород в зависимости от генотипа по каппа-казеину.
У телят изучаемых пород в стаде генофондного хозяйства ООО
племзавод «Ленина» Дюртюлинского района республики Башкортостан выявлены три генотипа по каппа-казеину: АА, АВ и ВВ.
Из обследованных телят бестужевской породы с генотипом АА
выявлено 18 гол. (51,4%), с АВ - 11 гол. (31,4%) и с ВВ - 6 гол.
(17,1%). В группе молодняка черно-пестрой породы 13 гол. (37,1%)
животных имели генотип АА, 17 гол. (48,6%) - генотип АВ и 5 гол.
(14,3%) были с генотипом ВВ. Разная частота встречаемости аллелей
гена каппа-казеина подтверждает необходимость проведения генотипирования животных по данному локусу в практике селекционной
работы.
Существенной разницы по живой массе новорожденного молодняка между оцениваемыми генотипами не установлено. Независимо
от породы животных живая масса бычков до 18 мес с генотипом ВВ
по каппа-казеину была выше по сравнению с генотипами АА и АВ. В
то же время наибольшей ее величиной во все возрастные периоды характеризовались животные бестужевской породы.
В 3-месячном возрасте молодняк бестужевской породы с генотипами АВ и ВВ по живой массе достоверно превосходил своих
сверстников черно-пестрой породы на 9,3…10 кг (9,8…11,1%, P
0,05…0,01). В 18 мес преимущество бестужевских бычков с геноти-
пом ВВ над сверстниками с генотипами АА и АВ составило 2,8…15,8
кг (0,6…3,7%), черно-пестрых - 5,4…11,4 кг (1,3…2,7%) (P 0,05).
По живой массе в разрезе групп бестужевские и черно-пестрые
бычки были однородны (Cv = 2,13…5,14%).
Анализ динамики среднесуточного прироста показал, что за весь
период выращивания – от рождения до 18 мес более высоким его показателем отличались бычки бестужевской породы независимо от генотипа по каппа-казеину.
В возрастной период 0-3 мес они же характеризовались и
наивысшим показателем относительной скорости роста. В то же время более высокий изучаемый показатель имели бычки данной породы
с генотипом ВВ.
В остальные возрастные периоды относительная скорость роста
была выше у животных черно-пестрой породы по сравнению с бестужевскими сверстниками.
По высоте в холке и косой длине туловища бычки черно-пестрой
породы независимо от генотипа по каппа-казеину превосходили бестужевских. Достаточно отметить, что в 18-месячном возрасте их преимущество по высоте в холке составило 1,2…2,8 см (1,0…2,4%, P
0,001), косой длине туловища - 2,8…3,7 см (1,9…2,5%, P 0,05).
По остальным промерам молодняк черно-пестрой породы незначительно уступал бестужевским сверстникам. Так, в 18 мес. преимущество бестужевских бычков по глубине груди составило 0,8…1,9 см
(1,2…2,9%, P 0,05), ширине груди - 1,9…2,5 см (4,6…6,5%,
P 0,05…0,001) и ширине в маклоках - 1,3…2,1 см (3,0…5,2%,
P 0,01…0,001).
Аналогичная закономерность наблюдалась по величине обхвата
груди, обхвата пясти и полуобхвата зада (P0,05…0,01).
Анализ межгрупповых различий по величине промеров в зависимости от генотипа по каппа-казеину показал превосходство животных с генотипом ВВ обеих пород, причем по глубине и обхвату груди, полуобхвату зада и косой длине туловища разница достоверна
(Р0,05…0,001).
По индексу длинноногости и растянутости черно-пестрые бычки
независимо от генотипа по каппа-казеину имели преимущество над
бестужевскими. В 18 мес оно составило 1,5…2,7% и 0,1…1,1%
(P0,05) соответственно. По остальным индексам преимущество было на стороне бестужевских бычков. Они были более широкотелы, у
них явное преимущество по индексам сбитости на 3,0…3,3%
(P0,01…0,001) и мясности на 1,6…3,3% (P 0,05).
Таким образом, оценка экстерьера подопытных животных показала, что для них характерно гармоничное и пропорциональное телосложение, при этом им были присущи некоторые особенности. Так, в
межпородном аспекте черно-пестрые бычки были более растянуты и
высокорослы.
Для них характерны менее выраженные мясные формы, хотя
бычки с генотипом ВВ по каппа-казеину по грудному индексу, индексам сбитости, широкотелости и мясности несколько превзошли
своих сверстников с генотипами АА и АВ.
Животные бестужевской породы напротив характеризовались
более выраженными мясными формами, о чем свидетельствуют величины индексов телосложения, причем наиболее высокие их показатели присущи животным с генотипом ВВ по каппа-казеину.
В целях раннего прогнозирования продуктивности, которая, в
свою очередь, зависит от роста и развития молодняка, повышения
экономической эффективности производства молока и мяса мы рекомендуем проводить ДНК-генотипирование животных по аллелям
каппа-казеина.
УДК 636.597.082.1
ОЦЕНКА ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ
ВНУТРИПОРОДНЫХ ЛИНИЙ ПЕКИНСКИХ УТОК ПО ДАННЫМ
ПОЛИМОРФИЗМА МИТОХОНДРИАЛЬНОЙ ДНК
И.Н.Ганиева, И.Ю.Долматова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г. Уфа
Существует мнение [1,2], что в промышленных популяциях птиц
и животных, которые находятся в условиях изолированного содержания и под давлением отбора, происходит обеднение наличного генофонда и снижение генетической изменчивости.
Поэтому в практической селекционной работе необходимо следить за сохранением оптимального генного разнообразия и динамикой генетической изменчивости [2]. Количественная оценка указанных параметров может быть получена при использовании ДНК маркеров.
Митохондриальная ДНК эукариот представлена кольцевой молекулой размером от 15700 до 19500 пар нуклеотидов (пн), что в 2500
раз меньше наименьшей из геномных ДНК животных и локализована
внутри митохондриального матрикса [3]. Нуклеотидные последовательности митохондриальных ДНК стали уникальным ключом в изучении эволюции организмов. Наследуется митохондриальная ДНК
практически только от одного из родителей (в большинстве случаев
является нейтральным маркером материнской линии), а также в ней
точечные мутации закрепляются в значительно большей степени, чем
в ядерной ДНК.
Целью работы является оценка генетического разнообразия внутрипородных линий уток пекинской породы по данным ДНКполиморфизма митохондриального генома.
Материалом исследования послужили утки пекинской породы,
которые состоят из следующих линий: 1) М1 и М2 – соответственно
отцовская и материнская линии пекинских уток, кросс Медео; 2) Б1 и
Б2 – соответственно отцовская и материнская линии кросса «Благоварский»; 3) БЦ1 и БЦ2 – линии уток «Башкирской цветной» породы.
Исследовали участок мтДНК в участке, кодирующим вторую
субъединицу НАДН – дегидрогиназы (ND2), имеющей длину 1057
пар нуклеотидов. Для ПЦР использовали пару олигонуклеотидных
праймеров, синтезированныхфирмой “Синтол” (г. Москва):
1. 5/ - ACCCCAGTCCTAGTCCTCAGTCTC – 3/
2. 5/ - CTTCGGTTTAGGTGGGTGTTATCC - 3/
Для рестрикционного анализа участка ND2 использовали 4
эндонуклиазы рестрикции Alu I (AG^CT), BstDE I(прототип Dde I –
C^TNAG), Hae III (GG^CC) Hinf I (G^ANTC). Рестрикцию проводили
в соответствии с рекомендациями фирмы-производителя ферментов
(ООО «Сибэнзим»). 8,5 мкл. амплицициронного образца инкубировали в течении 12 часов с 2,5 мкл рестриктазы в соответствующем с использованием ТВЕ-буфера, окрашивали бромистым этидием и выявляли в УФ-свете. В качестве маркёров молекулярной длины использовали маркёрные наборы фирмы «Сибэнзим» PBR322/Alu I и
pUC19/Msp I.
Митотипическое разнообразие (h) рассчитывали согласно методике, предложенной Nei [4]:
h=(1-∑χ2) N/(N-1), где
χ – частота каждого митотипа в популяции, N – объем выборки.
Для определения уровня полиморфизма митохондриальной ДНК
рассчитывали также нуклеотидное разнообразие (π) на сайт, которое
определяется как:
π=
,
∑   

где  - частоты i-того и j-того митотипов в популяции;  - отношения различающихся нуклеотидов между i-тым и j-тым митотипами,
которое определяется как:
 = (- log ℯ  )/r ,
где r – число нуклеотидов в сайте рестрикции; Sij – доля общих сайтов между i – тым и j – тым митотипами определяется как:
Sij = 2mij / (mi + mj) , где
mij - число общих сайтов между i-тым и j-тым митотипами; mi и
mj – число сайтов в i-том и j-том митотипах.
Электрофоретические спектры фрагментов, полученные после
обработки каждой рестриктазой, обозначали заглавной буквой и составляли таким образом комбинированный митотип каждой особи и
линии. Среди исследованных митохондриальных генов изученных
линейных субпопуляциях выявлено 11 митотипов, частота которых
представлена в таблице 1.
Таблица 1. Частоты митотипов мтДНК в различных линиях уток
Митотипы
1
2
3
4
5
6
7
8
9
10
11
Рестрикционные морфы
АААА
АААВ
ААВВ
АВВВ
АВВЕ
АВВС
АВСЕ
ABBD
AAAC
AAAD
AADE
Всего
М1
5
1
14
1
20
М2
13
1
13
Линия
Б1
Б2
6
10
8
2
1
1
15
14
БЦ1
10
5
1
16
БЦ2
12
1
1
14
Как видно из таблицы 1, в спектрах гаплотипов линий М1, М2,
Б1,Б2 не было обнаружено чётких межлинейных различий. Вместе с
тем, не выявлено гаплотипов, которые были бы общими для всех изученных линий. Наиболее частым гаплотипом для четырёх линий –
М1, М2, Б1 и Б2 является гаплотип под номером 4, обозначенный как
ААВВ. Этот факт может быть объяснён близкими филогенетическими взаимоотношениями между названными линиями, поскольку линии Б1(отцовская) и Б2 (материнская) кросса «Благоварский» были
отселекционированы на основе родительских исходных линий М1
иМ2 кросса «Медео», и как показывают проведенные ранее исследования, генетические расстояния между ними относительно невелики.
Для характеристики генетической дифференциации популяций
используются показатели митотипического и нуклеотидного разнообразия, которые представлены в таблицы 2.
Таблица 2. Митотипическое и нуклеотидное разнообразие
в исследованных линиях уток
Линия уток
М1
М2
Б1
Б2
БЦ1
БЦ2
Митотипическое
разнообразие (h)
0,466
0,140
0,579
0,528
0,337
0,269
Нуклеотидное
разнообразие (π)
0,024
0,013
0,033
0,036
0,02
0,017
Показатель митотипического разнообразия (h) эквивалентен показателю ожидаемой гетерозиготности для диплоидных данных. Он
характеризует вероятность различия двух случайно выбранных в популяции гаплотипов.
Из таблицы 2 можно видеть, что митотипическое разнообразие в
исследованных линейных популяциях пекинских уток является не
очень высоким по сравнению с другими популяциями и колеблется в
пределах от 0,14 до 0,579, причём линии Благоварского кросса Б1 и
Б2 характеризуются довольно высокими его значениями (0,579 и
0,528), а линии БЦ1 и БЦ2 башкирской цветной породы – сравнительно низкими (0,337 и 0,269). Соответственно этому и нуклеотидное разнообразие названных линий является высоким в митохондри-
альном геноме уток линий Б1 и Б2 (0,033 и 0,036) и незначительным в
геноме линий БЦ1 и БЦ2.
Литература:
1. Алтухов Ю.П. Генетические процессы в популяциях
[Текст]/Ю.П. Алтухов. – М.: ИКЦ “Академкнига”, 2003. – 431 с.
2. Глазко В.И. Генетика изоферментов сельскохозяйственных
животных.[Текст] Итоги науки и техники. Серия «Общая генетика»
/В.И. Глазко. М.: 1988. - С.210.
3. Минченко А.Г. Митохондриальный геном [Текст] /А.Г. Минченко, Н.А. Дудырева. – Новосибирск: Наука. Сибирское отделение,
1990. – 194 с.
4. Nei M.A. new measure of genetic distance. //Genet. Distance. L. –
1974. – P. 63 – 76.
УДК 636.2.082.2.(470.57)
МЕЖПОРОДНЫЕ РАЗЛИЧИЯ ПО ЧАСТОТАМ АЛЛЕЛЕЙ
ГЕНА Β–ЛАКТОГЛОБУЛИНА (LGB) У КОРОВ ЧЁРНОПЁСТРОЙ, БЕСТУЖЕВСКОЙ И СИММЕНТАЛЬСКОЙ ПОРОД
И.Т. Гареева, И.Ю. Долматова
ФГБОУ ВПО Башкирский государственный аграрный университет, г. Уфа
Работы многих исследователей посвящены изучению влияния
гена β–лактоглобулина на молочную продуктивность коров. Наша
лаборатория также занимается поиском ассоциаций между данным
геном и качественными показателями молока и удоев.
Коровы чёрно-пёстрой и бестужевской пород, несущие в своем
генотипе аллель гена LGBВ как в гетерозиготной, так и в гомозиготной формах имеют достоверно более высокие надои и выход молочного жира [1, 2].
Исходя из этих соображений, мы провели сравнительный анализ
частот генотипов и аллелей гена LGB в выборках плановых пород
крупного рогатого скота Республики Башкортостан.
Экспериментальные исследования проводились в хозяйствах РБ и
лаборатории молекулярной генетики ФГБОУ ВПО «Башкирский государственный аграрный университет».
Материалом исследований служили выборки коров чёрно-пёстрой породы из трех хозяйств (n=650); две выборки по симменталам:
местной селекции (n=82) и австрийской селекции (n=26) (ОПХ «Баймакское») и выборка по бестужевской породе - СПК ПЗ «Ленина»
(n=64). Данные о молочной продуктивности коров получены из пле-
менных карточек 2МОЛ непосредственно в хозяйстве. ДНК из крови
выделяли по стандартному фенол-хлороформному методу.
Методом ПЦР-ПДРФ были генотипированы полиморфные варианты гена β-актоглобулина. Продукт амплификации, полученный для
гена бета-лактоглобулина – HaeIII при 37º C в течение ночи. Рестрикты разделяли электрофорезом в 7% полиакриламидном геле, анализировали с помощью компьютерной системы гель-документирования
Gel Doc XR.
Генотипу LGВАА соответствуют рестрикционные фрагменты длиной 149 и 99 п.н., генотипу LGВАВ −149, 99 и 74 п.н. и генотипу
LGВВВ – 99 и 74 п.н.
Статистическую обработку данных генотипирования проводили
по стандартным методикам, с использованием программы Microsoft
Excel, Statistica for Windows в версии 5.1.
В таблице 1 показаны частоты аллелей и генотипов гена LGB в
различных популяциях изученных пород. Можно увидеть, что изученные породы различаются между собой по частотам аллелей и генотипов.
Из данных таблицы 1 видим, что во всех выборках преобладают
особи с гетерозиготным генотипом LGВАВ, их процентное соотношение в каждой выборке составляет более 50% (кроме симменталов австрийской селекции).
Наибольшая частота гетерозигот LGВАВ (64,8%) отмечается у
симментальской породы местной селекции. У симменталов австрийской селекции частоты генотипов LGВАВ и LGВВВ практически равны
и составляют 44% и 48% соответственно.
Таблица 1 Частоты встречаемости генотипов и аллелей гена LGВ
у исследуемых пород крупного рогатого скота
Порода
Чёрнопёстрая
Симментальская
Бестужевская
Популяция*
1
2
3
В целом
4
5
82
444
99
625
71
25
6
64
N
Частота генотипов, %
LGВАА LGВАВ LGBBB
7,4
58,5
34,1
13,7
60,1
26,1
8,1
51,5
40,4
9,8
56,7
33,5
18,3
64,8
16,9
8
44
48
4,7
59,3
36
Частота аллелей
LGВА
LGВВ
0,37±0,04 0,62±0,04
0,44±0,02 0,56±0,02
0,34±0,03 0,66±0,03
0,38±0,01 0,62±0,01
0,51±0,04 0,49±0,04
0,3±0,06
0,7±0,06
5,6
21,5
2,1
6,2
0,1
0,34±0,04
5,9
0,66±0,04
χ2
Примечание: * - популяция 1 – чёрно-пёстрая порода СПК ПЗ «Ленина»; 2 – чёрнопёстрая порода ООО им. Калинина; 3 – чёрно-пёстрая порода CПК «Красная Башки-
рия»; 4 – симментальская порода местной селекции ОПХ «Баймакское»; 5 – симментальская порода австрийской селекции; 6 – бестужевская порода СПК ПЗ «Ленина».
Частота аллеля LGВА самая высокая у симменталов местной селекции – 0,51, а у бестужевской породы самая низкая – 0,34. Соответственно поэтому, бестужевская порода характеризуется самой высокой
частотой встречаемости аллеля LGВВ – 0,66.
В таблице 2 представлены достоверные различия между частотами аллелей гена LGB у чёрно-пёстрой (усредненное значение), симментальской и бестужевской пород.
Таблица 2 Достоверность межпородных различий частот аллелей
гена β-лактоглобулина крупного рогатого скота
Породы
Чёрно-пёстрая
(усредненное значение)
Бестужевская
Бестужевская
Симментальская
0,7
10,9***
-
3,0**
Примечание: ** - Р < 0,01; *** - P < 0,001.
Как следует из таблицы 2, различия по частотам аллелей между
коровами чёрно-пёстрой и бестужевской пород не достоверны (td=0,7;
Р>0,1), благодаря тому, что у этих пород частоты аллелей очень близки по числовым значениям.
Различия по частотам аллелей между симментальской и чёрнопёстрой, а также между симментальской и бестужевской породами
являются достоверными (td=10,9; Р<0,001 и td=3,0; Р<0,01 соответственно).
Методом χ2-квадрат провели оценку соответствия фактически
наблюдаемых частот генотипов в изученных выборках теоретически
ожидаемым в соответствии с законом Харди-Вайнберга.
В выборке чёрно-пёстрой породы ООО АП им. Калинина высокое
значение χ2 (21,66) получено за счет избытка гетерозигот (267 наблюдаемых против 218,8 ожидаемых) и недостатка гомозигот. Остальные
выборки находятся в равновесном состоянии.
Таким образом, различия по частотам аллелей между симментальской и чёрно-пёстрой, а также между симментальской и бестужевской породами являются достоверными (td=10,9; Р<0,001 и td=3,0;
Р<0,01 соответственно).
Генное равновесие по гену LGB сохраняется во всех исследованных выборках коров, кроме чёрно-пёстрой породы ООО АП им. Калинина.
Литература:
1. Гареева, И.Т. Полиморфизм гена β-лактоглобулина в популяциях молочного скота Республики Башкортостан [Текст] / И.Т. Гареева, И.Ю. Долматова, Ф.Р. Валитов, Ю.А. Ракина // Проблемы биологии продуктивных животных. - 2011. - №3. - С. 3-11.
2. Калашникова, Л.А. Влияние полиморфизма генов молочных
белков и гормонов на молочную продуктивность коров черно-пестрой
породы [Текст]/ Л.А. Калашникова, Я.А. Хабибрахманова, А.Ш. Тинаев // Доклады РАСХН. – 2009. -№ 3. –C. 49-52.
3. Bleck T.G.,Bermel R.D. (2005). Correlation of the alphalactalbumin polymorphism to milk production and milk of Holsteins. J.
Dairy Sci. 76: 2292-2298.
4. Patel K. R., Chauhan J.B., Krishna M.S., Soni K.J. (2007). Allelic
frequency of cappa-casein and beta-lactoglobulin in Indian crossbred dairy
bulls. Turk. G. Anim Sci. 31: 399-402.
УДК 639.371.2
СРАВНИТЕЛЬНАЯ ХАРАКТЕРИСТИКА РОСТА И РАЗВИТИЯ
ГИБРИДА СТЕРЛЯДИ И КАЛУГИ
А.С.Говорливых, Ф.Р.Валитов, С.Г.Каримова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Искусственным воспроизводством осетровых рыб занимаются с
начала XX века. Однако серьезные работы по доместикации и целенаправленному выращиванию ремонтно-маточных стад этих видов
рыб были начаты в середине прошлого столетия. В настоящее время
маточные стада белуги, осетра, стерляди сформированы в рыбоводных хозяйствах многих стран. В Российской Федерации ремонтноматочные стада осетровых рыб созданы в более чем 40 рыбхозах,
расположенных в различных природно-климатических зонах страны.
Работы по гибридизации белуги и волжской стерляди, начатые
Н.И. Николюкиным в начале 50-х гг. прошлого века, привели к созданию плодовитых межродовых гибридов семейства Acipenseridae
под общим названием «бестеры». Товарное осетроводство в нашей
стране началось с промышленного освоения бестера. В дальнейшем
работы по селекции гибридных форм и повышению их продукционных характеристик позволили создать три породы – «Бурцевская»,
«Внировская» и «Аксайская», зарегистрированные как селекционные
достижения.
По аналогии с бестером, проводя наши исследования в условиях
ООО «Кармановский рыбхоз», мы надеялись получить гибрид, который унаследует темпы роста от калуги и улучшенные качества мяса
от стерляди.
Для получения гибридов использовали пять самок стерляди в
возрасте от 7 до 10 лет со средней массой 3,4 кг, неоднократно принимавших участие в нерестовых кампаниях. Для чистого разведения
стерляди и калуги брали производителей того же возраста. У калуги
четкого брачного наряда не наблюдалось, поэтому стимулировали созревание половых продуктов у трех особей, у которых общий габитус
тела, напоминал самцов. Созрел и дал сперму лишь один самец одиннадцатилетнего возраста массой 51 кг. При получении гибридов икра
стерляди была осеменена спермой калуги. Для стимуляции созревания производителей применяли гормоностимулирующий препарат
«Сурфагон». Икру получали прижизненно методом подрезки яйцеводов по методу С.Б.Подушки. Половину сцеженной икры стерляди использовали для гибридизации, а другую половину - для получения
чистой формы стерляди. Сперму калуги также делили пополам и использовали для осеменения икры стерляди и икры самки калуги. Гибридные и родительские формы икры инкубировали в отдельных аппаратах Вейса при температуре воды 15,5-16,5С0 с содержанием кислорода 9,9-10 мг/л, рН - 9,2. Выдерживали предличинок и выращивали личинок в одинаковых условиях – в лотках производства Ейского
судоремонтного завода. Кормление рыб производилось живыми кормами и стартовым кормом «Skretting» с учетом их возраста и массы.
Для изучения роста рыб большое значение имеют данные о весовом и
линейном росте рыб. Изучали мы их путем систематических взвешиваний и измерений на свежем материале штангенциркулем с точностью до 0,1 мм, начиная с четырехнедельного возраста. По мере роста
рыбы плотность посадки уменьшали. Все полученные данные обрабатывали статистически на ПК.
Икра стерляди была осеменена спермой калуги только один раз.
Оплодотворение была сравнительно высоким (73%), но уступало
оплодотворению чистой икры стерляди (87%) и калуги (78%). Гибрид
(стерлядь х калуга) был получен 18 марта 2012 года. Различия между
родительскими формами и гибридом были отмечены уже на стадии
инкубирования. Вылупление стерляди началось на 4 сутки инкубации
и продолжалось 65-82ч., несколько позже началось вылупление калуги – через 6,5часов и продолжалось 67-85часов. Появление первых
гибридных постэмбрионов отмечали через 12-15 часов после начала
инкубации, продолжительность составила 56-75ч. Переход личинок
стерляди и гибрида на активное питание произошло на четвертые
сутки выдерживания, калуги же - на пятые сутки.
Данные роста и развития рыб приведены в таблице 1.
Таблица 1 Рост и развитие молоди подопытных рыб, n=60 шт. (M±m)
Возраст.
нед.
4
5
6
7
8
Стерлядь
масса, г прирост, г
3,1±0,11
4,2±0,09
1,1
5,9±0,12
1,7
7,1±0,09
1,2
8,2±0,08
1,1
Калуга
масса, г прирост, г
1,5±0,04
2,4±0,05
0,9
3,5±0,06
1,1
4,6±0,05
1,1
5,0±0,04
0,4
Стерлядь х калуга
масса, г прирост, г
3,1±0,03
3,9±0,04
0,8
5,5±0,04
1,6
7,6±0,02
2,1
8,2±0,03
0,6
Анализ таблицы 1 показывает, что калуга в месячном возрасте
уступает гибридам и молоди стерляди, а гибриды имеют массу, равную массе материнской формы. Причем, разница в массе у гибридов
и стерляди не имела достоверной разницы в течение всего опыта, а
коэффициент вариации был наибольшим у стерляди. К двухмесячному возрасту, разница по массе между гибридом и калугой постепенно
сократилась и составила 3,2 г (p<0,001).
Пластические признаки определяют соотношение размеров и длин
поверхностных структур. Сопоставление размеров рыб разного возраста, пойманных в одно и то же время, приводит к представлению о
замедлении или усилении роста в отдельные периоды их жизни. Данные линейного роста подопытной молоди приведены в таблице 2.
Таблица 2 Данные линейного роста подопытной молоди рыб
4
5
8,0±0,09
8,4±0,08
5,5±0,25
6,3±0,34
6,6±0,27
7,3±0,32
1,7±0,09
2,0±0,08
1,4±0,08
1,7±0,09
гибрид
калуга
стерлядь
Длина головы, см
гибрид
калуга
Возраст,
нед.
стерлядь
Длина тела, см
1,7±0,08
1,9±0,09
6
7
8
9,7±0,15 8,7±0,41
10,6±0,24 10,3±0,57
11,2±0,51 11,8±0,90
8,6±0,39
9,0±0,41
9,8±0,43
2,2±0,07
2,3±0,10
2,6± 0,11
2,3±0,10
3,0±0,15
3,3±0,25
2,3±0,10
2,5±0,11
2,7±0,13
Из данных, приведенных в таблице 2, видно, что гибридная рыба
по линейному росту, как в четырехнедельном, так и в восьминедельном возрасте занимает промежуточное положение. Причем, по скорости роста длины тела и головы преимущество за калугой. Эта разница
составила 2,0 см и 0,6 см соответственно (p<0,01).
Полученные данные свидетельствуют о возможности скрещивания стерляди с калугой и требуют дальнейших исследований.
УДК 619:618.14
ФОРМИРОВАНИЕ, ПЕРИОДИЗАЦИЯ
И КРИТИЧЕСКИЕ ФАЗЫ РАЗВИТИЯ МАТКИ КОРОВ
В ПРЕНАТАЛЬНОМ ОНТОГЕНЕЗЕ
Н.В. Гребенькова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Формирование, рост и развитие репродуктивных органов коров
необходимо исследовать с ранних сроков онтогенеза, так как уже в
этот период могут формироваться аномалии развития, которые приводят к врожденному бесплодию животных и наносят значительный
экономический ущерб животноводству. Поэтому интерес к изучению
органов размножения имеет большое практическое значение [2-4].
Развитие половой системы является сложным процессом, включающим множество механизмов, реализующихся на протяжении нескольких стадий развития. Выяснение этих механизмов позволит ясно определить причины врожденной патологии репродуктивной системы коров. Поэтому целью наших исследований стало изучение
формирования и развития органов размножения коров на ранних стадиях эмбриогенеза.
Объектом исследования служили 75 плодов. На мясокомбинате
проводили тщательно послеубойное исследование туш и органов коров, полученных из них плодов с последующим гистологическим и
гистохимическим изучением полученного материала по общепринятым методикам [1]. Формирование органов размножения начинается
на 20-34 сутки пренатального онтогенеза, когда появляются зачатки
гонад. На 34-45 сутки завершается процесс дивергентной дифферен-
циации пола либо в сторону яичников, либо в сторону семенников.
На 45-60 сутки происходит уже активный процесс размножения половых клеток в яичниках. При дивергетной дифференциации в сторону яичников появляются парамезонефральные (мюллеровы) протоки,
из которых образуются яйцепроводы, матка и влагалище. В дальнейшем вплоть до рождения телочек плод, а так же органы размножения
претерпевают морфологические изменения. Полость матки выстлана
однослойным, многорядным, призматическим эпителием, собственная пластинка эндометрия представлена мезенхимой, которая в дальнейшем развивается в рыхлую соединительную ткань. В 3-месячном
возрасте клетки эндометрия плотно прилегают друг к другу. Васкуляризация матки слабо выражена, выявляются отдельные мелкие капилляры. Мы наблюдали юные, зрелые клетки и клетки с признаками
апоптоза. В собственной пластинке эндометрия в наиболее реактивном
состоянии находятся фибробласты, макрофаги. Внутриорганная нервная система матки представлена нервными стволами сплетения, состоящими преимущественно из пучков безмиелиновых нервных волокон,
в которых осевые цилиндры окружены шванновскими клетками.
В 6-месячном возрасте эпителий становится более высоким. Увеличивается количество желез, они углубляются в собственную пластинку и становятся более разветвленными. Увеличивается количество мелких капилляров, ближе к миометрию появляются более
крупные кровеносные сосуды. Поверхность эпителия становится более волнистой, увеличивается количество секрета на поверхности
эпителиоцитов. Цитоплазма эпителиоцитов и клеток собственной
пластинки имеет большое количество органелл и включений, структура которых свидетельствует о том, что в клетках протекают активные синтетические процессы. В нервных клетках цитоплазма характеризуется обилием различных органелл, что также соответствует их
высокой функциональной активности.
У 9-месячных плодов карункулы почти полностью закрывают
просвет матки и имеют высокую степень васкуляризаии. Поверхность
эпителия имеет очень широкие и глубокие вдавливания, поэтому выглядит более рельефной. На поверхности эпителиоцитов выявляются
многочисленные, плотно расположенные ворсинки. Дифференциация
клеток в основном завершена, кровоснабжение хорошо развито,
обеспечиваясь за счет мелких и крупных кровеносных сосудов. Безмиелиновые нервные волокна содержат несколько осевых цилиндров,
а сближенные участки плазмолеммы леммоцита формируют сдвоен-
ную базальную мембрану – мезаксон, на котором подвешен осевой
цилиндр. Цитоплазма нервных клеток характеризуется обилием органелл, что соответствует их высокой функциональной активности.
Миометрий в матки плодов формируется в начале 4 месяца, когда
появляются отдельные мышечные волокна, при этом отчетливо виден
лишь циркулярный мышечный пучок. В последующем формируются
продольный и сосудистый слои. Клетки миометрия интенсивно дифференцируются. К 6-месячному возрасту приобретают веретеновидную форму, характерную для гладкомышечных клеток. Наибольший
относительный прирост толщины миометрия отмечаются в 5 и 8 месяцев. Периметрий образуется соединительной тканью, в которой
преобладает бесструктурное межклеточное вещество. Снаружи серозной оболочки располагается мезотелий. Его клетки с возрастом
уплощаются и располагаются рыхло в циркулярном направлении.
После рождения у телят секреторная активность эпителия увеличивается. Формируется большое количество желез. Железы, сформированные ранее, углубляются. В собственной пластинке эндометрия
хорошо выражена васкуляризация. В миометрии и периметрии наиболее значимые изменения коснулись только органометрических данных.
Таким образом, в пренатальном онтогенезе сначала ускоряется
рост яичников, что тесно связано с образованием крупных полостных
фолликулов, а затем происходит подъем скорости роста матки, что
связано с формированием и развитием основных структур матки.
Данная картина свидетельствует о начале формирования маточноовариальных отношениях уже во внутриутробном периоде. Полученные данные позволили нам установить сроки периодизации и критические фазы развития матки.
Мы разделили внутриутробный период развития матки на пять
этапов: 1 –формирование генетического пола; 2 - индифферентное развитие; 3 - дифференциация гонад в сторону яичников; 4 - формирование яйцепроводов матки и влагалища из парамезонефральных (мюллеровых) протоков; 5 - рост и дифференциация оболочек матки. При этом
формирование и развитие матки характеризуется наличием 3 критических фаз: 1 - период оплодотворения; 2 - дифференциация гонад в сторону яичников и формирование органов размножения; 3 - от 2 месяцев
до рождения. В эти фазы нарушения условий содержания и кормления
стельных коров сказывается отрицательно на развивающийся плод.
Литература:
1. Меркулов, Г.А. Курс патогистологической техники [Текст]
/ Г.А. Меркулов. - Л., 1969. - 424 с.
2. Никитин, А.И. Проблемы ранней дифференцировки гонад
млекопитающих. Эмбриональный гистогенез и механизм регуляции
[Текст] / А.И. Никитин // Арх. анат., гистолог. и эмбриолог, 1985. –
№ 8. - С. 5-17.
3. Kenngott, R.A.-M. Prenatal development of the bovine oviduct
/ R.A.-M. Kenngott, F. Sinowatz // Anat., Histol., Embryol. – 2007. - N 4.
- Т.36. - Р. - 272-283.
УДК 619:618.
РАЗВИТИЕ МАТКИ И ЯИЧНИКОВ КОРОВ
В ПОСТНАТАЛЬНОМ ПЕРИОДЕ ОНТОГЕНЕЗА
В НОРМЕ И ПРИ ПАТОЛОГИИ
Н.В. Гребенькова, Е.Н. Сковородин
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Изучение закономерностей развития и функционирования органов размножения животных является одной из наиболее актуальных
проблем биологической науки. Интерес к этим проблемам не исчерпывается чисто теоретическими соображениями, поскольку достижения в данной области непосредственно связаны с кардинальными вопросами животноводства и ветеринарии, находят прямой и эффективный выход в практику [1, 2]. Выявление механизмов развития половой системы позволит определить причины патологии органов и
координировать мероприятия по профилактике, диагностике и лечению нарушений воспроизводительной функции.
Объектом исследования являлись новорожденные телята, полученные от клинически здоровых коров и коров, содержащихся на
неполноценном рационе, телки и коровы, подразделявшиеся на 3
группы: первая группа – здоровые животные, кормление и содержание которых было полноценным; вторая группа – телки-гипотрофики
и коровы кормление и содержание которых не было полноценным с
рождения; третья группа – бесплодные телки и коровы. На мясокомбинате проводили тщательно послеубойное исследование туш и органов коров, полученных из них плодов с последующим гистологиче-
ским и гистохимическим изучением полученного материала по общепринятым методикам [3].
В постнатальном онтогенезе у здоровых телок относительный
прирост массы яичника наиболее интенсивно увеличивался при формировании полноценных половых циклов, когда образуются желтые
тела половых циклов и полостные фолликулы. Сначала ускоряется
рост яичников, а только затем происходит подъем скорости роста
массы матки, что говорит об устойчивых маточно-овариальных отношений.
Мы ориентировались на классификацию полового цикла коров и
телок, основанную на морфологических изменениях в яичниках и выделении непродолжительной фолликулярной фазы и относительно
длительной фазы желтого тела (лютеиновой).
Фолликулярная фаза полового цикла продолжается три-четыре
дня. Начинается она с постоянного нарастания комплекса пролиферативных процессов в половых органах под воздействием гормона эстрогена, развивающихся фолликулов и клинически проявляется течкой. В матке клетки эндометрия характеризуются высокой секреторной активностью. Железы извилистые, чаще всего расширенные. В
собственной пластинке эндометрия кровеносные сосуды расширенны
и кровенаполнены. Эпителиоциты матки характеризуются высокой
синтетической и экзокринной активностью.
Лютеиновая фаза (фаза желтого тела) в яичниках начинается после овуляции и характеризуется формированием циклического желтого тела, которое на четвертые–шестые сутки цикла находят в одном
из яичников. На седьмые–девятые сутки полового цикла наблюдается
развивающееся желтое тело плотной консистенции, с бугристой верхушкой.
Лютеиновая ткань на разрезе дольчатая, серо-желтого цвета.
Крупных фолликулов диаметром до 1 см не обнаруживаются, встречались только мелкие и средние фолликулы. На 10 - 12 сутки полового цикла циклическое желтое тело (ЦЖТ) достигает своего максимального размера и характеризуется высокой гистохимической активностью. Функционирование желтого тела продолжается до 16-18
дня цикла. Если не происходит оплодотворения, то желтое тело
начинает постепенно рассасываться на протяжении последующих 2-3
половых циклов, одновременно происходит рост фолликулов. Как
правило, на поверхности яичников имеется один – два фолликула
диаметром более 1 см.
В эндометрии матки кровеносные сосуды расширены и кровенаполнены. Величина кровеносные сосудов по мере углубления в собственную пластинку эндометрия увеличивается, они становятся извилистыми и лежат небольшими группами. Эпителиоциты матки не обладают высокой синтетической и экзокринной активностью.
Исходя из полученных данных, мы разделили постнатальный период развития матки на четыре этапа: 1 – интенсивный рост и развитие матки; 2 – формирование половых циклов и физиологической
зрелости; 3 – морфофункциональная зрелость; 4 – старость или геронтологический. выделили следующие критические фазы: у телок
критической фазой являются первые месяцы после рождения; у половозрелой коровы критическими фазами являются фолликулярная стадия (овуляция) полового цикла и послеродовой период.
У телок-гипотрофиков и коров отмечали недоразвитие органов
размножения. Матка и яичники характеризовались гипоплазией, что в
дальнейшем приводит к нарушениям развития репродуктивной системы телок.
Одной из главных причин длительного бесплодия коров является
хронический эндометрит. В эндометрии матки наблюдали слущивание покровного эпителия, гиперемия. В тех участках, где эпителий
сохранился, соединительная ткань отечна и содержит инфильтрат.
Желез в матке сравнительно немного, все они небольшого размера.
Некоторые железы имеют кистозное расширение, встречается
атрофия желез и участки гиалиноза собственной пластинки. В железистом эпителии наблюдаются процессы зернистой дистрофии, некроза и
слущивания. Кроме того, маточные железы часто располагаются очень
близко к миометрию, иногда внедряясь в него. Кровеносные сосуды
расширены. В мышечном слое отмечались дистрофические и атрофические процессы. Хорошо выражена сосудистая реакция, кровеносные
сосуды расширены. Наблюдается слабая периваскулярная инфильтрация. В миометрии ретракция мышечных волокон не выражена. В серозной оболочке четко выраженных изменений по сравнению с нормой
не отмечали. Патоморфологические изменения при хроническом эндометрите зависят от состояния яичников коров. Наиболее чаще всего регистрировали следующие нарушения развития яичников: гипофункция
яичников, персистентное желтое тело, фолликулярные кисты.
Литература:
1. Ходжес, Дж. Есть ли альтернатива интенсивному животноводству [Текст] /Дж. Ходжес // Главный зоотехник, 2011. - № 2. – С. 8-13.
2. Племяшов, К.В. Клинико-морфологические исследования яичников и матки бесплодных коров [Текст]/ К.В. Племяшов // Ветеринария. – 2010. № 9. – С. 8-10.
3. Меркулов, Г.А. Курс патогистологической техники [Текст] /
Г.А. Меркулов. - Л., 1969. - 424 с.
УДК 636.237.23.082
ВОСПРОИЗВОДИТЕЛЬНЫЕ КАЧЕСТВА КОРОВ В СВЯЗИ
С АНТИГЕННЫМ СОСТАВОМ ЭРИТРОЦИТОВ КРОВИ
У.Р. Гумеров, С.Г. Исламова
ФГБОУ ВПО Башкирский государственный аграрный университет, г.Уфа
При интенсификации животноводства важнейшее значение имеет
сохранение высокой воспроизводительной способности животных.
Воспроизведение сельскохозяйственных животных – важнейшая
часть технологии их разведения, содержания и получения от них продукции. В целом оно определяет экономичность и рентабельность
животноводства. Важными показателями, характеризующими воспроизводительные качества, являются возраст первого отела коров,
продолжительность сервис и межотельного периодов, от которых зависит последующая продуктивность животных. Известно, что оптимальный возраст первого отела составляет 27-30 месяцев, продолжительность межотельного периода – 12-13 мес.
В целях изучения генетического маркирования воспроизводительных признаков (возраст первого отела, продолжительность сервис-периода и межотельного периода – МОП) исследовали их связь с наиболее распространенными аллелями. В основе были аллели В-системы
групп крови 98 голов крупного рогатого скота симментальской породы
ПЗ СПК «Дружба» Аургазинского района Республики Башкортостан.
Воспроизводительные способности коров представлены в табл. 1.
Таблица 1 Воспроизводительные способности коров
Показатель
Возраст 1-го отела, мес.
Сервис период, дн.
МОП, мес.
Выход телят на 100 коров, гол.
M±m
31,85±0,58
120,1±4,74
13,0±0,29
96
Сν,%
17,8
46,48
19,83
Анализируя данные воспроизводительных качеств хозяйства,
видно, что возраст первого отела довольно высок (31,85 мес.) как и
показатель сервис периода - 120,1 дней. Межотельный период у животных - в среднем 13 мес. что является оптимальным сроком. Необ-
ходимо добавить, что в стаде высокая изменчивость (Cv>10) по изучаемым признакам, что свидетельствует о возможности и эффективности селекции в дальнейшем.
Связь антигенных факторов с воспроизводительными качествами
коров представлены в таблице 2.
Таблица 2 Воспроизводительные способности коров
в связи с антигенами групп крови
Группа коров
Носители E'3
Не носители
Разница±
Носители I'
Не носители
Разница±
Носители Y2
Не носители
Разница±
Носители O1
Не носители
Разница±
Носители Y'
Не носители
Разница±
Носители A'2Y'
Не носители
Разница±
n, гол
25
73
29
69
21
77
5
93
12
86
9
89
Возраст 1-го
отела, мес.
31,7±0,89
32±0,67
-0,30
34,1±1,20
30,9±0,56
3,14
30,8±1,03
32,2±0,63
-1,40
32,4±2,64
31,9±0,56
0,50
31±1,30
32±0,59
-1,0
30,2±1,6
32,1±0,57
-1,90
Сервис-период,
дн.
124,5±8,8
101,4±5,6
14,10
130,6±11,7
119,8±4,6
10,79
101,8±6,5
126±5,60
-24,2**
90±12,50
122,7±4,90
-32,7*
91,1±4,0
125,2±5,20
-34,1***
95,1±4,50
123,6±5,10
-28,5***
МОП, мес.
14,2±0,60
12,9±0,32
1,30
13,01±0,52
13,1±0,35
-0,09
12,6±0,46
13,2±0,35
-0,60
13,7±1,50
12,9±0,30
0,80
12±0,40
13,3±0,32
-1,30*
11,6±0,40
12,9±0,32
-1,30*
Продолжительность сервис-периода у животных, не имеющих
аллели E'3 и I', составила 101,4±5.6 и 119,8±4.6 дней соответственно,
эти показатели ниже, чем у сверстниц – не носителей на 14 и 10 дней.
У коров – обладательниц аллелей Y2, O1, Y' и A'2Y' продолжительность сервис-периода была ниже в сравнении с животными, не имеющих данных аллелей, соответственно на 24,2, 32,7, 34,1 и 28,5 дней
(p<0,05…0,001). Следует заметить, что у коров, в крови которых присутствовал аллель I', возраст первого отела оказался выше на 3,14 месяца, чем у животных не носителей данного аллеля (p>0,05). Показатель межотельного периода у коров носителей аллеля E'3 был больше, а у носителей Y' и A'2Y' меньше на 1,30 мес.
Таким образом, в исследуемой популяции показатели воспроизводительной способности животных были в пределах оптимальных
значений. Но, вместе с тем, наличие определенных антигенов способствовало увеличению или, наоборот, уменьшению показателей воспроизводительной способности. В данном стаде антигены Y2, Y' и
A'2Y' могут в определенной степени служить в качестве генетических
маркеров воспроизводительных качеств.
УДК 636.598.053.087
ВЛИЯНИЕ ПРЕПАРАТА СОЛМИВИН СЕЛЕН
НА ВОСПРОИЗВОДИТЕЛЬНУЮ СПОСОБНОСТЬ
МУСКУСНЫХ УТОК, РОСТ И РАЗВИТИЕ УТЯТ
В.Д. Давлетова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Cолвимин Селен – препарат, обладающий комплексным действием, компенсирующий недостаток витаминов и селена при гипо- и
авитаминозах и недостатке селена в рационе животных. Витамины,
входящие в состав препарата участвуют в метаболизме в качестве катализатора, а так же необходимы для работы органов и организма в
целом. Биологическая роль селена связана с его антиоксидантным
действием[1]. Применение данного препарата способствует повышению неспецифической резистентости организма животных к различным воздействиям окружающей среды. При этом Солвимин Селен по
степени воздействия на организм относится к 4 классу опасности
(вещества малоопасные) по ГОСТ 12.1.007-76 [2].
Препарат птице добавляли в поилки с питьевой водой 25-50 г на
100 л воды в течение 7 дней. Курс повторяли через 2 мес.
Исследования проводили в условиях фермерсмкого хозяйства «Диана» Чишминского района Республики Башкортостан. Район относится
к биогеохимической провинции с недостатком селена, меди, цинка в
почве и воде. Препарат птица получала с водой в периоды гона и кладки яиц. Полученному молодняку препарат давали по той же схеме.
Выявили положительное влияние препарат на количество полученных яиц. По сравнению с предыдущими годами, где количество и
выводимость яиц составляли 20,6 шт. на одну самку или 60% на общее количество полученных яиц соответственно, а в период применения препарата утки снесли в среднем 36,5 яиц на одну самку. И вылупляемость яиц составило 97%. Так же выживаемость утят в первые
15 суток после вылупления в период адаптации к новым условиям
окружающей среды за период применения увеличилось с 80 до 100%.
В дальнейшем полученный молодняк, получавший препарат отличался большей интенсивностью роста. В первые 15 суток средняя масса
тела утят, получавших препарат Солвимин Селен увеличилось до 89,9
г, что в 2,5 раза больше по сравнению с массой тела в суточном возрасте. А по сравнению с контрольной группой данный показатель выше
на 34,4%. Далее в период интенсивного роста к 35 суточному возрасту,
масса тела утят получавших данный препарат составил в среднем
1090,2 г., что на 42,4% выше у утят в контрольной группе. А к концу
эксперимента масса тела утят получавших данный препарат составил в
среднем 2250 г., что на 92,3% выше у утят в контрольной группе.
Таким образом, применение комплексного препарата селена в
условиях недостатка этого микроэлемента в почве и воде способствует повышению плодовитости уток, сохранности молодняка и последующему интенсивному росту утят.
Литература:
1. Старков, М. В. Влияние парентерального введения селеноорганического препарата на изменение массы тела, некоторые гематологические и биохимические показатели крови при откорме быков[Текст] / М. В. Старков, Е. А. Мерзлякова, Т. А. Трошина. // Научное обеспечение реализации национальных проектов в сельском хозяйстве: Материалы Всероссийской науч. прак. конф. ФГОУ ВПО
Ижевская ГСХА. – Ижевск: РИО ФГОУ ВПО Ижевская ГСХА, 2006.
– Т.2. – С.263-265.
2. Татарчук, О. П. Эффективность поливитаминного препарата
Солвимин Селен при вакцинальном стрессе у цыплят-бройлеров.
[Текст]/ О. П. Татарчук, А. В. Бирюкова, Т. М. Окрлелова // Био. –
2011. - № 130/131 - С. 34-36.
УДК 619:618.2/7:636.2
ПРОФИЛАКТИКА АКУШЕРСКОЙ ПАТОЛОГИИ
У ВЫСОКОПРОДУКТИВНЫХ КОРОВ
В СУХОСТОЙНЫЙ ПЕРИОД
Т.О. Дмитриева
ФГБОУ ВПО Санкт-Петербургская государственная академия
ветеринарной медицины, г. Санкт-Петербург
Вопрос успешного решения задач по увеличению производства
молока напрямую зависит от рационального использования маточного поголовья. Однако положительным тенденциям в вопросе воспроизводства стада и росту продуктивности крупного рогатого скота в
значительной степени препятствует развитие акушерской патологии,
особенно в поздний стойловый период.
Одним из вариантов решения столь сложной проблемы является
введение в схемы профилактических мероприятий в сухостойный период у коров препаратов, которые обладают выраженным антиоксидантным, иммуномодулирующим эффектом, активизирующим работу
всего организма в целом и его реактивность на факторы внешней и
внутренней среды. Всем выше перечисленным требованиям отвечает
«Карофертин», препарат, представляющий собой инъекционную
форму синтетического β-каротина.
Целью исследования явилось выяснение особенностей течения
сухостойного периода в конце стойлового периода (конец марта начало мая месяцы) у высокопродуктивных коров, у которых предшествующие роды и послеродовый период сопровождались патологией, на примере хозяйства ЗАО «Любань» Тосненского района Ленинградской области и разработка метода профилактики заболеваний
репродуктивной системы с использованием парентерального введения синтетического β-каротина в сухостойный период.
Подопытные животные были распределены на 3 группы: первая и
вторая опытная и контрольная группы в количестве 23 головы в каждой. Первой опытной группе животных парентерально вводили препарат «Карофертин» в дозе 25 мл на голову, четырехкратно с интервалом в 10 дней в течение сухостойного периода. Первая инъекция
препарата проводилась на 11 день сухостойного периода, а последняя
инъекция - за 10-14 дней до предполагаемых родов. Второй опытной
группе животных парентерально вводили масленый раствор витамина
А (100 000 МЕ в 1мл) в дозе 5 мл на голову, трехкратно с интервалом
5 дней с 30 по 40 день сухостойного периода. В контрольной группе
животных профилактических мероприятий не проводилось.
Биохимическое и клиническое исследование крови в сухостойный период показали, что назначение препарата «Карофертин» перед
родами оказывает существенной влияние на повышение и стабилизацию уровня каротина и витамина А в крови, что отражается на благоприятном течение метаболических процессов, связанных с подготовкой к родовой деятельности и обеспечивающих стабилизацию про-
цесса послеродовой инволюции половых органов и процесс синтеза
молока. Фармакокинетика препарата «Карофертин» характеризуется
увеличением содержания в крови каротина (на 59,98±33,99%,
p<0,001) и витамина А (на 61,5±71,3%, p<0,05) и сохранением уровня
этих веществ в крови в течение десяти дней и более после последнего
введения.
Фармакодинамика препарата «Карофертин» характеризуется стабилизацией уровня каротин: до опыта 8,09±5,68 и после 23,59±6,61
мкмоль/л - p<0,001 и нормализация кальций-фосфорного отношения
(p<0,001), обмена веществ, нормализации кислотно-щелочного равновесия в организме (щелочной резерв крови: до опыта 41,46±13,6 и
после 48,4±8,18 Об.%СО2 - p<0,01).
За животными проводили клиническое наблюдение в течение родового и послеродового периодов. Учитывали время отделения последа, количество задержаний последа, наличие субинволюции матки, заболеваемость острым послеродовым эндометритом. В среднем
время отделения последа составило: по первой опытной группе 5,0±2,37 ч, по второй опытной группе – 8,6±3,0 ч, по контрольной
группе - 9,6±4,32 ч (p<0,01). Было зафиксировано задержаний последа: в первой опытной группе – 21,7±0,4% случаев, во второй опытной
группе – 43,5±0,41% случаев, в контрольной группе – 65,2±0,38%
случаев (p<0,01). Заболеваемость субинволюцией матки составила в
первой опытной группе 13,0±0,34%, во второй опытной группе
43,48±0,5%, в контрольной группе 56,5±0,49% (p<0,001). Послеродовым эндометритом в первой опытной группе заболело 26,0±0,44%
коров, во второй опытной группе - 34,78±0,49%, а в контрольной
группе – 52,0±0,49% (p<0,001). Процент мастита в послеродовый период во всех группах примерно одинаков: 1 опыт – 22,0±0,41%, 2
опыт - 21,5±0,4% и контроль – 22,0±0,42% (p<0,05).
Таким образом, проведенные экспериментальные исследования
показали, что препарат «Карофертин» является высокоэффективным
средством профилактики акушерской патологии у коров, способствует сокращению периода бесплодия у коров, что в проекции приводит
к снижению затрат на осеменение и увеличению показателя выхода
телят. Среднее значение по показателю сервис-периода по первой
опытной группе составил 110,0±4,66 дней, по второй опытной группе
154,6±5,5 дней и по контрольной группе 189,0±9,4 дней (p<0,01).
Применение препарата «Карофертин» в дозе 25 мл на голову четырехкратно в течение сухостойного периода позволило сократить дли-
тельность сервис-периода с 189,0±9,4 до 110,0±4,66 дней. Таким образом, период бесплодия сократился на 79 дней, что позволяет получить
дополнительную продукцию (на сумму 11107,2 рублей от каждой
оплодотворенной коровы, при окупаемости на рубль затрат 15,4 рублей).
Следовательно, использование препарата «Карофертин» для коррекции нарушения обмена веществ и профилактики акушерской патологии у высокопродуктивных коров оправдано и с биологической,
и с экономической точки зрения.
Литература:
1. Антипов, В.А. Влияние каротина микробиологического на
воспроизводительную функцию коров [Текст]/ Антипов В.А., Турченко А.Н., Чащин А.В., Кузьминова Е.В., Уразаев Д.Н. // Материалы
научно-практической конференции «Новые фармакологические средства для животноводства и ветеринарии». – Краснодар, 2001. – Т. 2. С. 8-9.
2. Карнаухов, В.Н. Функции каротиноидов в клетках животных
[Текст]:М., Наука, 1973. – 105 с.
3. Кольцова, Э.В. Каротиноидные препараты микробиологического синтеза и их применение в животноводстве, птицеводстве и
пищевой промышленности [Текст] / Кольцова, Э.В., Мишина, В.С.
//:М.,1984. - 32 с.
4. Кузьминова, Е.В. К вопросу витаминного питания [Текст]/
Кузьминова Е.В., Семененко М.П., Трошина А.Н., Кудинова С.П. //
Материалы науч.-практ. конф. «Актуальные проблемы ветеринарии в
современных условиях», Краснодар, 2006 - С. 297-298.
5. Dingl, J.T. Vitamin A, carotinoids and cell function / Dingl J.T.,
Lucy J.A. // Biol. Rev. – 1965. – Vol. 40. – P. 422.
УДК 636.5.087.8
СЕЛЕН В ПТИЦЕВОДСТВЕ
Дюдьбин О. В.
ФГБОУ ВПО Башкирский государственный аграрный университет, г.Уфа
В организм птиц селен, поступает из окружающей среды, с кормами, добавками, через питьевую воду и незначительная часть - через
дыхательные пути и кожу. Абсорбируется селен главным образом в
двенадцатиперстной и подвздошной кишках. Часть селена не абсорбируется слизистой кишечника и удаляется из организма через желудочно-кишечный тракт. В крови селен включается в лейкоциты,
эритроциты,липопротеиды,фибриноген. До 70% общего количества
селена крови сосредоточено в эритроцитах. При достаточном количестве селена в кормах концентрация элемента в крови птицы составляет 5-8 мкг/100 мл, печени 12-16 мкг/100 г. Снижение концентрации
селена в крови до 0,8-1 мкг/мл и в печени до 3-4 мкг свидетельствует
о его дефиците и предрасположенности птицы к беломышечной болезни. Установлено, что инъекции селена курам способствуют увеличению у них в крови эритроцитов на 14% и гемоглобина - на 13%[2].
В организме птиц селен распределяется в следующем убывающем порядке: печень, почки, селезенка, легкие, поджелудочная железа, головной мозг, сердце, мышечный желудок, скелетные мышцы.
Относительно большое содержание ceлена в печени, почках и селезёнке, по-видимому, связано со специальной его функцией в этих органах. У птиц 5-30 дневного возраста процессы выведения и накопления в органах селена происходят интенсивнее, чем у птиц старшего
возраста, что свидетельствует о более высокой потребности их в этом
элементе. В дальнейшем, по-видимому, птица адаптируется к некоторому избытку или недостатку элемента в рационе.
Установлены иммуностимулирущие свойства селена. Он ускоряет синтез антител, повышает устойчивость к микробным и вирусным
инфекциям, усиливает фагоцитоз, функции нейтрофилов и лимфоцитов. Определённую роль селен играет в механизме зрения, регулируя
процессы, происходящие в сетчатке глаза, и повышая её световую
чувствительность.
Обмен селена в организме тесно связан с метаболизмом витамина Е. Недостаток селена в рационах птицы вызывает беломышечную
болезнь, экссудативный диатез, атрофию поджелудочной железы, энцефаломаляцию, медленное развитие иммунокомпетентных органов,
снижение яйценоскости, раннюю эмбриональную смертность.
Ведущий механизм развития последствий селенового дефицита
заключается в повреждении клеточных мембран вследствие активации процессов перекрестного окисления липидов, обусловленной
снижением активности фермента глутанионпероксидазы. Проявляется это нарушением микроциркуляции и увеличении проницаемости
капиллярных и клеточных мембран, что выражается в явлении за-
стойной гиперемии, отечности, кровоизлияниях. Изменяются также
функциональные структуры клеток, наступает некроз [1].
Избыточное содержание селена в рационе приводит к токсикозу.
У птиц это проявляется в заметном нарушении роста, снижении яйценоскости, выпадения перьев, уменьшением выхода молодняка из
яиц, образуются отёки мышц, кожи. Птица очень плохо усваивает селен из кормов животного происхождения на 8-25%, из растительных
кормов на 59%, которые, к сожалению, не восполняют его дефицит.
Низкую биологическую доступность селена из кормов животного
происхождения многие исследователи связывают с образованием
комплексных соединений его с ртутью (особенно в рыбной муке), пуриновыми основаниями и др. [2]. В последние годы на рынке кормового сырья появилось достаточно большое количество органических
соединений селена, обладающих меньшей токсичностью, по сравнению с селенитом натрия.
Таким образом, селен играет существенную роль в обменных
процессах птицы. Особое значение имеет обеспечение организма селеном в ранний период пост эмбриогенеза цыплят, в период становления антиоксидантной системы защиты организма.
Учитывая важность организации оптимального кормления птицы современных скороспелых кроссов в предстартовый период для
максимального проявления продуктивных свойств в конце откорма,
представляет научный и практический интерес проведения комплексных физиологических исследований и выбор эффективной формы из
наиболее распространённых препаратов селена.
Литература:
1. Голубкина, Н. А. Селен в питании: растения, животные, человек [Текст] /, Т. Т. Папазян. - М.: Печатный город, 2006. - 252 с.
2.Шипилов, В. Новое в кормлении птицы [Текст]/ В. Шипилов, И.
Переслегина // Птицеводство. 1999. - № 6. - С. 30-31.
УДК 636.1:636.082(575.2)
СРАВНИТЕЛЬНЫЙ АНАЛИЗ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ
ПО ПОЛИМОРФНЫМ БЕЛКАМ И ФЕРМЕНТАМ КРОВИ
У ЛОШАДЕЙ БАШКИРСКОЙ И РУССКОЙ ТЯЖЕЛОВОЗНОЙ
ПОРОД
А.Г. Ильясов, И.Ю. Долматова
ФГБОУ ВПО Башкирский государственный аграрный университет, г.Уфа
Полиморфные различия контролируются серией множественных
аллелей того или иного локуса, постоянны на протяжении жизни животного, имеют кодоминантный характер наследования. Таким образом, выявленные генотипы по той или иной полиморфной системе,
служат генетическим паспортом конкретного животного и могут
быть использованы для описания генетической структуры пород и
популяций.
В настоящее время известно, что больше всего по аллелям и типам систем крови, а также по степени внутрипородного генетического разнообразия отличаются породы лошадей разного направления
продуктивности и происхождения, в частности наибольшей полиморфностью обладают аборигенные породы, такие как вятская, калмыцкая, а среди заводских - тяжеловозы.
Целью нашей работы являлось проведение сравнительного анализа генетической структуры лошадей башкирской и русской тяжеловозной породы по полиморфным системам белков альбумина,
трансферрина и ферменту эстеразе.
Объектом исследования служили лошади башкирской породы
(n=63) хозяйства ООО «Толпар» Баймакского района и русской тяжеловозной породы (n=25) ООО КФХ «Юлдоз» Туймазинского района
Республики Башкортостан.
Определение полиморфных вариантов белков и ферментов проводилось в соответствии с методическими рекомендациями по использованию систем белков и групп крови при контроле достоверности происхождения лошадей, разработанными ВНИИ коневодства [2].
Подсчет частот проводили используя статистические методы популяционной генетики для множественных аллелей [1].
Результаты изучения полиморфных белков и ферментов крови
племенных лошадей башкирской породы хозяйства и русской тяжеловозной породы для наглядности представлены в виде диаграмм на
рисунках 1, 2, 3.
A
A
AA
0.4
0.3
0.5
0.302
0.4
0.286
0.3
0.2
0.2
0.1
0.1
0
0
0.302
AB
0.396
BB
0.415
B
B
Башкирская порода
0.299 A
B
Русская тяжеловозная
порода
Рисунок 1 Частоты генотипов по полиморфной системе белка
альбумина
Анализируя частоты полиморфных вариантов белков и ферментов по обеим породам видно, что генетическая структура примерно
совпадает. Так, по башкирской породе видно, что по полиморфной
системе альбумина частоты аллелей А и В отличаются незначительно
и составляют 0,45 и 0,55 соответственно. По русской тяжеловозной
породе частота аллелей А составляет 0,48 и B – 0,52 соответственно.
Животные с генотипом ВВ встречаются чаще, как по башкирской породе – 0,396, так и по русской тяжеловозной породе – 0,415.
DD
OO
0.18
RR
DF
0.285
FM
HO
HM
OO
DF
0.15
0.1
DO
0.049 0.095
0.015
0.032
0.032
0.11
0.016
0.048
0.032
DD
0.2
0.09 0.05
0.045
0.12
0.021
DO
0
DH
HO
0.19
0.12
0.033
0.056
0.145
DH
FF
FO
FO
FH
0.286Башкирская порода
FF
FH
Русская тяжеловозная порода
Рисунок 2 Частоты генотипов по полиморфной системе белка
трансферрина
0.6
FF
0.4
FF
0.32
0.3
0.4
0.2
0.2
0.1
0.016
0
0
0.28
0.571
JJ
0.412FJ
JJ
Башкирская порода
FJ
0.4
Русская тяжеловозная порода
Рисунок 1 Частоты генотипов по полиморфной системе
фермента эстеразы
По системе трансферрина у лошадей башкирской породы распределение частот аллелей было следующее: наибольшую частоту встречаемости имели аллели D и F – 0,22 и 0,22 соответственно. Значительно меньшую частоту имели аллели Н, О, M и R (0,06, 0,05, и 0,07
соответственно). Наиболее часто встречающиеся генотипы DO и FO 0, 285 и 0,286; несколько меньше HO (0,11), FH (0,032) и OO (0,049).
По русской тяжеловозной породе наибольшую частоту встречаемости имели аллели D (0,35), H (0,26) и R (0,28). Наиболее высоко
встречающиеся частоты отмечены для генотипов RR (0,18) и HO
(0,19), несколько меньше DD (0,021), DF (0,045) и FF (0,033).
По полиморфной системе фермента эстеразы у изученных животных встречаются только аллели F и J. Их частоты у башкирской
породы незначительно отличаются и составляют 0,45 и 0,55 соответственно. Чаще всего среди исследованных животных встречаются
лошади с генотипом JJ (0,571) и гораздо реже FF (0,016). Лошади
башкирской породы с генотипом FJ занимают промежуточное положение, и их частота составила 0,412. У лошадей русской тяжеловозной породы чаще всего встречаются животные с гетерозиготным генотипом FJ (0,4) и меньше всего JJ (0,28).
Учитывая генетические особенности породы по наличию тех или
иных аллелей полученные данные могут служить генетической характеристикой изученной популяции.
Литература:
Животовский Л.А. Популяционная биометрия. [Текст] /
Л.А.Животовский // Учебник. – М.-: Наука, 1991.- 271с.
2. Храброва, Л.А. Методы генетической сертификации лошадей
по полиморфным системам крови [Текст] / Л.А. Храброва и др. //
Учебное пособие – Дивово, 2010. – 70с.
3. Храброва, Л.А. Мониторинг генетической структуры пород в
коневодстве. [Текст] / Л.А. Храброва.// Доклады РАСХН /. - 2008. №3. – С.42-44.
4. Храброва, Л.А. Особенности аллелофонда местных пород лошадей. [Текст] / Л.А. Храброва, А.М. Зайцев // Журнал Коневодство и
кон. спорт. - 2008. - №3. – С.9-10.
1.
УДК 636.21.081.25
СРАВНИТЕЛЬНАЯ ХАРАКЕТРИСТИКА ГЕОНОФОНДА
ЧЕРНО-ПЕСТРОЙ И СИММЕНТАЛЬСКОЙ ПОРОД
КРУПНОГО РОГАТОГО СКОТА РЕСПУБЛИКИ
БАШКОРТОСТАН ПО ГРУППАМ КРОВИ
Э.И.Ильясова, Ф.Р.Валитов, И.Ю.Долматова, А.Г.Ильясов
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Одной из главных задач в племенной работе является использование генетических маркеров различных хозяйственно-ценных признаков, так как они неизменяемы в онтогенезе, независимы от условий внешней среды и имеют кодоминантный характер наследования
[1].
Таким образом, повышается значимость исследований полиморфизма генетических систем крови, в частности групп крови. Наследование факторов крови у каждого вида животных контролируется несколькими генами и имеет большое практическое значение. Генетическое маркирование позволяет сравнивать популяции скота по уровню биоразнообразия, проводить генетическую дифференциацию линий и семейств, мониторинг генофонда породы, оценивать и прогнозировать эффективность племенной работы.
Цель настоящего исследования заключалась в сравнительном
анализе частот встречаемости эритроцитарных антигенов крови черно-пестрой и симментальской пород крупного рогатого скота.
Материалом исследования служили племенные коровы маточного поголовья черно-пестрой (n=4742гол.) и симментальской
(n=1421гол.) Республики Башкортостан. Группы крови определяли
стандартными серологическими тестами с использованием 54 моноспецифических сывороток. Частота антигенов групп крови определялась методом прямого подсчета [3]. Коэффициент генетического
сходства популяции рассчитали при помощи формулы Маяла и
Линдстерема [2].
В целом наблюдается сходный спектр распространения антигенов. На рисунке 1 представлены частоты встречаемости выявленных
антигенов.
1.2
1
0.8
0.6
0.4
0.2
0
A1
Z'
-0.2
B2 G2
I1
K
P2 T1 Y2
B' E2'
I'
K' P1' Y'
C1
E
W
X2
F
J
M
S2
U
H''
Z
черно-пестрая порода
симментальская порода
Рисунок 1 Частота встречаемости эритроцитарных антигенных факторов
крупного рогатого скота черно-пестрой и симментальской пород
Наибольшая частота встречаемости у коров черно-пестрой породы наблюдается по антигену А2 по А-системе, С1 по С-системе, F по
FV-системе. У коров симментальской породы наибольшая частота
встречаемости по антигену А2 по А-системе, В2 по В-системе, С1 по
С-системе, F по FV-системе, H` по S-системе. Наибольшие различия в
частоте встречаемости отмечаются по следующим антигенам системы В: В1, I1, P2, Y2, E2`,E3`, P1`,B`; по системе С: X1, X2; по системе
FV: F; по системе S: S2 и H`.
Из таблицы 1 видно, что сравниваемые популяции имеют большое генетическое сходство по изученным системам групп крови, о
чем свидетельствует коэффициент генетического сходства.
Таблица 1 Коэффициенты генетического сходства между изученными
популяциями по различным системам групп крови
Системы
А
(3 антигена)
Коэффициент генети0,9489
ческого
сходства
B
(31 антигена)
0,9421
C
(8 антигенов)
0,9703
FV
(2 антигена)
0,9932
L (2 антигена)
S (7 антигенов)
0,9244
0,9388
Наименьший коэффициент генетического сходства между чернопестрой и симментальской породами наблюдается по системе S
(0,9388), наибольший – по системе FV (0,9932). Система B и L явля-
ются наиболее полиморфными. В системах J и Z различий по частоте
встречаемости эритроцитарных антигенных факторов не выявлено.
Селекционная работа, проводимая с каждой породой оказывает
значительное влияние на полиморфизм групп крови и в результате
формируется свой генофонд и определенные генотипы, характеризующие стадо. Рядом исследователей [4,5] высказаны рекомендации в
отношении необходимости сохранения определенного установившегося генофонда в стаде, поскольку он связан с более высокой продуктивностью.
Литература:
1. Буваева, Н.В. Применение иммуногенетических методов в
повышении продуктивности скота калмыцкой породы [Текст] //
Межрегиональная молодежная научная конференция «Перспективы
реализации предпринимательских проектов в инновационно ориентируемой экономике. Региональный аспект». Элиста, 2010. С. 143-144.
2. Деева, B.C. Группы крови крупного рогатого скота и их селекционное значение [Текст] / B.C. Деева, И.О. Сухова // РАСХН.
Сиб. отд-ние. СибНИПГИЖ. - Новосибирск, 2002. - 172 с
3. Максимова, А., Петрачкова, И. Использование иммуногенетических маркёров при выведении внутрипородного типа айрширского скота [Текст] / А.Максимова, И.Петрачкова//Молочное и мясное
скотоводство, 2007.-№5.-С.9-12.
4. Моисейкина, Л.Г., Бурнинова, Л.В, Буваева, Н.В. и др. Генетическое сходство скота калмыцкой породы [Текст] / Л.Г. Моисейкина, Л.В Бурнинова, , Н.В.Буваева//Материалы XIII международной
научно-практической конференции «Актуальные проблемы интенсивного развития животноводства». Горки, 2010. С. 138-142.
5. Моисейкина, Л.Г., Бурнинова, Л.В, Буваева, Н.В. и др. Иммуногенетические методы в селекции скота [Текст]/ Л.Г.Моисейкина,
Л.В Бурнинова, , Н.В.Буваева // Агрорынок. – 2010. - №1. С. 34. Тихонов В.Н. О генетических механизмах связи групп крови и
биохимических маркёров с продуктивностью и резистентностью
[Текст]// С.-х. биология. - 1987. -№ 7. - С. 57-65.
УДК 619:615
ВЛИЯНИЕ ГОМЕОПАТИЧЕСКОГО ПРЕПАРАТА
«ФОСПАСИМ» НА РЕПРОДУКТИВНЫЕ КАЧЕСТВА
КРОЛИКОМАТОК ПРИ СТРЕССЕ
Э.Р. Исмагилова, Л.Л. Ибрагимова
ФГОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Стресс - это внутреннее состояние организма, проявляющееся в
форме специфического синдрома ("адаптационный синдром"), который представляет собой совокупность всех неспецифически вызванных изменений в рамках данной биологической системы [1].
Предупреждение, снижение влияния стресса - один из важнейших факторов сохранения здоровья, повышения продуктивности животных и снижения затрат на получение продукции. В современных
условиях животные постоянно подвергаются воздействию стрессоров, как физических, так и психогенных. Охватывая практически всех
особей, подвергнутых транспортировке, перегруппировке и вакцинации стресс снижает естественную резистентность животных, ведет к
заболеваемости и падежу, а в конечном итоге срыву технологических
режимов и потере экономической выгоды [2,3].
Целью настоящего исследования явилось изучение влияния гомеопатического препарата «Фоспасим» (ООО «Хелвет») на репродуктивные показатели кроликоматок во время стресса.
Кроликоматки калифорнийской породы в возрасте 4 мес., массой 3,0-3,5 кг транспортировались в течение суток на расстояние 840
км в 2х ярусных сетчатых клетках в авторефрижераторе при температуре 14оС, уличная температура в месте погрузки составляла -22оС, в
месте выгрузки - 14оС. После транспортировки кроликов содержали
не в идентичных условиях: в трехъярусных клетках (вместо одноярусных), кормили полнорационным гранулированным комбикормом
c 25-30% содержанием травяной муки. В рационе животных сено отсутствовало (в прежних условиях сено давалось вволю). Данная ситуация явилась для кроликов физическим и психическим стрессом.
В исследовании приняли участие 4 группы кроликоматок по 15
голов в каждой, выровненных по возрасту, живой массе, физиологическому состоянию.
Первой опытной группе вводили внутримышечно "Фоспасим"
(ООО "Хелвет") по 0,4 мл/гол однократно перед транспортировкой.
Второй опытной группе - "Фоспасим" (ООО "Хелвет") по 0,4 мл/гол
дважды: перед транспортировкой и после выгрузки в первый день
адаптации. Третьей опытной группе вводили 0,4 мл/гол дважды: перед транспортировкой и после выгрузки в первый день адаптации,
далее перорально по 12-13 капель ежедневно, в течение 7 дней. Контрольная группа кроликов перевозилась без участия расслабляющего
средства в идентичных условиях.
Через неделю после стрессорного воздействия кроликоматки,
пришедшие в охоту, подверглись естественному осеменению кролами калифорнийской породы. Учет репродуктивных качеств у кроликоматок устанавливали по каждой матке и в среднем по подопытной
группе.
Плодовитость – количество живых крольчат при окроле.
Крупноплодность – живая масса крольчонка при рождении.
Молочность – живая масса гнезда на 21 день подсосного периода.
Сохранность крольчат – отношение количества крольчат при
отъеме к плодовитости * 100.
Масса крольчат при отъеме (30-32 дня).
В течение опыта вели наблюдение за физиологическим состоянием подопытных крольчат (аппетит, здоровье, пульс, дыхание, температура тела).
Результаты первого осеменения и окрола указаны в таблице № 1.
Таблица 1 Результаты первого осеменения и окрола
Название
группы
Контрольная
1 опытная
2 опытная
3 опытная
Кол-во маток, пришедших Кол-во
Кол-во в охоту и осемененных
окрона 7 день после прибытия лов в
гол.
группе
гол.
%
% прохолоста
по
группе
Кол-во
живых
крольчат
в группе
15
4
26,6
2
50
17
15
15
15
9
12
15
60
80
100
8
11
14
11,1
8,3
6,6
66
93
125
Из таблицы 1 видно, что в охоту после транспортировки лучше
пришли кроликоматки 3 опытной группы (14 гол. из 15), прохолост
составил 6,6%, в результате по группе мы получили 125 крольчат, что
в 7 раз больше, чем в контрольной группе.
Показатели продуктивности кроликоматок представлены в таблице 2.
Таблица 2 Репродуктивные показатели кроликоматок (по группам)
№
п/п
1
2
3
4
Наименование Плодо- Крупногруппы живитость,
плодвотных
гол.
ность, г
Контрольная
8,25
54,1
1 опытная
8,5
57,2
2 опытная
8,45
58,0
3 опытная
8,92
62,4
Молочность,
кг
2,6
2,7
2,8
3,2
Сохранность, %
88,2
93,0
93,5
96,0
Ср. масса
крольчат
при отъеме, г
652
674
682
690
Из таблицы 2 видно, что кроликоматки опытных групп превосходили контроль по сохранности на 5,2-7,8%, причем наибольшая сохранность (96,0%) отмечается в 3 опытной группе.
Плодовитость всех групп в пределах 8-9 голов, что характерно
для калифорнийской породы, хотя контрольная группа уступает подопытным на 0,25-0,67 гол.
Наивысшая молочность (3,2 кг) отмечается в третьей подопытной
группе, также средняя живая масса при отъеме крольчат составляет
690 г, что на 38 г больше контроля.
Вышеуказанные показатели получены при принятой на комплексе технологии.В течение опыта физиологическое состояние подопытных крольчат соответствовало норме: аппетит умеренный, дыхание
равномерное, температура 38,0-39,5 ◦С.
Из вышеизложенного можно сделать вывод, что кроликам, как
самым пугливым и подверженным стрессу сельскохозяйственным
животным, для более быстрой адаптации (7 дней), сохранения здоровья и повышения продуктивности необходимо применять гомеопатическое средство «Фоспасим» дважды по 0,4 мл/гол. внутримышечно,
далее перорально 12-13 капель в течение 7 дней.
Литература:
1. Селье, Г. Очерки об адаптационном синдроме [Текст]: М.:1960.
2. Заварзин, А.А., Строева, О.Г. Сравнительная гистология: учебник [Текст] / А.А.Заварзин, О.Г. Строева, / - Спб.: Изд-во С.-Петербург. ун-та, 2000.-518с.
3. Худолеев, А.А. Стресс у спортивных лошадей /А.А. Худолеев,
О.Г. Сапожникова, В.А. Оробец// Диагностика, лечение и профилактика заболеваний сельскохозяйственных животных [Текст]: сборник
научных трудов по материалам 73-науч.-практ. конф. – Ставрополь:
АГРУС, 2009. - С 108-109.
УДК 636.2:637.5
ГОРМОНАЛЬНЫЙ ПРОФИЛЬ ОРГАНИЗМА МЯСНЫХ
КОРОВ ПРИ ГИПОФУНКЦИИ ЯИЧНИКОВ
О.А. Кацараба
Львовский национальный университет ветеринарной медицины и
биотехнологий имени С. З. Гжицкого, г. Львов, Украина
Среди многих нарушений функциональной деятельности половых желез у мясных коров, ведущих к расстройству половой цикличности и их бесплодию, на первое место выступает гипофункция яичников. Данная патология, сопровождаемая нарушением роста и овуляции фолликулов, проявляется значительным снижением активности стероид генеза[1, 3].
Для мясных коров с гипофункцией яичников характерно низкое
содержание в крови всех половых гормонов, играющих важнейшую
роль в регуляции половой цикличности и формировании феноменов
полового цикла. В то же время функциональная деятельность яичников при данной патологии полностью не прекращается, о чем свидетельствует наличие в них фолликулов на разной стадии развития и
периодическое повышение в крови концентрации прогестерона и эстрадиола-17р [2].
Поэтому изучение особенностей стероид генеза при функциональных расстройствах гонад, особенно с учетом сохранения овариальной цикличности, имеет очень важное значение как в раскрытии
механизмов их возникновения, так и для совершенствования метода
биотехнического контроля за репродуктивной функцией и плодовитостью мясных коров.
Целью нашей работы было изучить гормонального статуса коров
абердин-ангусской мясной породы с гипофункцией яичников, сопровождающейся длительной анафродизией, и его изменений в динамике
овариальной цикличности (с учетом сохраняющихся волн роста и
атрезии фолликула). При этом мы учитывали что активизация гормоносинтезирующей функции яичников у коров происходит с интервалом 6-7 дней. После родов и в последующем этими днями являются
4-6, 10-12, 19-21, 25-27 дни и так далее. Под нашим наблюдением
находилось 30 коров абердин-ангусской мясной породы. После постановки диагноза на гипофункцию яичников и на 5 и 15дни от них
получали венозную кровь и в ее сыворотке иммуноферментным методом определяли содержание прогестерона и эстрадиола-17.
Выполненные нами эндокринологические исследования показали
(табл. 1),что для гипофункции яичников, сопровождающейся длительной анафродизией, характерным является низкий уровень концентрации в крови прогестерона (1,66±0,267 нМ/л), особенно на фоне
волны роста фолликулов (0,50±0,095 нМ/л). В этом случае его концентрация была ниже средних значений в 3,3 раза (Р<0,01), а в сравнении с периодом атрезии фолликулов - в 5,8 раза (Р<0,01).
Если учесть, что основным источником синтеза прогестерона при
гипофункции яичников могут быть только текальные и интерстициальные клетки, а также атрезические тела, то можно заключить, что
данная патология характеризуется, в первую очередь, пониженной
гормонопоэтической функцией стромальных структур яичников. С
образованием атрезических тел содержание прогестерона в крови,
естественно, повышается до 2,98±0,458 нМ/л или в 5,8 раза.
Таблица 1 Содержание половых гормонов в крови коров
при гипофункции яичников (нМоль/л)
Гормоны
Без учета
овариальной
цикличности
Волна роста
фолликулов
Атрезия
фолликулов
1.
Прогестерон
1,66±0,267
0,50±0,095
2,98±0,458
2.
Эстрадиол-17р
0,70±0,032
0,64±0,056
0,79±0,028
3.
Соотношение
прогестеронэстрадиол
2,37
0,78
3,77
№
п/п
В отличие от прогестерона продукция эстрогенных гормонов при
гипофункциональном состоянии яичников по периодам роста и атрезии фолликулов изменяется не так существенно (табл. 1). В среднем
его значение составило 0,70±0,032 нМ/л, на волне роста фолликулов
оно изменилось всего лишь на 8,7% в сторону уменьшения
(0,64±0,056 нМ/л) и при их атрезии повысилось на 22,2% (0,79±0,028
нМ/л).
Из полученных и приведенных в таблице 1 данных можно заключить, что в яичниках при их гипофункции рост фолликулов, синтезирующих эстрогенные гормоны, сохраняется, однако резкого увеличения количества вторичных и созревания третичных фолликулов не
отмечается. Связано это, по-видимому, также с пониженной потенциальной возможностью клеток текальных оболочек фолликулов, которые являются источником синтеза андрогенных гормонов — прямых
предшественников эстрогенов.
Изменение меж гормональных соотношений (прогестерон - эстрадиол) с 2,37 до 0,78 и 3,77 в основном связано с колебаниями концентрации в крови прогестерона, то есть с состоянием гормонопоэтической функции соединительнотканных структур гонад.
При анализе гормонального статуса абердин-ангусских коров с
гипофункцией яичников в динамике двухнедельного наблюдения за
ними установлено, что транс ректальный массаж половых органов,
используемый при диагностике их функционального состояния, активизирующий в них кровообращение и тканевый метаболизм, положительно сказывается на гормоносинтезующей функции половых желез.
Так, уже через 5 суток концентрация прогестерона в крови коров
возросла с 1,66±0,267 нМ/л до 1,95±1,511 нМ/л, а через 15 суток в
среднем до 5,02±1,610 нМ/л или в 3 раза при колебаниях 2,98 - 8,14
нМ/л. По полученным последним цифрам можно судить, что у части
животных (по нашим данным у 33,3%) произошла овуляция и сформировалось желтое тело – основная морфологическая структура яичника, синтезирующая прогестерон.
Таблица 2 Показатели содержания в крови коров половых гормонов
при гипофункции яичников в динамике опыта (нМоль/л)
№
Гормоны
п/п
Исходный
фон
Через 5 суток
Через 15 суток
1.
Прогестерон
1,66±0,267
1,95±1,511
5,02±1,610
2.
Эстрадиол-17р
0,70±0,032
0,74±0,043
0,79±0,053
3.
Соотношение
прогестеронэстрадиол
2,37
2,64
6,35
Содержание в крови коров эстрадиола-17Р изменялось в течение
двух недель менее значительно (с 0,70±0,032 нМ/л до 0,79±0,053
нМ/л). При этом, у тех животных, у которых отмечена только активизация гормональной функции яичников показатели содержания в
крови данного гормона составили 0,82-0,85 нМ/л, а у которых уже
произошла овуляция – 0,68-0,72 нМ/л. Соотношение прогестерона с
эстрадиолом изменилось с 2,37 до 6,35.
Таким образом, отмеченные нами колебания в содержании половых гормонов в крови коров с гипофункцией яичников по периодам
роста и атрезии фолликулов, а также в динамике наблюдений подтверждают, что функциональная активность гонад при данной патологии полностью не прекращается.
Однако низкая функциональная активность стромальных (соединительнотканных) структур коркового вещества яичников не обеспечивает достаточного синтеза и циклического подъема эстрогенных
гормонов, а следовательно, развития, созревания растущих в яичниках фолликулов и проявления полового цикла.
Именно недостаточный уровень синтеза и инкреции эстрадиола,
создающего необходимый фон для проявления циклической деятельности гипоталамо-гипофизарной системы (по механизму обратной
положительной, стимулирующей связи), отрицательно сказывается на
циклическом выбросе лютеинизирующего гормона (ЛГ), в результате
чего сдерживается развитие и созревание фолликулов.
С другой стороны не следует забывать, что гормонопоэтическая
функция половых желез (их стромальных структур и энзиматических
систем стероидогенеза) обеспечивается уровнем продукции фолликулостимулирующего (ФСГ) и лютеинизирующего гормонов.
Поэтому снижение функциональной активности половых желез и
нарушение половой цикличности у животных по отношению к гипоталамо-гипофизарным сдвигам в своей основе имеет вторичное происхождение (особенно у высокопродуктивных животных).
В связи с чем гипофункцию яичников у животных следует рассматривать как гипоталамо-гипофизарную болезнь регуляции, связанную с функциональными сдвигами вследствие неблагоприятного
действия факторов внешней и внутренней среды организма.
В этой связи для коррекции функциональной активности морфологических структур яичников, восстановления половой цикличности
и плодовитости коров при гипофункции половых желез вполне
уместной может быть физиологическая заместительная терапия с использованием экзогенных гонадотропных гормонов. Однако, надо
полагать, что ее эффективность во многом будет зависеть от времени
инъекции препаратов в связи с наблюдаемыми волнами роста и атрезии фолликулов в яичниках.
Литература:
1. Лабодин, А.С. Гормональная регуляция полового цикла у коров
// Актуальные проблемы ветеринарии в борьбе с незаразными болезнями животных [Текст]: – Воронеж, 1990. – С. 70-74.
2. Карымов, В.Н. Влияние простагландина Ф-2α на функцию яичников и применение его для лечения коров с лютеиновыми кистами
[Текст]: // Дис. канд. вет. наук: 16.00.07. – Воронеж, 1986. – С. 6-10.
3. Вареников, М.В. Применение прогестагенов и их сочетаний
при гипофункции яичников у коров-первотелок [Текст]: Дис. канд.
биол. наук : 06.02.01. – п. Дубровицы, Моск. обл., 2003. – С. 8-12.
УДК 636.2.053
РОСТ И РАЗВИТИЕ ТРАНСПЛАНТИРОВАННЫХ ТЕЛЯТ
ГОЛШТИНСКОЙ ПОРОДЫ В УСЛОВИЯХ ООО «АЛАТАУ»
КАРМАСКАЛИНСКОГО РАЙОНА
Г.Р. Каюмова, Д.Р. Якупова
ФГБОУ Башкирский государственный аграрный университет,
г.Уфа
Метод трансплантации может являться основой ускоренного воспроизводства высокопродуктивных коров и целых популяций. Трансплантация эмбрионов может ускорить селекционный прогресс в молочном скотоводстве в 6-7 раз по сравнению с обычными методами
разведения, обеспечивает более интенсивное размножение животных с
высокой генетической ценностью и животных малочисленных пород.
Этот метод предоставляет большие возможности для использования мировых генетических ресурсов: транспортировка глубокоохлажденных эмбрионов вместо животных, устранение ветеринарных
препятствий в международной торговле, исключение необходимости
адаптации импортированного генетического материала к новым
условиям среды. В мировой практике около 80% быков, находящихся
на племенных предприятиях и используемых в системе искусственного осеменения, получены путем трансплантации эмбрионов [1].
Технология трансплантации эмбрионов включает такие основные
звенья как вызывание суперовуляции, искусственное осеменение донора, извлечение эмбрионов, оценка их качества, кратковременное
или длительное хранение и пересадка. Метод трансплантации эмбрионов базируется на использовании в качестве доноров эмбрионов коров с высокой продуктивностью. Отбор доноров – целенаправленный
выбор племенных коров, хорошо реагирующих на гормональную обработку и дающих биологически полноценные эмбрионы.
Донор – это корова высокой племенной ценности, от которой после гормонального вызывания суперовуляции и осеменения спермой
выдающегося быка-улучшателя получают эмбрионы. После отбора
коров-доноров приступают к индуцированию множественной овуляции или суперовуляции.
Реципиент – телка или корова по племенной ценности ниже донора. Реципиенту трансплантируют (пересаживают) в матку один или
два эмбриона на определенной стадии развития. Оптимальной считается овуляция, при которой из фолликулов яичника выходит 10…20
созревших яйцеклеток. Только около 50% из них оказываются пригодными для трансплантации [3].
Оценка и селекция ранних эмбрионов по желаемому полу позволит ускорить темпы генетического прогресса в популяциях, повысит
эффективность селекции. В 2003 г. получила апробацию и разрешение на промышленное использование методика по разделению семени по половому признаку.
При использовании сексированного семени появляется возможность поднять долю нарождающихся телок до 90 – 94% [2].
Эффективность трансплантации эмбрионов во многом определяется условиями хранения зигот. Самым перспективным и эффективным методом консервации эмбрионов является их глубокое замораживание (криоконсервация) в жидком азоте при температуре -196ºС.
Современные стандарты приживляемости замороженно-оттаянных
эмбрионов после пересадки составляют 44 – 55%, свежеполученных –
50 – 60%.
Трансплантация эмбрионов дает возможность увеличить племенное ядро стада за счет выдающихся матерей – доноров в 6 – 8 раз
быстрее обычных способов воспроизводства [3].
На ферме ООО «Алатау» объектами исследования были телочки
голштинской породы, из которых по принципу аналогов были сформированы две группы животных по 10 голов. В I группу входили животные, полученные традиционным способом, во II – телочкитрансплантанты. Условия кормления и содержания всех животных
были одинаковыми в соответствии с рационами, принятыми в хозяйстве. С целью изучения роста и развития подопытных животных
взвешивали ежемесячно в одну и ту же дату утром до кормления. По
данным взвешивания рассчитывали абсолютный и среднесуточный
приросты живой массы, а также относительную скорость роста. Экстерьерные особенности изучали у телочек в возрасте 1 мес путем взятия промеров тела. На основании промеров вычисляли индексы телосложения. Для контроля за физиологическим состоянием организма у
молодняка в возрасте 10 суток, 1 мес, 3 мес в крови, взятой из яремной
вены, определяли содержание гемоглобина – по Сали, эритроцитов –
на ФЭК, скорость оседания эритроцитов (СОЭ) – по Панченкову.
В результате проведенного опыта было установлено, что показатели роста и развития телок первой группы незначительно отличаются от второй группы. С целью ускорения селекционного прогресса в
молочном скотоводстве предлагаем применять трансплантацию эмбрионов, полученных от коров с высокой генетической ценностью.
Литература:
1. Костомахин, Н.М. Скотоводство [Текст]: учебник / Н.М. Костомахин. – СПб.: Издательство «Лань»,2007. – 432 с.
2. Сибагатуллин, Ф.С. Сексированное семя (семя, разделенное по
половому признаку) – новый метод воспроизводства стада [Текст]: /
Сибагатуллин Ф.С., Холодков С.А. // Ветеринарный врач. - 2009г. №1.– С. 55-56.
3. Мадисон В.В. Биотехнология приплода [Текст]: / В.В. Мадисон
// Животноводство России. – 2010г. - №6. – С. 5 – 6.
УДК 636.597.082.1
ГЕНЕТИЧЕСКИЙ ПОЛИМОРФИЗМ ГЕНА ТИОЭСТЕРАЗЫ
СИНТАЗЫ S – АЦИЛ ЖИРНЫХ КИСЛОТ (S-AFAST) УТОК
Т.В.Кононенко, И.Ю. Долматова
ФГБОУ ВПО Башкирский государственный агарный университет,
г.Уфа
Полиморфизм по длине рестрикционных фрагментов ДНК
(ПДРФ) обусловлен изменениями в ДНК, приводимым к появлению
(исчезновению или изменению взаиморасположения) сайтов узнавания для рестриктаз.
Анализ ПДРФ – полиморфизма позволяет также получить достаточно четкие представления об уровне генетической гетерогенности
изучаемых популяций и оценить произошедшие в ходе селекции
микроэволюционные процессы.
Для изучения ПДРФ-полиморфизма использован ген, котролирующий синтез фермента тиоэстераза синтазы S-ацил жирных кислот
(S-acyl fatty acid synthase thioesterase), который принимает участие в
выработке маслянистого секрета копчиковой железы у птиц. Этот ген
состоит из 6 экзонов и 5 интронов. Общая протяжённость гена - 9138
пар нуклеотидов (пн). Первый интрон имеет протяжённость 1477 пн. и
несколько сайтов рестрикции для эндонуклеаз BstDE I, Alu I и Hae III.
Материалом исследования послужили утки пекинской породы,
которые состоят из следующих линий: 1) М1 и М2 – соответственно
отцовская и материнская линии пекинских уток, кросс Медео; 2) Б1 и
Б2 – соответственно отцовская и материнская линии кросса «Благоварский»; 3) БЦ1 и БЦ2 – линии уток «Башкирской цветной» породы.
На рисунке 1 представлены спектры рестрикционных фрагментов, полученных при гидролизе амплифицированного I интрона рестриктазой BstDE I, а в таблице 1 даны сводные результаты о разнообразии рестрикционных морф.
Рисунок 1 Спектры рестрикционных фрагментов амплифицированного
I интрона гена S-AFAST уток, полученных при его гидролизе
рестриктазой BstDE I
Фрагменты 100, 400, 500 и 850 являются специфическими только
для мускусной породы (линии Ю1 – Ю2). Следует отметить, что
фрагмент 1000 пн. имеется у мускусных линий Ю1 – Ю4, также как и
линий БЦ1- БЦ2 Башкирской цветной породы. Вместе с тем у линий
БЦ1 и БЦ2 имеется фрагмент 700 пн. сближающий их с линиями М1
– М2.
Таблица 2 Типы BstDE I - рестрикционных морф I интрона гена
S-AFAST у исследованных линий уток
Приблизительные размеры
фрагментов
90
100
250
300
350
400
450
500
550
700
850
1000
Благоварский
(Б1 и Б2)
+
+
+
+
Кроссы и линии
Башкирская
цветная поМедео
Юбилейный
рода
(М1 и М2) (Ю1 – Ю4)
(БЦ1 и БЦ2)
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Всего в 200 исследованных образцах ДНК от 10 различных линий
уток пекинской и мускусной породы выявлено 12 рестрикционных
фрагментов, которые сочетаются в различных комбинациях. Общими
для всех линий является фрагмент с молекулярной массой ~ 90 пн.
Затем, с наибольшей частотой (в 8 линиях из 10) встречается фрагмент ~ 250 пн. Его нет только у линий БЦ1 и БЦ2 Башкирской цветной породы.
Описанные особенности рестрикционных спектров не находят
явственного отражения в рассчитанных коэффициентах генетического сходства (таблица 2). Мускусные линии (Ю1 – Ю4) имеют примерно равное отдаление (0,32 – 0,40) как от пекинских линий (Б1 –
Б2, М1 – М2), так и от Башкирской цветной породы (0,32 – 0,39).
Однако на дендрограмме, показывающей филогенетические взаимоотношения (рисунок 1), мускусные линии Ю1 – Ю4 и линии БЦ1
– БЦ2 Башкирской цветной породы образуют два отдельных кластера, между которыми располагаются линии М1 – М2 кросса Медео и
линии Б1 – Б2 Благоварского кросса.
Таблица 2. Матрица генетических расстояний, рассчитанная
на основе встречаемости BstDE I – рестрикционных фрагментов
I интрона гена S-AFAST
М1
М2
Б1
Б2
БЦ1
БЦ2
Ю1
Ю2
Ю3
Ю4
М1
-
М2 Б1
0,40 0,37
0,41
-
Б2
0,38
0,42
0,45
-
БЦ1
0,39
0,40
0,34
0,33
-
БЦ2
0,35
0,37
0,39
0,35
0,43
-
Ю1
0,36
0,38
0,40
0,39
0,36
0,39
-
Ю2
0,33
0,35
0,35
0,34
0,29
0,33
0,37
-
Ю3
0,36
0,36
0,38
0,37
0,33
0,37
0,31
0,39
-
Ю4
0,32
0,34
0,34
0,33
0,28
0,32
0,36
0,40
0,38
-
Рисунок 1 Дендрограмма филогенетических взаимоотношений между
изученными линиями уток, по данным BstDE I - полиморфизма
I интрона гена S-AFAST
При оценке генного разнообразия линий уток на основании полиморфизма гена S-AFAST использован показатель h, который эквивалентен показателю ожидаемой гетерозиготности для диплоидных
данных и характеризует вероятность различия двух случайно выбранных в популяции генотипов.
Индексы генетического разнообразия, рассчитанные на основе
ПДРФ – полиморфизма I интрона гена S-AFAST уток приблизительно равны для всех линий (как мускусных так и пекинских) и составляют 0,2124 – 0,285.
Следует отметить, что линии БЦ1 и БЦ2 Башкирской цветной
породы характеризуются несколько большим по сравнению с остальными линиями, генным разнообразием (0,285); несмотря на то, что на
ранних этапах селекционной работы по выведению данной породы
использовали инбридинг.
УДК 636 .082.21
СОВРЕМЕННЫЕ МЕТОДЫ ВОСПРОИЗВОДСТВА СТАДА
С.М.Лукманов
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
В ряду современных методов воспроизводства животных всё
большее применение получают новейшие методы биотехнологии
воспроизводства. Биотехнология как перспективное и приоритетное
направление животноводства развивается ускоренными темпами и
овладевает всё более новыми методами. Как изучение природы двойственности, получение однояйцевых близнецов; раннее определение
пола у эмбрионов; культивирование и оплодотворение клеток in vitro,
получение химерных и тpaнcгeнных животных, трансплантация эмбрионов и клонирование животных, получение и использование сексированного семени.
Такими направлениями, котоpыe приблизились к рубежу пpaктических приложений в воспроизводстве и селекции крупного рогатого
скота являются искусственное получение монозиготных близнецов
путем разделения бластомеров. Важным перспективным направлением исследований, позволяющим исключить половой пpoцесс, является получение с помощью микрохирургических манипуляций новых
генетических копий (клонов) животных.
Всё большее применение в воспроизводстве животных находят
метод получения и использования сексированного семени и трансплантация эмбрионов. Наиболее эффективное применение метода
трансплантации эмбрионов получил в конце 80-х годов XX в Великобритании, в Северной Америке (США, Канада), во многих странах
Европейского Союза. После доклада Ч. Смита и Ф. Николаса в 1983 г.
на конференции Британского общества животноводческой продукции
по поводу множественной овуляции и трансплантации эмбрионов
(МОЕТ — Multiple Ovulation and Embryo Transfer) данный метод был
взят на вооружение британскими животноводами. В 1986 г. была разработана система МОЕТ, которая апробировалась на базе нуклеусного стада компании Премьер Бридерс Лимитед. Были получены
настолько впечатляющие результаты, что компания Премьер Бридерс
Лимитед разработала программму МОЕТ на основе системы МОЕТ.
Компания Эгрикалчюрал Текнолоджи Лимитед (финансируемая рядом других компаний для разработки сельскохозяйственных проектов) одобрила эту систему и вместе с Бритиш Текнолоджи Групп выделила средства для компании Премьер Бридерс Лимитед. Полученные капиталовложения позволили Премьер Бридерс Лимитед осуществить программу, известную как система МОЕТ. В дальнейшем
Премьер Бридерс Лимитед была преобразована в компанию Джинус.
В 2000 г. она приобрела одну из крупнейших компаний по искусственному осеменению и трансплантации эмбрионов в США —
Америкэн Бридерс Сервис. В связи с этим британские селекционеры
и ученые получили широчайший доступ на американский рынок и
способность влиять на селекционный процесс в мировом масштабе.
В системе МОЕТ предусматривается значительное сокращение
интервала между поколениями по сравнению с традиционной проверкой потомства для создания нуклеусного стада при самом быстром темпе генетического улучшения стада, какого только можно достичь с помощью современных технологических методов.
Цель системы МОЕТ — создание нуклеусного стада. В течение
трех лет отбирали генетически ценных коров не только в Великобритании, но и в США, Канаде, Новой Зеландии и других странах с
развитым животноводством. Данных коров (с отличной родословной
и наследственными задатками продуктивности) включили в систему
получения эмбрионов, для чего их осеменяли высокоценными племенными быками, которые занимали верхние ранги в мировой классификации производителей. В результате полученные телята, выращиваемые вместе, стали основой нуклеусного стада. Когда стадо было создано, в каждом последующем году оно обновлялось на 50 % за
счет поступления ремонтного поголовья. Содержание всех коров
осуществляли при общем кормовом режиме, чтобы исключить влияние паратипических факторов. Данные о продуктивности животных
тщательно регистрировали.
Преимущество системы МОЕТ заключается в том, что она позволяет учитывать признаки, которые не оценивают при проверках
потомства в разных странах, например коэффициент полезного дей-
ствия корма, скорость раздоя, устойчивость к маститу, легкость отела, массу теленка при рождений и многие другие.
За счет использования системы МОЕТ селекционерам Великобритании удалось повысить продуктивность крупного рогатого
скота молочных пород в целом по стране только за 10 лет с 5500 кг до
7500 кг, или на 36 %. В настоящее время в Соединенном Королевстве
имеется два нуклеусных стада компании Джинус (600 коров) и компании Коджент (1200 коров). Стадо компании Коджент крупнейшее в
мире. Уровень молочной продуктивности в этих стадах составляет 11
000—12 000 кг молока. Сперму и эмбрионы используют как в пределах Соединенного Королевства, так и вывозят за рубеж, в частности
США и Канаду, откуда первоначально был получен генетический материал.
В Канаде компания Альта Дженетик имеет свое нуклеусное стадо
с маточным поголовьем 500 голов. Продуктивность данного стада
около 12 000 кг при жирномолочности 3,6% и белковомолочности 3,1
%. В стране разработана программа «Альта Джин Программ», которая призвана обеспечивать компанию быками-производителями для
использования их в мировой системе искусственного осеменения, а
также эмбрионами для продажи во все регионы мира.
По мнению ученых и специалистов Великобритании, система
МОЕТ может быть успешно применена в селекционных программах
стран с неустойчивой экономикой или в развивающихся, поскольку
капиталовложения идут не во многие хозяйства, а только в одно —
нуклеусное стадо. За счет этого снабдить генетическим материалом
(сперма и эмбрионы) можно целые страны или регионы в зависимости от их размера.
В Дании программа по трансплантации эмбрионов в отличие от
селекционных программ МОЕТ предусматривает широкое применение данного метода в каждом фермерском стаде совместно с искусственным осеменением. В связи с этим в стране специалисты по искусственному осеменению прошли обучение по овладению методом
пересадки эмбрионов. В результате каждый из них по заявке фермера
может осуществлять пересадку эмбрионов, полученных как от коровдоноров данного фермера, так и от других коров с необходимыми генетическими и продуктивными качествами. Цель данной программы
— поставить на одну ступень способ искусственного осеменения животных и трансплантацию эмбрионов, что, по нашему мнению, требует колоссальных финансовых затрат!
Зарубежный опыт по разведению крупного рогатого скота молочных пород показывает, что при постановке на оценку молодых
бычков категорию улучшателей получают лишь 10 % животных, которые могут быть в дальнейшем допущены к племенному использованию. В категорию лучших быков, получающих право общенационального или международного использования, входят 2— 3
% быков от поставленных на проверку.
С помощью новых технологий стало возможным разделять сперму по полу, используя принцип цитометрии потока, чтобы в результате осеменения получить животное желаемого пола. Этот метод даёт
90% гарантии успеха, в среднем 9 из 10 рождённых телят будут желаемого пола.
Перспективы использования разделённой по полу спермы широки и очевидны: возможность в случае срочного увеличения поголовья
стада не закупать скот со стороны и, следовательно, уменьшить риск
занесения инфекции в стадо; планировать увеличение племенной
ценности животного, включая такие характеристики как здоровье
вымени, сопротивляемость заболеваниям, лёгкость отёлов, уровень
оплодотворяемости; быстро увеличивается молочное стадо, когда
ферма получает только нужных ей тёлочек.
Успешно работает на ряду со многими международными организациями по симментальской породе как Европейской федерации скотоводов пятнистого (симментальского) скота (EVF – Europaischen
Vereinigung der Fleckviehzuchter) организациями Германии, Франции,
Италии, Югославии, Австрии, Швейцарии и в 1974 г.–Всемирной федерации симментальского скота (WSFF– World Simmental-Fleckvieh
Federation) способствовало её известности программа племенной работы Flecvie Austria, МАS-селекция по айрширской породе, ЭТ/ДТ –
программа разведения крупного рогатого скота голштинской породы
Германии, программа селекции крупного рогатого скота Канады и
США.
Литература:
1. Ерохин, А.С. Методы регуляции пола у животных [Текст]
/А.С.Ерохин, М.И.Дунин : книга. -М.:ВНИИплем, 2009. - 64 с.
2. Эрнст, Л.К. Трансплантация эмбрионов сельскохозяйственных животных. [Текст] /Л.К.Эрнст, Н.И.Сергеева. - М.: 1989.
УДК 636.934.25/26.082.31
ПЕРСПЕКТИВЫ ИСПОЛЬЗОВАНИЯ
ИСКУССТВЕННОГО ОСЕМЕНЕНИЯ ПЕСЦОВ И ЛИСИЦ
В РЕСПУБЛИКЕ БАШКОРТОСТАН
Д.Ю.Лыткина1, А.В. Уколов1, Л.В.Герасимова2
1
ООО «Октябрьское» РБ, 2 ФГБОУ ВПО Башкирский
государственный аграрный университет, г.Уфа
Впервые опыты по искусственному осеменению зверей проводил
создатель этого метода известный русский ученый И.И.Иванов, который предвидел его большое будущее не только в животноводческой
практике, но и в совершенно новой тогда отрасли - звероводстве. В
настоящее время до 100% поголовья лисиц и песцов в Скандинавских
странах осеменяются искусственно. В России лишь с 2001 г. описываемый метод взяли на вооружение в Гагаринском звероплемхозе
Смоленской области [1, 2].
Искусственное осеменение лисиц и песцов проводят в специально оборудованном помещении, в котором предусматривается наличие
лаборатории, места для взятия спермы и осеменения, а также комнаты для персонала. Из оборудования в лаборатории необходимо иметь
специальный станок для фиксации зверей во время взятия спермы и
искусственного осеменения, зажим-фиксатор для самок и самцов,
микроскоп, дистиллятор, стерилизатор, предметные и покровные
стекла, одноразовые шприцы на 5 и 10 мл, сушильный шкаф, мойку с
холодной и горячей водой, термостол, холодильник, шкаф для инструментов, стол для документов и специально изготовленные инструменты для искусственного осеменения лисиц и песцов: металлические катетеры длиной 24 см с закругленными краями и с внутренним диаметром 1,2 мм; 12-сантиметровые пластмассовые направляющие трубки с внутренним диаметром 3 мм; пробиркиспермоприемники.
Основной способ взятия спермы - мастурбация. Этим методом у
песцов эякулят можно получить в течение 2...3 мин, у лисиц - за 5...10
мин. Собирают его в пластмассовый или стеклянный спермоприемник. Сразу после взятия сперму оценивают визуально, в норме она
должна быть молочно-белого цвета, без посторонних примесей, объем ее может варьировать от 1 до 10 мл. Далее сперму оценивают под
микроскопом по десятибалльной шкале: по густоте, прямолинейнопоступательным движениям спермиев и наличию у них патологиче-
ских изменений. Для осеменения допускается использование спермы
с оценкой не ниже 6 баллов.
После определения качества спермы проводят ее разбавление
синтетической средой в 2... 10 раз. Степень разбавления зависит от
объема эякулята и его густоты. Одноразовым шприцем на 10 мл разбавитель постепенно приливают к эякуляту по стенке спермоприемника. Для разбавления применяют синтетические среды. Разбавленную и готовую к осеменению сперму набирают в одноразовый 5миллилитровый шприц с подсоединенным металлическим катетером.
Объем дозы для осеменения одной самки составляет 0,5...1,0 мл, в
нем должно содержаться не менее 20 млн сперматозоидов. Самку
фиксируют в станке: шею - фиксатором-захватом, который закрепляется на боковой балке приспособления, а хвост - резинкой от эспандера, прикрепленной к верхней балке. Пластмассовую направляющую трубку вводят во влагалище, а в трубку - катетер. Одной рукой
через брюшную стенку фиксируют шейку матки и медленно проникают катетером через ее цервикальный канал. Сперму впрыскивают в
матку, плавно нажимая на поршень шприца.
Важно точно установить срок осеменения самок. Состояние половой охоты у самок можно определять четырьмя способами: по поведению самки в присутствии самца-пробника (рефлекс неподвижности); по состоянию половых органов самки («петли»); по цитологической картине влагалищных мазков по методике Т.М.Чекаловой [5]; по
сопротивлению слизистой оболочки влагалища, определяемому с помощью норвежского прибора SI-LI 3, который в Финляндии называют Брюнсметром. Самок песца осеменяют двукратно - в первый и
третий дни охоты, а самок лисицы - в первый и второй.
На звероферме ООО «Октябрьское» имеется около 500 самок голубых песцов пород вуалевый и шедоу, а также 100 самок серебристо-черной лисицы, завезенных в 2012 г. со зверохозяйства «Вятка»
Кировской области. Это хозяйство имеет одно из лучших стад песцов
и лисиц в России. Известно, что селекция в российских зверохозяйствах в последние десятилетия в основном была направлена на увеличение выхода щенков, что дало очень хорошие результаты: в лучших зверохозяйствах получают более 9 щенков на покрытую самку
песца, 5 щенков – самку лисицы, но по размеру зверей в основном
производился стабилизирующий отбор [4]. Так средняя живая масса
завезенных самок составляет около 6 кг, самцов – 7 кг. В скандинавских же странах с помощью искусственного осеменения созданы массивы песцов, в которых живая масса самцов достигает 15–20 кг.
Результаты воспроизводства пушных зверей в ООО «Октябрьское» представлены в таблице 1.
Таблица 1 Результаты гона и щенения песцов и лисиц
Показатель
Всего самок
в т.ч. холостых
пустых
НБР
ощенилось
Родилось щенков
Плодовитость
Лисица
гол
96
10
31
7
48
250
5,21
Песец
%
100
10,4
32,3
7,3
50,0
-
гол
497
155
134
45
163
1606
9,85
%
100
31,2
27,0
9,1
32,8
-
Данные свидетельствуют, что плодовитость молодых самок в первый год щенения в ООО «Октябрьское» РБ была довольно высокой и
составляла 5,21 у лисиц и 9,85 – у песцов. Большие резервы увеличения выхода щенков заключаются в уменьшении прохолостований,
пропустований самок и уменьшении числа неблагополучных родов.
Для повышения эффективности песцеводства и лисоводства планируется завоз самцов песцов и лисиц, имеющих крупные размеры и
отличное опушение. Внедрение искусственного осеменения песцов и
лисиц в ООО «Октябрьском» позволит сократить количество завозимых импортных высокоценных производителей. Максимальное использование их для воспроизводства поможет кардинально увеличить
размер зверей и улучшить качество волосяного покрова (однородность цвета, густоту, плотность и выравненность волоса) за счет высоких темпов селекции по количественным признакам и даст возможность конкурировать на рынке пушнины.
К тому же на мировом рынке отмечается устойчивый спрос на
шкурки гибридов между разными породами лисиц и песцов /3/. Поэтому важным резервом увеличения рентабельности, который открывает искусственное осеменение, является воэможность получения
шкурок песцово-лисьих гибридов, когда вуалевых самок осеменяют
спермой серебристо-черной лисицы.
Литература:
1. Жвакина, А.Р. Репродуктивные технологии в звероводстве
[Текст] /А.Р. Жвакина, Багиров В.А., Кудрявцев В.Б. //Достижения
науки и техники АПК. -2011. -№12. -С.60-63.
2. Кудрявцев, В.Б. Искусственное осеменение песцов и лисиц в Гагаринском звероплемхозе [Текст] /В.Б.Кудрявцев, О.А. Николаев
//Кролиководство и звероводство. -2004. -№4. –С.7-8.
3. Паркалов, И.В. Межвидовая гибридизация в звероводстве
[Текст] / И. В. Паркалов // Кролиководство и звероводство. - 2008. №5. - С. 8-10.
4. Чекалова, Т.М.Эффективность селекции по воспроизводительной способности у песцов (alopex lagopus) и лисиц (vulpes vulpes) в
условиях их клет. разведения на спец. зверофермах [Текст]
/Т.М.Чекалова //Вестник ВОГиС. -2007, Том 11. -№ 1. – С. 195-203.
УДК 636.2.082
ВОСПРОИЗВОДИТЕЛЬНАЯ СПОСОБНОСТЬ
ЧИСТОПОРОДНЫХ И ПОМЕСНЫХ ТЕЛОК
А.Б. Макулова, Ю.А.Карнаухов
ФГБОУ ВПО Башкирский государственный агарный университет,
г.Уфа
Экспериментальная часть работы включала научно-хозяйственный опыт, проведенный в 2007 – 2010 г.г. в СПК «Алга» Чекмагушевского района Республики Башкортостан.
Для проведения исследований были подобраны полновозрастные
коровы (в возрасте 5-7 лет, третий – четвертый отел) бестужевской
породы в количестве 65 голов, которых искусственно, ректо-цервикальным способом, осеменили: часть спермой быков - производителей бестужевской породы, а часть – салерской.
Из полученного приплода было сформировано 2 группы бычков
и две группы телок по 15 голов в каждой, бычков в 2-месячном возрасте кастрировали открытым способом. В первую группу входили
чистопородные кастраты бестужевской породы, во вторую их помесные полукровные сверстники, в третью чистопородные бестужевские
телки и в четвертую помесные салерс х бестужевские телки. Молодняк до 6-месячного возраста выращивался методом ручной выпойки
молока, затем кастраты были переведены на откормочную площадку,
а телки зимой содержались группой без привязи, летом – на пастбище.
Основные задачи воспроизводства стада сводятся к интенсивному использованию маточного поголовья для получения телят, выращиванию и сохранению их здоровья.
В практической деятельности очень важно установить хозяйственную зрелость молодняка (С.В. Карамаев, Х.З. Валитов, Е.А. Китаев, 2011).
Для обеспечения эффективного использования коров, получения
от них максимального количества приплода в течение жизни ее необходимо осеменить, как можно в более раннем возрасте.
Однако ранний ввод телок в процессе воспроизводства имеет как
положительные, так и отрицательные последствия. Положительный
эффект бывает только в том случае, когда животные достигают оптимальной живой массы, гармоничного развития, имеют крепкую конституцию. Слишком раннее оплодотворение телок задерживает их
рост и развитие, ослабляет организм, и такие животные в дальнейшим
непригодны к длительной и интенсивной эксплуатации. У таких
нетелей часто бывают трудные отелы, телята рождаются недостаточно жизнеспособными. Слишком поздняя случка из-за недостаточного
и неполноценного кормления ухудшает воспроизводительные функции телок, в дальнейшем отрицательно сказывается на молочной
продуктивности коров. Поэтому телок следует осеменять по достижении ими хозяйственной зрелости.
По мнению Н.М. Костомахина и др. (2006) хозяйственная зрелость
организма характеризуется завершением его формирования, когда животное достигает 65-75% живой массы взрослой коровы стандарта породы, т.е. требования I класса. В нашем случае это 340-350 кг живой
массы. При изучении воспроизводительной способности телок учитывали следующие показатели: возраст при плодотворном осеменении,
оплодотворяемость от первого осеменения, индекс оплодотворяемости.
Установлено, что интенсивное выращивание подопытных телок
повысило их скороспелость, способствовало более ранней половой и
хозяйственной зрелости (таблица 1).
Таблица 1 Воспроизводительная функция телок (X±Sх)
Показатель
Возраст при плодотворном осеменении, сут.
Средняя живая масса, кг.
Оплодотворяемость от первого осеменения, %
Индекс оплодотворяемости
Группа
III
543,6±8,52
341,8±4,52
73,4
1,43
IV
453,4±6,56
347,6±3,41
80,0
1,20
У полукровных телок хозяйственная зрелость в среднем наступала в возрасте 453 суток, что на 90 суток раньше, чем у чистопородных
телок бестужевской породы. Следует отметить, что при выращивании
помесных телок на высоком уровне кормления и осеменения их в
возрасте 15 мес, при средней живой массе 348 кг, наблюдалась более
высокая их оплодотворяемость в сравнении с чистопородными
сверстницами.
Оплодотворяемость подопытных телок составляла 93,3 – 100%, в
том числе от первого осеменения 73,4 – 80,0%, а количество осеменении на одно оплодотворение было 1,20 – 1,43.
Литература:
1. Карамаев, С.В. Скотоводство [Текст] / Карамаев, С.В., Валитов,
Х.З., Китаев, Е.А. / РИЦ СГСХА, 2011. – 575 с.
2. Костомахин, Н.М. Разведение с основами частной зоотехнии
[Текст]/ Костомахин, Н.М., Потокин, В.К, Кириллова, Е.К. / СПб.:
«Лань», 2006. – 448 с.
УДК 619:616.379 – 008.64:636.7
ЛЕЧЕБНАЯ ТАКТИКА ПРИ ДИАБЕТИЧЕСКОМ
КЕТОАЦИДОЗЕ НА ФОНЕ ЕТЭСТРУСАССОЦИРОВАННОГО
САХАРНОГО ДИАБЕТА У СУК
Ю.С. Мартынова, А.Н. Мартынов, В.Г. Турков, С.Г. Сапронова
ФГБОУ ВПО Ивановская государственная сельскохозяйственная
академия имени академика Д.К. Беляева, г. Иваново
Ветеринарная эндокринология мелких домашних животных в течение последних лет получила быстрое развитие. Сахарный диабет
одна из частых диагностируемых патологий [1,4,5]. Одной из разновидностей сахарного диабета у собак является метэструсассоциированный диабет. Данная патология возникает в период беременности
или нормальном метэструсе и характеризуется гипергликемией.
Позднее обращение за ветеринарной помощью и слабое знание эндокринной патологии приводит к выявлению осложнений сахарного
диабета. Основным осложнением течения метэструсассоциированного сахарного диабета у собак является диабетический кетоацидоз.
Цель исследования разработать оптимальный алгоритм диагностики и лечения диабетического кетоацидоза развившегося на фоне
метэструсассоциированного сахарного диабета.
Базой исследования явился лечебно-профилактический и лабораторно-диагностический ветеринарный центр «Ветасс» при кафедре
хирургии и акушерства ФГБОУ ВПО «Ивановская ГСХА имени академика Д.К. Беляева». Исследование проводили в период с 2007 по
2012 годы. В исследовании приняли участие 16 собак с установленным диагнозом метэструсассоциированный сахарный диабет осложненный диабетическим кетоацидозом.
Диагноз устанавливали на основании соответствующей клинической картины и данных анамнеза. Развитие кинической картины отмечено спустя 1,5 – 2 месяца после последней течки полиурия, полидипсия, тошнота, рвота, диарея, признаки дегидратации (сухость кожи и слизистых оболочек, снижение тургора кожи), нарушения уровня сознания, глубокое шумное дыхание, фруктовый запах из пасти (у
части пациентов), абдоминальный синдром (боль в животе, диарея).
Всем пациентам проводили рутинные исследования (гематологическое, биохимическое, электролитное, гормональное исследования
крови и изучение антиоксидантного статуса), ультразвуковое исследование органов брюшной полости и рентгенографию органов грудной полости, проводили исследование мочи и выполняли электрокардиографию.
Лечение собак с метэструсассоциированным сахарным диабетом
осложненным диабетическим кетоацидозом преследовало следующие
цели [2,3]: регидратация, восполнение дефицита инсулина, коррекция
выявленных нарушений электролитов, лечение сопутствующей патологии. Медикаментозная коррекция начиналась сразу после установления диагноза. Регидратация проводилась 0,9% раствором натрия
хлорида в объеме 80% от потребности в жидкости и вводилась за 10
часов; рассчитывали потребность в жидкости по формулам
А=(В+С+Д)/10, где В (мл, необходимые для регидратации) = вес тела
(кг)*% обезвоживания*1000мл/л*0,8; С (поддерживающий объем) =
2,2 мл/кг/час*10час; Д = количество потерь в мл при рвоте за 10-ти
часовой период. Все растворы вводятся подогретыми до 370С. Инсулинотерапия начинается сразу – используя только короткие инсулины
(Актрапид регуляр, Хумулин регуляр) в дозе 0,1 МЕ/кг. Для этого добавляем 0,5МЕ/кг инсулина в шприц на 50мл 0,9% раствор натрия
хлорида. Полученный раствор вводим со скоростью 10мл/час. Для
предотвращения адсорбции инсулина пластиковыми трубочками добавляем в раствор натрия хлорида альбумин, до внесения инсулина.
Инсулиносодержащий раствор натрия хлорида меняем каждый час на
свежеприготовленный. При отсутствии эффекта от введения инсулина в течение 2 часов скорость введения удваиваем. При снижении
гликемии до 14 ммоль/л переходим на введении глюкозы 10% параллельно с инсулином. При нормализации уровня глюкозы и состояния
пациента переходим на подкожное введение инсулина каждые 2 часа,
а затем каждые 4 часа. Уменьшение введения инсулина при нормализации гликемии приводит к «подкармливанию» диабетического кетоацидоза и соответственно продлевает его. Исследование уровня калия
проводим до начала терапии, через час начала инсулинотерапии и затем каждые 2 часа. Практически у всех пациентов с диабетическим
кетоацидозом развивается дефицит калия. Для коррекции гипокалиемии всем пациентам спустя 2 часа начала инсулинотерапии назначаем инфузии калия хлорида, в растворе Рингера. После нормализации
клинико-лабораторных данных, восстановлении способности самостоятельно принимать пищу, контроля сопутствующей патологии пациента переводим на обычную инсулинотерапию и ставится вопрос о
проведении овариогистерэктомии.
Таким образом, полученный материал, показывает серьезность и
тяжесть состояния пациентов с диабетическим кетоацидозом на фоне
метэструсассоциированного сахарного диабета и современные возможности инсулинотерапии при данной патологии. Осложненный
диабетическим кетоацидозом метэстусассоциированный сахарный
диабет, ведет к развитию тяжелой полиорганной недостаточности.
Литература:
1. Гильдиков, Д.И. Изменение белкового обмена при сахарном
диабете у собак и кошек [Текст]/ Д.И.Гильдиков, В.Н.Байматов //
Российский ветеринарный журнал: мелкие домашние и дикие животные, 2009 - №4. С. 7 – 9.
2. Дедов, И.И. Эндокринология [Текст]: - М.: ГЭОТАР-Медиа,
2009. С.117 – 125.
3. Макинтайр, Д. Скорая помощь и интенсивная терапия мелких
домашних животнах [Текст] / Макинтайр, Д., Дробац К., Хаскингз, С.,
Саксон, У// Практическое руководство/ Пер. с англ. Лисициной Т.В. –
М.: «Аквариум-Принт», 2008. С. 329.
4. Eigenmann, J.E. Diabetes in elderly female dogs: recent findings on
pathogenesis and clinical implications.// Journal of the American Animal
Hospital Association, 1981; 17:805.
5. Herrtage, M.E. et al.: Diabetic retinopaty in a cat with megestrol
acetateinduced diadetes.// J Small Anim Pract, 1985; 26:595.
УДК 619:615.847:636.5
ИЗУЧЕНИЕ ДЕЙСТВИЯ МОНОХРОМАТИЧЕСКОГО
ОСВЕЩЕНИЯ НА РОСТ СЕРДЦА КУРИНЫХ ЭМБРИОНОВ
А.А. Малофеев, Д.В. Метальникова, Р.Ю. Хохлов
ФГБОУ ВПО Пензенская государственная сельскохозяйственная
академия, г.Пенза
Установлено, что свет является мощным физическим фактором,
влияющим на функциональное состояние органов и тканей животных
и человека (Карапетян С.К., 1955; Пигарев Н.В., 1967; Bednarczyk M.
F., Simon J., Ferre R., Leclercq B., 1984; Coleman M.A., McDaniel G.R.,
Neely W.C., Ivey W.D., 1997; Лукьянова С.Н., Алексеева В.А., 2011).
Изучение свойств видимого света показало, что световая энергия
распределяется по световому спектру не одинаково. В зависимости от
спектра одному и тому же количеству люменов соответствует разное
количество ватт. Установлено, что чувствительность глаза к лучам с
разной длинной волны спектра неодинакова и достигает максимума
при длине волны 540 нм, что соответствует зеленому участку спектра. Красные световые волны (670 нм) легко проникают вглубь тканей, проходя через кожу, мышцы, сосуды, достигая прямым путем
гипоталамус, а через него и гипофиз. Основное количество исследований о влияние различных спектров видимого света посвящено
постнатальному онтогенезу. Что касается эмбрионального периода,
то работ в этом направлении не достаточно для выявления механизмов и закономерностей действия волновой энергии света на индивидуальное развитие животных и птиц.
В связи с этим мы определили цель наших исследований – изучить
влияние красного монохроматического света на эмбриогенез куриного
эмбриона. В качестве объекта исследования выбрали сердце эмбриона.
Задачей исследования было определение динамики относительного
прироста массы сердца куриного эмбриона при включении в технологию инкубирования красного монохроматического света.
Для осуществления поставленной задачи сформулировали две
группы яиц по 90 штук в каждой с последующей их инкубацией.
Первая группа, инкубация которой осуществлялась в темноте, была
контрольной. Вторая группа, инкубация которой осуществлялась в
сочетании с красным монохроматическим светом с длиной волны 670
нм, в круглосуточном режиме – была опытной. Технологические параметры инкубационного процесса в обеих группах соответствовали
нормативным. Ежедневно, с 10-суточного возраста осуществляли
вскрытие эмбрионов в количестве 6 голов в каждой группе и препарировали сердце.
Сердце взвешивали на весах Adventurer AR-2140 и на основании
полученного цифрового материала рассчитывали относительный
прирост массы сердца в каждой группе по формуле:
K
(Wt  W0 )  100
,
(Wt  W0 )  2
где К – относительный прирост в процентах за определенный отрезок
времени; Wt – значение показателя в возрасте (t); W0 – начальное значение показателя.
Динамика относительного прироста массы сердца куриных эмбрионов обеих групп представлена на рисунке 1.
70,00
Относительный прирост, %
60,00
50,00
40,00
30,00
20,00
10,00
0,00
10-11
11-12
12-13
13-14
14-15
15-16
16-17
17-18
18-19
19-20
Возрастные интервалы, сут
контроль
опыт
Рисунок 1. Динамика относительного прироста массы сердца
куриных эмбрионов
Анализируя относительный прирост массы сердца куриного эмбриона, следует отметить, что за возрастной интервал 10-11 суток
анализируемый показатель в опыте оказался на 14 % больше, по
сравнению с контролем. В следующий возрастной интервал 11-12 суток относительный прирост массы сердца в обеих группах снизился,
так в опыте на 20,13 %, а в контроле лишь на 3,46 % и составил 43,59
% и 46,26 %, соответственно. Таким образом, относительный прирост
массы сердца, за анализируемый интервал, в опыте был на 2,67 %
меньше, чем в контроле. В возрастном интервале 12-13 суток относительный прирост массы сердца изменился, по сравнению с предыдущим возрастным интервалом не существенно, так в опыте он снизил-
ся лишь на 0,16 %, а в контроле, напротив, увеличился на 0,99 %.
Сравнивая относительный прирост массы сердца в анализируемом
возрастном интервале, отмечаем, что в контроле его значение было
выше на 3,82 %, по сравнению с опытом.
В возрастном интервале 13-14 суток наблюдается асинхронное
изменение анализируемого показателя. Так в опыте относительный
прирост массы сердца, по сравнению с предыдущим возрастным интервалом увеличился на 9,82 % и составил 53,25 %, а в контрольной
группе, напротив, снизился на 3,75 % и составил 43,50 %. Таким образом, на данном этапе эмбриогенеза относительный прирост массы
сердца был выше в опытной группе на 9,75 %. Что касается следующего возрастного интервала – 14-15 суток, то он характеризуется резким снижением прироста массы сердца в обеих группах. А именно в
опытной группе он сократился на 45,68 %, а в контрольной на 29,18
% и составил 7,57 % и 14,32 %, соответственно.
Таким образом, в анализируемом возрастном интервале относительный прирост массы сердца в опытной группе оказался почти в 2
раза меньше, чем в контрольной.
Следующие два возрастных интервала 15-16 и 16-17 суток характеризуются синхронными изменениями анализируемого показателя у опытных и контрольных эмбрионов с минимальной разницей
между группами. На следующем этапе эмбриогенеза 17-18 сутки отмечается более интенсивное увеличение прироста массы сердца у
контрольных эмбрионов, а именно на 11,87 %, тогда как в опыте увеличение составило лишь 5,81 %. Что касается разницы между группами, то в анализируемом возрастом интервале относительный прирост массы сердца в контрольной группе оказался на 6,15 % больше,
чем в опытной. В следующий возрастной интервал 18-19 суток в
опытной группе прирост массы сердца не существенно увеличивается
на 0,4 %, а в контрольной, напротив существенно снижается на 13,08
%. Таким образом, в этом возрастном интервале прирост массы сердца был больше на 7,33 % в опыте.
На заключительном этапе эмбриогенеза 19-20 сутки отмечается
снижение прироста массы сердца у куриных эмбрионов в обеих группах. Но вместе с тем, прирост массы сердца в опытной группе был на
9,02 % больше, по сравнению с контрольной.
Таким образом, на основании полученных данных, можно констатировать, что красный монохроматический свет с длиной волны
670 нм оказывает достоверное влияние на рост массы сердца курино-
го эмбриона на заключительном этапе эмбриогенеза 18-20 сутки.
Также в эмбриональном морфогенезе сердца куриных эмбрионов
можно выделить 4 периода. Первый период – с 10 по 14 сутки, характеризуется стабильно высоким приростом массы сердца. Второй период – с 14 по 16 сутки, характеризуется относительным покоем в росте сердца. Третий период – с 16 по 18 сутки, для него характерен
умеренный рост массы сердца. Четвертый период – с 18 по 20 сутки,
характеризуется уменьшением роста сердца.
Литература:
1. Карапетян, С.К. Значение удлиненной световой экспозиции в
повышении биологической активности животного организма [Текст]//
Успехи соврем. Биологии. – 1955. – т. 9. – вып. 1. – С. 65-67.
2. Пигарев, Н.В. Задачи исследования световых режимов в интенсивном птицеводстве [Текст] // Разработка научных основ электрификации сельского хозяйства. Вып 1. – Запорожье. – 1967. – С. 47-49.
3. Bednarczyk, M. F., Simon J., Ferre R., Leclercq B. Effect of Light
During Embryonic Development in Two Lines of Chickens Selected for
Leanness or Fatness." Reprod. Nutrition Dev. 24 (1984), 235-238.
4. Coleman, M.A., McDaniel G.R., Neely W.C., Ivey W.D. Physical
Comparisons of Lighted Incubation in Avian Eggs. Poultry Science, 56
(1997), 1421-1425.
5. Лукьянова, С.Н. Изменения в реакции нейронов зрительной области коры головного мозга кролика на вспышку света под влиянием
низкоинтенсивных физических факторов неионизирующей природы
[Текст]/ Лукьянова, С.Н., Алексеева В.А./ Радиац.биология. Радиоэкология, 2011; Т.51, N 4. - С. 471.
УДК 619:618.19+636.7:611.6
ВЛИЯНИЕ НОВООБРАЗОВАНИЙ В ТКАНЯХ
МОЛОЧНОЙ ЖЕЛЕЗЫ У СУК НА ГОМЕОСТАЗ
А.Н. Мартынов, В.Г. Турков
ФГБОУ ВПО Ивановская государственная сельскохозяйственная
академия имени академика Д.К. Беляева, г. Иваново
Новообразования в молочной железе у сук регистрируют достаточно часто [1,3]. Это гетерогенная группа заболеваний часто сопровождается глубокими нарушениями в функции органов и систем организма животного. Известно, что внешне идентичные изменения в
тканях молочной железы могут быть вызваны далеко не однородными процессами и иметь различные последствия [1,2,3].
Дальнейшее изучение природы новообразований и поиск новых
способов диагностики и лечения является одной из актуальнейших
задач современной ветеринарной онкологии.
Цель настоящей работы заключалась в определении наиболее
значимых изменений в гомеостазе животных, которые возникают у
сук с новообразованиями молочной железы.
Работа выполнена в течение 2008 - 2011 годов на базе лабораторно-диагностического и лечебно-профилактического ветеринарного
центра «Ветасс» при ФГБОУ ВПО «Ивановская ГСХА имени академика Д.К. Беляева», патологоанатомического отделения областной
клинической больницы г. Иваново, городской клинической больнице
№ 4 г. Иваново.
В работе использован научный материал, полученный на основании детального анализа 87 историй болезни собак разных пород и
возрастных групп, с опухолевыми поражениями молочных желез содержащихся в домашних условиях. В качестве контроля показателей
характеризующих нормальный гомеостаз использовали группу здоровых собак, которая включала 7 сук в возрасте от 4 до 8 лет, в стадии анэструса.
Гематологические исследования проводили на автоматическом
гематологическом анализаторе ВСЕ-90Vet. Определение биохимических показателей проводили при помощи полуавтоматического биохимического анализатора «Biochem BA» открытого типа с использованием реактивов фирмы «Ольвекс».
Проведение определения биохимических маркеров вели согласно наставлениям производителя. Содержание эстрадиола, прогестерона, свободного тироксина в сыворотке крови определяли радиоиммунохимическим методом на аппарате «Нарко Тест», двенадцатиканальном гамма счетчике. Для определения эстрадиола, прогестерона
и свободного тироксина использовали наборы фирмы BECKMAN
COULTER COMPANY IMMUNOTECH, Прага.
В таблице представлены ретроспективный анализ изучаемых гематологических, биохимических и гормональных показателей крови
у сук с новообразованиями в тканях молочной железы.
На основании гистологического исследования пораженных тканей молочной железы новообразования были отнесены в одну из
групп представленных в таблице 1.
Таблица 1 Показатели гомеостаза у собак
с новообразованиями молочной железы
Гистологический диагноз
ДисгормоПоказатель
Злокачественные
Фиброаденальные
Аденомы
новообразования
номы
дисплазии
Эритроциты
НГН*
N*
N
N
12
5,69±0,39
6,14 ±0,17
6,59±0,58
6,47±0,31
М±m (10 /л)
Лейкоциты
ВН***
N
N
N
18,07±2,14
12,17±1,12
8,86±0,91
13,91±2,15
М±m (109/л)
НГН***
N*
N*
N**
Гемоглобин М±m (г/л)
125,76±5,55
135,19±1,67
132,2±2,23
140,0±2,32
Скорость оседания эритЗВН****
ВН****
ВГН**
ВН***
роцитов М±m (мм/час)
26,41±6,39
7,07±1,34
4,4±1,43
6,83±1,55
Билирубин общий
N*
N***
N
N*
М±m (мкмоль/л)
8,82±1,14
8,91±0,78
6,46±1,45
8,34±1,50
Билирубин прямой
N**
N
N
N
М±m(мкмоль/л)
1,65±0,32
1,24±0,18
0,99±0,54
1,49±0,50
ВГН*
N*
N
N
АСТ М±m (МЕ/л)
60,17±5,39
58,35±5,19
56,51±9,00
48,30±10,70
ВГН***
N**
N
N
АЛТ М±m (МЕ/л)
62,68±6,67
54,61±4,40
43,95±8,34
52,91±13,33
N**
ВГН****
N*
ВГН***
Общий белок М±m (г/л)
69,11±2,68
74,47±0,78
72,64±2,85
75,63±2,60
N
N
N
N**
Альбумины М±m (г/л)
30,64±1,62
31,98±0,65
32,9±2,13
34,4±1,24
Мочевина
N**
N*
N*
ВН
М±m (ммоль/л)
6,35±0,63
6,72±0,39
7,19±1,03
8,86±2,90
Креатинин
ВГН***
ВГН***
N*
ВН**
М±m (мкмоль/л)
125,34±9,6
117,05±5,7
113,0±11,03
136,0±26,5
N**
N**
N
N
ГГТ М±m (МЕ/л)
4,51±0,74
4,25±0,55
3,55±1,46
3,75±1,07
Глюкоза
N
N***
N**
ВН
М±m (ммоль/л)
5,52±0,85
4,74±0,12
4,68±0,20
8,56±4,09
Холестерин
ВН***
ВН***
N
ВН**
М±m (ммоль/л)
7,41±0,62
6,82±0,31
5,23±0,42
7,43±1,21
Щелочная фосфатаза
ЗВН*
ВН*
N
ЗВН**
М±m (МЕ/л)
327,8±69,67
225,5±20,08
128,0±7,44
327,6±95,73
Кислая фосфатаза
ЗВН****
N***
N*
N
М±m (МЕ/л)
12,20±1,03
1,35±0,18
1,48±0,41
4,37±1,88
Эстрадиол
N
ЗВН***
ВН***
ВН
М±m (пмоль/л)
197,7±37,23
409,3±61,05
328,0±14,14 333,6±167,63
Прогестерон
ВН
N
ВН
ЗВН
М±m (нмоль/л)
2,54±0,61
2,19±0,38
4±0
9,54±6,98
Свободный тироксин
НН***
НН***
N
НН*
М±m (пмоль/л)
8,07±0,78
8,47±0,42
13,35±2,72
7,54±1,25
Примечание: ВН – выше нормы, ЗВН – значительно выше нормы, НН – ниже нормы, ВГН
– верхняя граница нормы, НГН – нижняя граница нормы, N - норма; ** - p<0,05, * р<0,02, *** - p<0,01, **** - p<0,001.
Полученные результаты позволяют заключить, что для злокачественного течения процесса в тканях молочной железы у сук характерными изменениями в гомеостазе являются: лейкоцитоз, возрастание СОЭ, повышение лейкоцитарного индекса интоксикации, возрастание уровней щелочной и кислой фосфатаз в крови, а также снижение уровня свободного тироксина. Для собак с дисгормональными
дисплазиями молочных желез наиболее характерными изменениями в
гомеостазе являются увеличение щелочной фосфатазы, эстрадиола,
скорости оседания эритроцитов, лейкоцитарного индекса интоксикации, непрямого билирубина, глобулинов, холестерина и снижение
уровня свободного тироксина. Результаты наших исследований позволяют не только глубже представить состояние функции органов и систем больного животного, но и повысить качество лечебной помощи.
Литература:
1. Мартынов, А.Н. Дисгормональные дисплазии молочной железы у собак [Текст]: Автореф…канд.вет.наук. – Воронеж, 2012. – 20с.
2. Хайленко, В.А.Диагностика рака молочной железы [Текст]/
В.А. Хайленко, Д.В. Комова, В.Н. Богатырева. – М.: ООО «Медицинское информационное агентство», 2005. – 240с.
3. Якунина, М.Н., Голубева В. А., Гаранин Д.В. Рак молочной железы у собак и кошек [Текст] / Якунина, М.Н., Голубева В. А., Гаранин Д.В. – М.: ЗООМЕДЛИТ, КолосС, 2010. – 79с.
УДК 619:615.847:636.5
ДИНАМИКА КОЛИЧЕСТВА ЭРИТРОЦИТОВ В КРОВИ
КУРИНЫХ ЭМБРИОНОВ ПРИ ВОЗДЕЙСТВИИ
ОТРИЦАТЕЛЬНЫХ АЭРОИОНОВ
Д.В. Метальникова, А.А. Малофеев, Р.Ю. Хохлов
ФГБОУ ВПО Пензенская государственная сельскохозяйственная
академия, г. Пенза
В процессе инкубации яиц довольно часто можно наблюдать эмбриональную смертность. Поэтому повышение жизнеспособности,
резистентности и выводимости цыплят, является актуальной проблемой. Для уменьшения процента смертности и получения качественного и жизнеспособного молодняка совершенствуется технология
инкубации. Для создания оптимальных условий микроклимата в жи-
вотноводческих и птицеводческих помещениях, а также для инкубирования яиц сельскохозяйственной птицы некоторые исследователи
(А.Л. Чижевский, 1959; В.В. Рудаков, С.К. Александрова, 1987; Е.П.
Дементьев и др., 2000; А.Н. Анин, 2004; Н.Л. Бушунова, 2005 и др.)
рекомендуют использование аэроионизаторов. Применение отрицательных аэроионов способствует усилению функций внутренних органов, повышению резистентности, лучшему росту и развитию взрослых особей и эмбрионов, увеличению содержания в крови гемоглобина, эритроцитов и лейкоцитов.
В связи с вышеизложенным, и на основании анализа доступной
литературы по влиянию аэроионизации на морфофункциональные
изменения у животных и птиц, можно утверждать, что данное научное направление является актуальным и бесспорно содержит научную новизну. Вместе с тем, следует отметить, что основная масса работ по использованию аэроионизации в животноводстве и птицеводстве посвящена постэмбриональному периоду онтогенеза. Что касается эмбрионального этапа онтогенеза, то научных работ, посвященных этому периоду существенно меньше.
Целью наших исследований являлось изучение влияния
аэроионизации на динамику количества эритроцитов в крови куриных эмбрионов. Для этого в условиях лаборатории Пензенской ГСХА
была проведена инкубация куриных яиц. Режим инкубации соответствовал действующим рекомендациям ВНИТИП по инкубации яиц
сельскохозяйственной птицы. Было сформировано две группы яиц по
90 штук в каждой. Контрольная группа инкубировалась в обычном
режиме – без аэроионизации. В опытной группе, в процессе инкубации, ежедневно применялся аэроионизатор «Эффлювион»-3.1, сеансами по 30 минут и концентрацией аэроионов 105 ион/см3. Начиная с
11 суток инкубации осуществляли подсчет количества эритроцитов в
крови куриных эмбрионов. Подсчет эритроцитов проводили в камере
Горяева по общепринятой методике. Так как, эритроциты птиц имеют
ядро, которое не разрушается под действием уксусной кислоты, это
препятствует подсчету. Для окрашивания использовалась краска по
Фриеду и Лукачевой в модификации И.А. Болотникова. После этого
лейкоциты окрашивались в фиолетовый цвет, а эритроциты оставались неокрашенными, что облегчало подсчет.
Динамика количества эритроцитов в эмбриональной крови контрольной и опытной групп представлена на рисунке 1.
Количество эритроцитов, ×10¹²/л
3
2.5
2
1.5
Контроль
Опыт
1
0.5
0
11
12
13
14
15
16
17
18
19
20
Сутки
Рисунок 1 Количество эритроцитов в крови куриных эмбрионов
В контрольной группе количество эритроцитов на 11 сутки инкубации составило 0,33±0,01×1012/л, а в опытной 0,35±0,01×1012/л, что
на 6,96 % больше, чем в контрольной. На 12 сутки инкубации количество красных клеток крови увеличилось в контрольной и опытной
группе на 0,12×1012/л и 0,13×1012/л, соответственно и составило
0,45±0,02×1012/л и 0,48±0,1×1012/л. На 13 сутки эмбриогенеза количество эритроцитов в контроле увеличилось на 0,24×1012/л по сравнению с предыдущими сутками и составило 0,69±0,04×10 12/л. Анализируемый показатель в опыте составил 0,88±0,03×1012/л, что на 27,54 %
достоверно больше, чем в контроле. На 14 сутки инкубации количество эритроцитов в контроле увеличилось на 0,24×1012/л и составило
0,93±0,05×1012/л, в опыте анализируемый показатель увеличился на
0,39×1012/л и составил 1,27±0,09×1012/л, что достоверно больше контроля на 36,56%. На 15 сутки инкубации количество красных клеток
крови в контрольной группе увеличилось на 0,04×1012/л и составило
0,97±0,07×1012/л, а в опытной – на 0,27×1012/л и составило
1,54±0,03×1012/л. Таким образом, в 15 суточном возрасте число эритроцитов в крови опытных эмбрионов достоверно превышало контроль на 0,57×1012/л. Количество эритроцитов в крови контрольных
эмбрионов на 16 сутки инкубации составило 1,01±0,04×1012/л, а в
опытной группе 1,89±0,01×1012/л, что достоверно больше контрольной на 87,13%. На 17 сутки инкубации количество эритроцитов в
контрольной группе зафиксировано на уровне 2,16±0,49×1012/л, а в
опытной 2,44 ±0,04×1012/л. К 18 суткам инкубации количество красных клеток крови в контроле уменьшилось на 0,38×1012/л и составило
1,78±0,08×1012/л. В опыте количество эритроцитов продолжало увеличиваться и составило 2,68±0,25×1012/л. Снижение количества красных клеток в опыте произошло на 19 сутки развития эмбрионов и составило 0,45×1012/л. В контроле количество эритроцитов на 19 сутки
увеличилось до 1,91±0,04×1012/л, что достоверно меньше опыта на
0,32×1012/л. К 20 суткам прирост эритроцитов в контроле и опыте составил, соответственно 0,42×1012/л и 0,30×1012/л. Следует отметить,
что количество эритроцитов в опытной группе достоверно больше
контрольной на 8,58%.
Таким образом, обобщая собственные экспериментальные данные
можно заключить, что наибольший прирост количества эритроцитов в
контроле и опыте приходится на 17 сутки и составляет соответственно
1,15×1012/л и 0,55×1012/л, наименьший в контроле на 15 и 16 сутки эмбриогенеза (0,04×1012/л), а в опыте на 12 сутки (0,13×1012/л).
Наибольшая достоверная разница между контролем и опытом по
количеству красных клеток крови приходится на 16 сутки эмбриогенеза (87,13% - 0,88×1012/л), наименьшая – на 11 сутки (6,06 % 0,02×1012/л).
Снижение количества эритроцитов могло происходить в связи со
снижением процессов гемопоэза в печени и включением в кроветворение костного мозга. Также снижение гемопоэза на поздних этапах
развития может быть связано с заполнением малого круга кровообращения кровью при втягивании желточного мешка внутрь эмбриона,
и перераспределением кровяных клеток в сосудистом русле.
Таким образом, на основании полученных данных можно сделать
вывод: применение искусственной аэроионизации при инкубации куриных яиц приводит к повышению количества эритроцитов в крови
эмбрионов. Причем наибольший прирост количества эритроцитов в
обеих исследуемых группах пришелся на 17 сутки инкубации.
Наибольшее достоверное превышение количества красных клеток
крови в опытной группе было отмечено на 16 сутки развития эмбрионов.
Литература:
1. Анин, А.Н. Влияние аэроионизации на морфологические и
биохимические показатели крови поросят-сосунов [Текст]// Труды
Чувашской государственной с.-х. академии. Чебоксары: ЧГСХА,
2004. - Т. XIX. - С. 20-22.
2. Бушунова, Т.В. Физиологическое обоснование эффективности
аэроионизации при промышленном выращивании бройлеров [Текст]:
автореферат дисс. канд. биол. наук. Благовещенск , 2005.
3. Дементьев, Е.П. Динамика показателей аэроионизации в животноводческих помещениях учхоза БГАУ и свободной атмосфере
[Текст]/ Е.П. Дементьев В.А. Казадаев, Е.В. Цепелева // Ветеринарнобиологические проблемы науки и образования. Уфа: БГАУ, 1999. - С.
70-79.
4. Рудаков, В.В. Ионизация воздуха в животноводческих помещениях [Текст]: Л.: Агропромиздат, 1987. С. 70.
5. Чижевский, А.Л. Руководство по применению ионизированного воздуха в промышленности, сельском хозяйстве и медицине
[Текст]: - М.: Госпланиздат, 1959. - 56 с.
УДК 636.2.082.2
КАЧЕСТВО ШКУР БЫЧКОВ БЕСТУЖЕВСКОЙ ПОРОДЫ
И ИХ ПОМЕСЕЙ С САЛЕРС И ОБРАК
И.В. Миронова, И.А. Масалимов
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Решающим фактором повышения эффективности отрасли животноводства является ускоренное качественное совершенствование существующих пород, в большей степени отвечающих промышленной
технологии [3].
Как известно, каждой породе присущи хозяйственно-полезные
признаки, которые могут проявляться в определенных условиях
внешней среды. Дальнейшее развитие получают животные тех пород,
которые наряду с хорошей приспособленностью к тем или иным
условиям, будут показывать лучшую продуктивность при меньших
затратах труда и средств [4].
Большинство пород крупного рогатого скота по своим хозяйственно-биологическим свойствам представляют большую ценность
и имеют высокие потенциальные возможности для увеличения производства животноводческой продукции. Это, прежде всего, касается
бестужевской породы, которая значительное распространение получила на Южном Урале. Она относится к породам двойного (комбини-
рованного) направления продуктивности, отличается рядом ценных
хозяйственно-биологических признаков и характеризуется сравнительно низкой мясной продуктивностью. Повышение продуктивности
крупного рогатого скота бестужевской породы возможно путем промышленного скрещивания [1].
Скрещивание коров бестужевской породы с быками породы салерс и обрак позволит получить животных, сочетающих в себе положительные хозяйственно-биологические признаки, присущие данным
генотипам.
Порода салерс, мясного направления продуктивности. Выведена
в горных районах Центральной Франции. Отличается неприхотливостью к условиям кормления и содержания. Масть животных темнокрасная. Животные имеют компактное телосложение в форме прямоугольника. Голова средней величины; носовое зеркало светлое; рога
длинные, направлены в стороны и вверх. Грудь глубокая, с хорошо
развитым подгрудком. Передняя и задняя части туловища хорошо
развиты, костяк крепкий, конечности правильно поставлены.
Порода обрак выведена в центральной части Франции и является
одной из наиболее распространённых пород мясного направления
продуктивности в стране. Животные этой породы хорошо приспособлены к экстенсивному производству, известны своей неприхотливостью. Животные характеризуются высокой выносливостью при передвижении на большие расстояния, способностью усваивать большое
количество грубых кормов. Масть животных светло-бурая, со светлыми отметинами на конце морды и конечностях. Голова средней величины с вогнутым профилем. Носовое зеркало и конец хвоста темные. Спина и поясница - широкие, передняя и задняя части туловища
развиты хорошо. Спина имеет некоторую провислость, крестец и корень хвоста приподняты, конечности крепкие, правильно поставленные. Научно-хозяйственный опыт согласно теме исследования проводился в 2010-2011 гг. в СПК - колхоз «Алга» Чекмагушевского района Республики Башкортостан. Объектами исследования являлись
бычки бестужевской породы и их помеси с породой салерс и обрак.
Для опыта подбирали коров бестужевской породы по 3-5 отелу,
которые осеменялись согласно схеме опыта спермой высококлассных
быков соответствующих пород. При этом были сформированы 3
группы животных: I - бычки бестужевской породы, II - бычки помеси
½ салерс х ½ бестужевская, III - ½ обрак х ½ бестужевская.
По методике Г.И. Кульчумовой, И.П. Заднепрянского определяли
массу парной шкуры, ее размеры, площадь и толщину. Для определения площади шкуры брали промеры длины (от линии, соединяющей
концы шкуры на седалищных буграх, до середины междурожья) и
ширины (от линии, проходящей по средней трети шкуры в точке, делящей ее пополам). Толщину шкуры измеряли кутиметром на локте,
середине последнего ребра и маклоке.
От состояния кожного покрова во многом зависит адаптационная
способность животных к условиям внешней среды. Кожный покров,
кроме защитной функции, участвует в терморегуляции и обмене веществ, отражая конституциональный и продуктивный тип животных.
Вместе с тем для кожевенной промышленности важной задачей является получение от сельскохозяйственных животных тяжелого сырья.
Исследованиями В.А. Вершинина (2001), А.Н. Сивко (2002) установлено, что качественные показатели шкуры тесно связаны с массой и упитанностью животных. Эти авторы сообщают, что с увеличением живой
массы тела животного повышается масса шкуры и улучшается ее качество.
Качество шкур крупного рогатого скота главным образом зависит
от их массы, площади и толщины на различных топографических
участках. В связи с этим определенный интерес представляет изучение динамики изменения качества шкур бычков разных генотипов.
По действующему ГОСТа 1134-73 шкуры крупного рогатого скота подразделяются по мессе: на легкие - массой 13-17 кг, средние 18-25 кг и тяжелые - свыше 25 кг.
Анализ полученных данных свидетельствует, что при убое бычков всех групп были получены шкуры, существенно превосходящие
минимальные требования стандарта, предъявляемые к тяжелому кожевенному сырью (табл. 1).
Таблица 1 Характеристика шкур подопытных бычков
Показатель
Предубойная живая масса, кг
Масса парной шкуры, кг
Выход шкуры, %
Длина шкуры, дм
Ширина шкуры, дм
Площадь шкуры, дм2
Толщина шкуры, мм на локте
середине последнего ребра
Группа
I
II
III
476,33±6,34 528,67±3,19 507,33±2,68
34,43±1,11
41,23±1,05
37,10±1,00
7,23±0,16
7,80±0,19
7,31±0,23
20,73±0,66
24,47±0,50
22,50±0,39
18,27±0,67
21,37±0,55
20,67±0,78
378,97±31,53 522,62±13,41 465,17±22,38
4,10±0,21
4,80±0,07
4,53±0,25
5,37±0,36
5,53±0,18
5,39±0,13
на маклоке
Приходится площади шкуры на 1
кг живой массы, дм2
Приходится массы шкуры на 1 дм2, г
6,07±0,36
6,57±0,18
6,40±0,25
0,80±0,05
0,99±0,02
0,92±0,04
91,5±8,33
78,9±0,54
80,1±5,38
Так в возрасте 18 мес это превышение требований ГОСТа по массе у бычков I группы составило 9,43 кг (37,72%), II группы 16,23 кг
(64,92%), III группы 12,1 кг (48,4%).
Вследствие большей длины и ширины шкур у помесных бычков
по площади шкуры они превосходили своих чистопородных сверстников. Это преимущество в пользу молодняка II группы составило
143,65 дм2 (37,91%), III группы - 86,2 дм2 (22,75%).
Определением толщины шкуры на различных топографических
участках установлено, что максимальная ее величина наблюдалась на
маклоке, минимальная - на локте, показатели толщины на ребре занимали промежуточное положение.
При анализе межгрупповых различий по толщине шкуры на различных участках установлено преимущество помесного молодняка
над чистопородными сверстниками бестужевской породы. Достаточно отметить, что преимущество бычков II группы над бычками из I
группы по толщине шкуры на локте составляло 0,7 мм (17,07%),на
середине последнего ребра 0,16 мм (2,98%), на маклоке - 0,5
мм(8,24%), IIIгруппы на 0,43 мм(10,49%),0,02 мм (0,37%), 0,33 мм
(5,44%).
Таким образом, при убое молодняка всех групп получено тяжелое кожевенное сырье, характеризующееся товарно-технологическими свойствами, позволяющими широко использовать его для производства широкого ассортимента кожаных изделий.
При этом промышленное скрещивание бестужевского скота с породами салерс и обрак способствовало повышению качественных характеристик сырья.
Литература:
1. Белоусов, А.М. Совершенствование бестужевского и чернопестрого скота на Южном Урале [Текст] / А.М. Белоусов, В.И. Косилов, Р.С. Юсупов, Х.Х. Тагиров. Оренбург: Издательство «Оренбургская губерния», 2004. 168 с.
2. Вершинин, В.А. Хозяйственно-биологические особенности и
мясные качества бычков казахской белоголовой породы разных гено-
типов: автореф. дисс…. канд. с.-х. наук [Текст] / В.А. Вершинин.
Волгоград, 2001. 22 с.
3. Нелепов, Ю.Н. Биологические и продуктивные особенности
голштинизированного скота Нижнего Поволжья [Текст] / Ю.Н. Нелепов, И.М. Волохов, И.Ф. Горлов // Волгоград, 1999. 207 с.
4. Салихов, А.А. Влияние различных факторов на качество говядины в разных эколого-технологических условиях [Текст] / А.А. Салихов, В.И. Косилов, Е.Н. Лындина. Оренбург, 2008. 368 с.
5. Сивко, А.Н. Хозяйственно-биологические особенности и потребительские свойства мяса симментальских бычков разных типов
телосложения: автореф. дисс…. канд. биол. Наук [Текст] / А.Н. Сивко. Волгоград, 2002. 30 с.
УДК 619:615.847:636.5
ОЦЕНКА ПОКАЗАТЕЛЯ ТОНИЧЕСКОЙ НЕПОДВИЖНОСТИ КУР
ПРИ ИЗУЧЕНИИ СТРЕССОВОЙ ЧУВСТВИТЕЛЬНОСТИ КУР
А. В. Мифтахутдинов
ФГБОУ ВПО Уральская государственная академия ветеринарной
медицины, г. Троицк
Одним из показателей общего состояния напряжения и страха
кур является тоническая неподвижность, которая является признаком
нежелательных поведенческих ответов, обуславливающих в стаде состояние агрессии и каннибализм [1]. Тоническая неподвижность, или
так называемый гипноз животных, является не ассоциативным ответом, наблюдаемым у рыб, лягушек, ящериц, птиц, крыс, кроликов и
мышей. Некоторые исследователи полагают, что указанная реакция
может представлять модель человеческого гипноза, полученного в эксперименте, другие считают, тоническая неподвижность является ответом в серии оборонительных последовательных реакций, направленной
против хищника. Величина тонической неподвижности, по мнению ряда исследователей, является генетически обусловленным признаком,
связанным с деятельностью нервно-эндокринной системы [2].
Актуальным для физиологии и селекции является вопрос о взаимосвязи стрессовой чувствительности времени и тонической неподвижности кур в условиях промышленного содержания.
Тестирование и отбор кур по степени стрессовой чувствительности
проводили путем внутрикожного введения 70% раствора скипидара в
область бородки. Для оценки результатов тестирования "читку" местной реакции осуществляли через 24 часа, по степени выраженности ло-
кального адаптационного синдрома, проявляющегося в виде признаков
асептического воспаления: утолщение бородки, более высокая местная
температура, выраженная краснота, болезненность при пальпации.
Всего проведена оценка стресс чувствительности 1600 голов птиц
родительского стада в возрасте 48 недель. Через 24 часа после воздействия, во время читки реакции, кур и петухов делили на 2 группы – положительно реагирующие и отрицательно реагирующие, птиц с сомнительным результатом реакции в опытные группы не включали. Тоническую неподвижность определяли по методу [3] в собственной модификации, касающейся времени фиксации птицы. Птицу размещали на
спине в U-образной колыбели, фиксируя на 15 секунд. Наблюдатель
размещался на расстоянии 1 м от птицы, не устанавливая зрительного
контакта, так как это приводит к значительному увеличению времени
тонической неподвижности. Через 15 секунд фиксации экспериментатор
удалял руки и начинался отчет времени, если птица начинает движение
в течение 15 секунд и не приходит в состояние неподвижности фиксацию повторяли, но не более 3 раз. Определение тонической неподвижности проводили у 20 голов из каждой группы в период с 10 до 14 часов.
В результате оценки скипидарной пробы птиц родительского
стада через 24 часа после проведения реакции определили, что у 1072
голов была выражена отрицательная реакция, у 360 голов - положительная реакция и у 168 голов – реакция характеризовалась как сомнительная, что составляет 67%, 22,5% и 10,5% соответственно.
В результате оценки тонической неподвижности в течение 15 секундной фиксации необходимо отметить, что стресс-чувствительные
куры входили в состояние тонической неподвижности в среднем с 1,1
раза, для стресс-устойчивых кур требовалось в среднем 1,45 попыток.
На рисунке 1 представлены данные оценки тонической неподвижности кур с разной стрессовой чувствительностью.
Рисунок 1 Время тонической неподвижности, сек
Анализируя полученные результаты, необходимо отметить, что
время тонической неподвижности стресс-чувствительных кур (положительная реакция) составляло 139,7±63,7 сек., против 50,4±29,11 сек. в
группе стресс-устойчивых кур (отрицательная реакция). Разница показателя высокодостоверна (Р=0,00001). Обнаруженные отличия указывают на более высокий уровень времени тонической неподвижности у
стресс-чувствительных кур по сравнению со стресс-устойчивыми.
Увеличение времени тонической неподвижности подтверждает
большую напряженность функциональных систем, реализующих
адаптационные процессы у стресс-чувствительных кур, предположительно выражающиеся изменением времени охранительного торможения и увеличением времени состояния ориентировки, предшествующей развитию стрессовой реакции.
По данным ученых фирмы «Ломанн Тирцухт» и Мюнхенского
технического университета, имеется прямая зависимость между страхом и расклёвом кур [4]. Чем куры больше подвержены страху, тем
больше расклев в стаде. Чем выше у птицы страх, тем сильнее она подвержена расклеву или наоборот является инициатором расклева, вследствие рассогласования процессов возбуждения и торможения, которое,
как известно, является основным механизмом реализации стрессового
повреждения функциональных систем организма. Тестирование кур,
путем моделирования локального адаптационного синдрома, внутрикожным введением 70% раствора скипидара, позволяет вести отбор
кур по степени стрессовой чувствительности. Доказанная в эксперименте прямая зависимость стрессовой чувствительности с реакцией
страха, представит возможность отбирать для родительского стада
стресс-устойчивое поголовье, отличающееся меньшей склонностью к
"девиантному" поведению, что способствует формированию правильной в производственном отношении иерархии соподчинения в стаде.
Литература:
1. Campo, J.L. Realized Heritability of Tonic Immobility in White
Leghorn Hens: A Replicated Single Generation Test [Text]/ J.L. Campo,
C. Carnicer// Poultry Scince. - 1993. - № 72. - pp. 2193-2199.
2. Gallup, G. G. Tonic immobility: The role of fear and predation/ G.
G. Gallup// Psychol. Rec. Vol. 1. - 1977. - pp. 41–61.
3. Jones, R.B. Tonic Immobility in the Domestic Fowl as a Function of
Social Rank [Text]/ R.B. Jones, J.M. Faure // Bio. Behav. – 1982. – Vol. 7.
- pp. 27-32.
4. Расклев перьев курами-несушками// Животноводство России. № 1. – 2011., стр. 15-17.
УДК 677.35
ОСОБЕННОСТИ СТРОЕНИЯ ВОЛОСЯНОГО ПОКРОВА
В ПРОЦЕССЕ АДАПТАЦИИ ЖИВОТНЫХ ГЕРЕФОРДСКОЙ
ПОРОДЫ АВСТРАЛИЙСКОЙ СЕЛЕКЦИИ
Р.Р.Мурдашов, М.Ф.Ахметгариев, Д.Х.Шамсутдинов,
А.З.Шайхутдинова
ГНУ Башкирский научно-исследовательский институт
сельского хозяйства Россельхозакадемии, г. Уфа
В адаптации животных к условиям внешней среды существенную
роль отводят волосяному покрову, защищающий организм животного
от излишней теплоотдачи в силу того, что волосы в своем составе содержат значительное количество кератина – плохого проводника тепла. Защитная роль волосяного покрова от потерь тепла заключается и
в наличии теплозащитного слоя воздуха. Поэтому, чем выше степень
терморегуляции, тем меньше температура кожи, во многом зависящая
от температуры окружающей среды [1]. Между тем важное биологическое значение в приспособлении животных к непривычным для них
факторов внешней среды имеет своевременная смена волосяного покрова. Он изменяется в пределах одного и того же вида не только в зависимости от природно-климатических условий, но и от сезона года.
По состоянию волосяного покрова в связи с акклиматизацией
можно судить о здоровье животных, крепости их конституции, продуктивности [2]. Исходя из этого состояние волосяного покрова мо-
жет в определенной степени явится одним из объективных показателей адаптации скота к условиям его обитания.
Учитывая большую защитную функцию волосяного покрова от
воздействия неблагоприятных факторов внешней среды, мы изучали
его состояние в различные сезоны года при содержании животных в
совершенно новых условиях по сравнению с их родиной Австралией,
откуда их завезли в зону Урала. При этом следует отметить, что
линька животных проходила в обычные для данной территории сроки
довольно интенсивно. Об изменении волосяного покрова завезенного
маточного поголовья в летний и зимний периоды можно судить по
полученным данным (таблица 1).
Результатами наших исследований установлено, что значительная лабильность волосяного покрова определяется сезоном года. В
частности летом он существенно короче, реже, а в его структуре приобретает остевой волос (56,8-52,8%), за счет сокращения удельного
веса пуха до 23,1-25,3%.
Таблица 1 Характеристика волосяного покрова на 1см2
кожи первотелок по сезонам года, X±Sx
Показатель
Масса, кг
Длина, мм
Густота
Структура
волос, % ость
Пух
Переходящий
Сезон
года
Зима
Лето
Зима
Лето
Зима
Лето
Зима
Лето
Зима
Лето
Зима
Лето
1
61,3±0,25
19,5±0,47
38,1±0,56
12,6±0,32
1524,0±5,37
832,0±3,22
16,4
59,0
61,1
23,1
22,5
20,9
Группа
2
75,8±0,35хх
21,5±0,31х
36,4±0,78
11,2±0,53
1427±4,61
895,0±3,15
18,2
53,5
58,4
24,9
23,4
21,6
3
83,6±0,75ххх
23,8±0,52хх
45,2±0,93ххх
13,3±0,21хх
1598,0±6,14хх
958,0±2,69хх
19,3
52,8
57,5
25,3
23,2
21,9
Примечание: х-P<0,05; хх-P<0,01; xxx-P<0,001.
Однако в зимнее время происходит значительный рост волосяного покрова, за счет увеличения удельного веса пуха от 61,1% в первой
группе до 57,5% третьей. В сравнении с летним периодом, его увеличение составило 2,6-2,3 раза соответственно, при снижении ости в
2,9-2,7 раза, что подтверждается исследованиями и других авторов
[4]. Между тем длина волос увеличилась в 2,9 и 2,4 раза, а их макси-
мальная масса с 1см2 площади кожи соответственно в 3,2-3,5 раза.
Между тем, как отмечает Н.П.Мелихов (1998) [3] бычки симментальской породы при содержании на площадке в условиях Нижнего Поволжья характеризовались зимой более длинной (на 22,8%) и густой
(на 4,5%) волосяным покровом с большим содержанием пуха (на
4,5%) чем их сверстники, которые выращивались в помещении.
Известно, что в стабилизации теплового баланса с учетом периода года значительная роль отводится густоте волос, преобладание которого в зимний период по сравнению с летним колебалось от 1,84
раза в первой группе до 1,67 раза у животных третьей опытной группы. Количество волосяного покрова во многом обусловлено и генотипом животных независимо от сезона года.
Так, по общей массе волос на 1см2 кожи имело место явное различие между животными второй над первой группой в зимнее время
при высокодостоверной P<0,01-0,001 разнице 14,5мг или 23,7%, а
третьей и первой – 22,3мг или 36,4%.
Значительно меньше была разница 7,8мг или 10,3% между животными третьей и второй групп, аналогичная тенденция между
группами сохранилась по данному показателю и в летний период.
В частности между животными третьей и первой групп разница
составила 4,3мг или 22,1% при P<0,01.
Однако по длине и густоте волосяного покрова различия между
группами хотя и сохранились, но были менее существенными при явном превосходстве животных из третьей группы при 2,1мм или 18,8%
и 126мг или 15,2% в сравнении с представителями первой группы
при P<0,01-0,001.
В результате резкого изменения условий среды обитания, животные герефордской породы по разному адаптируются в зависимости от
их генотипа за счет соответствующих изменений в характеристике
шерстного покрова с учетом температурно-влажного режима определяемого сезоном года.
Между тем у импортированных животных в процессе акклиматизации в зависимости от их генотипа изменяется и состав минеральных веществ шерстного покрова (таблица 2).
Таблица 2. Содержание минеральных веществ в покровном волосе
герефордских первотелок в зимне-стойловый период, X±Sx
Показатель
Зола, %
1
2,19±0,08
Группа
2
2,24±0,06
3
2,27±0,15
Макроэлементы г/кг св:
кальций
фосфор
Микроэлементы, мг/кг св:
железо
медь
цинк
марганец
кобальт
0,295±0,17
0,312±0,15х
0,364±0,09хх
0,037±0,009
0,044±0,006ххх
0,049±0,003ххх
113,4±25,1
3,5±0,86
28,6±1,52
19,8±1,13
0,53±0,054
119,8±29,6х
3,7±0,74х
29,3±1,62
21,4±3,81х
0,57±0,062
124,3±31,2
3,9±0,65
31,8±3,27
22,6±2,38хх
0,61±0,031х
Примечание: х-P<0,05; хх-P<0,01; xxx-P<0,001.
Анализ приведенных данных показывает, что по всем минеральным веществам кроме железа содержащихся в покровном волосе
подопытные телки характеризовались довольно низким их содержанием. В частности, по сравнению с нормативными данными меди содержится в 2,5 раза, марганца в 3,6 раза и цинка в 5,1 раза меньше в
юго-степной зоне РБ.
Существенные различия по данным минеральным веществам выявлены были и между группами. В частности, вполне достоверная
P<0,05-0,001 разница, имела место по содержанию кальция в покровном волосе между второй, третьей в сравнении с первой группой
27,03-54,06%.
По сравнению микроэлементов максимальная и достоверная
P<0,05-0,01 прослеживалась по марганцу 8,08-13,09 в пользу животных второй и третьей групп.
По остальным микроэлементам разница была также достоверной
P<0,05, но несколько меньше с колебанием 9,62-15,10%.
Таким образом, при изучении адаптационно-приспособительных
качеств установлены изменения не только в морфологическом составе покрова, но и содержании в нем минеральных веществ в зависимости от их генотипа.
Литература:
1. Ажмулдинов, Е.А. Повышение эффективности производства
говядины [Текст] / Е.А.Ажмулдинов, Г.И.Бельков, В.И.Левахин //
Монография. Оренбург.-2000.-274с.
2. Каюмов, Ф. Новые типы и линии мясного скота [Текст] /
Ф.Каюмов, К.Джуламанов, Н.Герасимов//Животноводство России.
№1, 2011.-С.47-48.
3.Мелихов, Н.П. Особенности роста и мясной продуктивности
бычков симментальской породы и помесей с голштинами при различной технологии содержания в условиях Нижнего Поволжья
[Текст] / Н.П.Мелихов// Автореф.дисс.на соиск.уч.ст.канд.с.-х.наук.Оренбург.1998.-22с.
4. Чернов, Г.А. Акклиматизация герефордов и абердин-ангуссов
на юго-востоке [Текст] / Г.А.Чернов//Автор.дисс.на соиск. уч. ст.
канд. с.-х.наук. Оренбург,1971.21с.
УДК 63(02).46.71
ПАТОГИСТОЛОГИЧЕСКИЕ ИЗМЕНЕНИЯ В ПЕЧЕНИ
И ПОЧКАХ КРОЛИКОВ ПРИ ПСОРОПТОЗЕ
М.М.Разяпов, Р.Г.Фазлаев
ФГБОУ ВПО Башкирский государственный агарный университет, г.Уфа
Многолетние изучения патогенеза гельминтозов животных показали, что возбудители болезни оказывают патологическое воздействие не только на те органы, в которых они локализуются, но и отрицательно влияют на морфофункциональное состояние всего организма животных. В своих исследованиях мы поставили задачу изучить влияние паразитирования псороптозных клещей на морфологию
печени и почек.
Для исследований сформировали две группы подопытных животных. Кроликов первой группы (n = 3) экспериментально заразили
клещами Psoroptes cuniculi ,для чего заложили корочки из уха больных псороптозом кроликов, на которых находились половозрелые
особи (самки и самцы,n=90±15),личинки (n=60± 15) и яйца (n=20±10)
всем трем животным. Кролики данной группы составили опытную
группу.
Кроликов второй группы заражению не подвергали - они составили контрольную группу. Подопытных кроликов содержали в разных помещениях, исключающих заражения другими болезнями в виварии факультета ветеринарной медицины ФГБОУ ВПО Башкирский
государственный аграрный университет. Условия кормления и поения – одинаковые. Все кролики опытной группы подверглись заражению псороптозом. На семидесятый день после заражения произвели
убой подопытных кроликов с последующим взятием материала для
гистологических исследований. Брали кусочки органов размером 1х1
см: наружное ухо (ушная раковина) и кожа головы. Взятые кусочки
органов фиксировали в 10% растворе нейтрального формалина. После соответствующей гистологической проводки, готовили срезы
толщиной 7 мкм и окрашивали гематоксилин - эозином. Всего приготовили 54 микропрепарата.
Печень животных контрольной группы имеет дольчатое строение, каждая долька имеет многогранную форму. В центре дольки
располагается центральная вена. От центральной вены веерообразно
к периферии дольки отходят печеночные пластинки, состоящие из
двух рядов гепатоцитов. Гепатоциты имеют кубическую форму, в
центре клетки располагается округлой формы ядро с гомогенным
хроматином и ядрышком. Цитоплазма гепатоцитов имеет умеренную
базофилию, цитолемма клеток определяется отчетливо. Между печеночными пластинками располагаются внутридольковые синусоидные
капилляры, несущие кровь с периферии дольки к центральной вене.
Вокруг внутридольковых синусоидных капилляров определяются
перисинусоидальные пространства. Между дольками, в слабо развитой междольковой рыхлой соединительной ткани располагается триада печени (междольковая артерия, вена и междольковый венозный
проток). У опытной группы животных (больных псороптозом) в гистологической структуре печени имеются определенные изменения.
Прежде всего, в цитоплазме гепатоцитов выявляются вокуоли, заполненные цитоплазматической жидкостью. Вокуоли, содержащие прозрачную жидкость, различного диаметра и равномерно распределяются по всей цитоплазме. Ядра большинства клеток занимают центральное положение, иногда определяется смещение ядра к периферии клетки. Вакуолизация гепатоцитов определяется не только не
только в центральной части дольки печени, но и по периферии, именно в периферической части дольки определяется гепатоциты двуядерные, особенно в зоне расположения триады печени. При этом вокруг триады печени концетрируются лимфоидные клетки различной
интенсивности. Иногда в различных участках дольки печени встречаются небольшие очаги кровоизлияния, нарушающие структуру печеночных пластинок. Следовательно гидропическая дистрофия отражает нарушение водно-электролитного и белкового обмена, приводящие к изменению коллоидно-осмотического давления в гепатоцитах, то есть определяется токсическая дистрофия печени в результате
аллергической реакции на хроническую интоксикацию организма.У
контрольной группы животных почки состоят из коркового и мозгового вещества. Структурно-функциональной единицей почки является нефрон, где различают почечное тельце, проксимальный отдел,
тонкую часть (петля) и дистальный отдел. Почечное тельце образова-
но сосудистыми клубочками, покрытого капсулой, образованной
двумя лепестками.
У животных опытной группы встречаются почечные тельца с запустевшими кровеносными капиллярами. Когда почечное тельце
имеет небольшие размеры, имеющиеся клеточные элементы располагаются плотно и среди них не определяются форменные элементы
крови.
Вполне вероятно, что это один из элементов гломерулонефрита,
связанный с инфекцией бактериальной. И в мозговом веществе, в
просветах канальцев почек встречаются участки со слущенными эпителиальными клетками в просвете канальцев. Определяются изменения и в системе кровоснабжения почки, особенно характерным является венозная гиперемия по ходу почечных канальцев, а иногда и небольшие очаги кровоизлияния среди нефронов, и скопления лимфоидных клеток. Вполне вероятно, что все гистологические изменения
почек являются результатом антигенной стимуляции иммунного
комплекса, отражающего реакцию гиперчувствительности немедленного типа, что характерно для гломерулонефрита.
Наши исследования показывают, что псороптозные клещи, паразитируя в области наружнего и внутреннего уха кроликов оказывают
патологическое воздействие не только в местах локализации, но и вызывают патогистологические изменения в печени и почках.
УДК 636.2.082.2
ВЛИЯНИЕ ПОЛИМОРФИЗМА ГЕНОВ МОЛОЧНЫХ
БЕЛКОВ НА МОЛОЧНУЮ ПРОДУКТИВНОСТЬ КОРОВ
ЧЕРНО-ПЕСТРОЙ И БЕСТУЖЕВСКОЙ ПОРОД
Ю.А.Ракина, Ф.Р. Валитов, И.Ю.Долматова
ФГБОУ ВПО Башкирский государственный аграрныйуниверситет,
г.Уфа
Молочная продуктивность относится к сложным количественным
признакам, которые контролируются большим количеством генетических локусов. К таким локусам относятся гены белков молока, в
том числе сывороточные белки – бета-лактоглобулин и альфалактоальбумин, вторую группу составляют гены гормонов [1].
Локус LGB в основном влияет на состав и молочные качества
молока, так аллель А ассоциирован с выходом параметров молочной
продуктивности, а аллель В с высоким процентом жира в молоке
[3,4]. Локус ALA связан с обильномолочностью. Вариант А ассоциируется с большим выходом молока, а вариант В – с более высоким
содержанием белка и жира в молоке [2].
В связи с этим целью наших исследований явилось изучение полиморфизма генов бета-лактоглобулина и альфа-лактоальбумина коров черно-пестрой и бестужевской породы и его влияние на некоторые показатели молочной продуктивности.
Объектом исследования послужили коровы черно-пестрой породы ООО АП им. Калинина Стерлитамакского района (n=112), а также
бестужевской породы (n=50) ООО племзавод «Чишма» Дюртюлинского района республики Башкортостан. Из крови ДНК выделяли
стандартным фенол-хлороформным методом.
Методами полимеразной цепной реакции и анализа полиморфизма длин рестрикционных фрагментов ДНК исследованы гены LGB и
ALA. Для амплификации фрагментов генов использовали соответствующие праймеры:
LGB 1 : 5' – TGT GCTGG ACACCGACTACAAAAAG- 3'
LGB 2 : 5' – GCT CCCGGTATATGACCACCCTCT – 3'
ALA 1 : AAG AGT TGG ATG GAA TCA CC
ALA 2 : TTC AAA TTG CTG GCA TCA AGC
Полученные амплификаты гена LGB расщепляли эндонуклеазой
HaeIII, гена ALA - Mha. Электрофоретический анализ фрагментов
проводили в 7% ПААГе с добавлением бромистого этидия. Для анализа распределения рестрикционных фрагментов ДНК использовали
гельдокументирующую систему Gel Doc XR и программное обеспечение Image Lab версия 2.0. «DNA-Analysis». В качестве маркера молекулярных масс использовали маркер pUC/MspI.
У исследованных животных в локусе бета-лактоглобулина и альфа-лактоальбумина выявлено 3 варианта генотипа - АА, АВ и ВВ, которые имели разную частоту встречаемости (таблица 1).
Таблица 1 Частоты встречаемости аллелей и генотипов генов
бета-лактоглобулина и альфа-лактоальбумина у коров черно-пестрой
и бестужевской пород
Генотип
ч-п/бест.п
LGB
Частота генотипов, %
АА
АВ
ВВ
0,28/0,06
0,36/0,49
0,36/0,45
Частота аллелей
А
В
0,46/0,31
0,54/0,69
ALA
0,21/0,54
0,60/0,38
0,19/0,08
0,51/0,73
0,49/0,27
Частота встречаемости гомозиготного генотипа АА гена беталактоглобулина коров черно-пестрой породы на 0,08% меньше частоты генотипов АВ и ВВ, следовательно частота аллеля В имеет
наибольший показатель 0,54. У бестужевской породы частота аллеля
0,69.
По гену альфа-лактоальбумина частота генотипов АВ (0,60) у
коров черно-пестрой породы значительно превышает частоту гомозиготных генотипов, но частоты аллелей примерно равны и составляют
0,51 и 0,49 соответственно. У коров бестужевской породы частота
гомозиготного генотипа АА более чем в 2 раза выше по сравнению с
черно-пестрой и составляет 0,54%. Соответственно, частота аллеля
ALAА также высока (0,73).
Молочная продуктивность коров черно-пестрой и бестужевской
пород с разными генотипами по генам ALA и LGB представлены в
таблице 2.
Таблица 2 Молочная продуктивность коров черно-пестрой
и бестужевской пород с разными генотипами по генам LGB и ALA
Порода
Чернопестрая/
Бестужевская
Генотип
по гену
n
LGBАА
31/3
LGBАВ
40/24
LGBВВ
40/22
ALAАА
23/26
ALAАВ
68/18
ALAВВ
21/4
удой, кг
4407,8+121,7/
3412,0+253,9
4752,2+86,0/
3430,6+99,1
4570,6+110,3/
3300,5+92,2
4436,0+113,8/
3410,5+94,9
4580,0+83,6/
3242,8+97,6
4991,0+140,8**/
3469,3+153,6
Продуктивность
жир, %
молочный жир, кг
3,44+0,09/
150,96+5,04/
3,78+0,02
128,93+10,09
3,43+0,06/
163,08+4,47/
3,77+0,01
129,89+3,81
3,51+0,11/
159,10+5,07/
3,79+0,01
124,32+3,51
3,40+0,10/
149,81+4,45/
3,77+0,01
128,54+3,58
3,54+0,07*/
161,35+3,97/
3,81+0,02
122,51+3,87
3,33+0,08/
166,49+6,66/
3,78+0,01
131,97+5,64
Примечание - * р<0,05, **р<0,01, ***р<0,001
Анализ данных таблицы показал, что коровы как черно-пестрой,
так и бестужевской пород по гену LGB не имеют достоверных различий по продуктивности между сравниваемыми генотипами (p>0,05).
По черно-пестрой и бестужевской породам наибольший удой получен от коров с генотипом LGBAB – 4752,2 кг и 3430,6 кг соответ-
ственно, наименьший по черно-пестрой породе - с генотипом LGBAA
(4407,8 кг), по бестужевской – с генотипом LGBBB (3300,5 кг).
Наибольшей жирномолочностью по обоим породам отличались коровы с генотипом LGBBB – 3,51% и 3,79% соответственно. Молочный
жир является комплексным показателем и поэтому зависит как от
удоя, так и от массовой доли жира в молоке.
Черно-пестрые коровы по удою с генотипом ВВ по гену ALA,
достоверно превосходили коров с генотипом ALAАA на 555 кг
(p<0,01). Наибольшей жирномолочностью отличались животные с
генотипом ALAАВ – 3,54%, наименьшей с генотипом ALAВВ – 3,33%
(p>0,05). По бестужевской породе преимущество по удою имели также животные с генотипом ВВ – 3469,3 кг, и превосходили генотип
АВ на 226,5 кг (p>0,05). По массовой доле жира коровы с генотипом
ALAВВ превышали коров с генотипом ALAАА на 0,04% (p>0,05).
Таким образом в результате проведенного анализа прослеживается тенденция, что наличие аллеля В в локусе LGB более благоприятно для высоких удоев. По локусу ALA тенденцией к большим надоям
обладают гетерозиготные животные. На содержание жира в молоке
также благоприятно влияет наличие аллеля В в локусе LGB и гомозигот по ALA.
Литература
1. Хабибрахманова, Я. А. Полиморфизм генов молочных белков и
гормонов крупного рогатого скота: Автореф. дис.канд. биол.наук
[Текст]: п. Лесные Поляны Моск. обл. 2009. -20 с.
2. Bleck T.G.,Bermel R.D. (2005). Correlation of the alphalactalbumin polymorphism to milk production and milk of Holsteins. J.
Dairy Sci. 76: 2292-2298.
3. Patel K. R., Chauhan J.B., Krishna M.S., Soni K.J. (2007). Allelic
frequency of cappa-casein and beta-lactoglobulin in Indian crossbred dairy
bulls. Turk. G. Anim Sci. 31: 399-402.
4. Strzalkowska N, Krzyzeewski J, Zwierzchowski L (2002). Effect of
cappa-casein and beta-lactoglobulin polymorphism cows age, stage of lactation and somatic cell count on daily milk yield and comprosition in
Polish Black and white cattle. Anim Sci Pap Rep. 20: 21-35.
УДК 636.2 (450.57)
ПРОДУКТИВНОЕ ДОЛГОЛЕТИЕ КОРОВ ГОЛШТИНСКОЙ
ПОРОДЫ В УСЛОВИЯХ ГУСП СОВХОЗ «АЛЕКСЕЕВКИЙ»
Г.Р. Рахимкулова, Р.М.Мударисов
ФГБОУ ВПО Башкирский государственный агарный унивреситет,
г.Уфа
Продолжительность использования высокопродуктивных коров
во многом определяет эффективность молочного скотоводства и, в
конечном счете, результативность совершенствования пород и стад
[1,3]. Длительное использование молочного скота позволяет: уменьшить затраты в расчете на корову; увеличить средний удой стада за
счет эксплуатации более продуктивных полновозрастных коров; повысить реализацию племенных животных; проводить выбраковку
низкопродуктивных животных.
Преждевременная выбраковка коров из стада снижает надежность оценки животных по продуктивным и племенным качествам,
так как от них остается мало потомков. Коровы-долгожительницы,
как правило, отличаются крепкой конституцией, устойчивостью к заболеваниям, хорошими воспроизводительными качествами и развитым выменем [2]. Голштинская порода высоко ценится как самая
обильномолочная, наиболее экономичная и технологичная в условиях
промышленной технологии производства молока. Достаточно высокий темп роста численности голштинского скота, его продуктивности
во многих развитых странах подтверждает это. Продолжительность
жизни коров обусловлена рядом генотипических и экологических
факторов без оценки влияния, которых невозможна эффективная селекция по данному признаку. Поэтому в задачи наших исследований
входило изучение зависимости продуктивного долголетия коров
голштинской породы с учетом их линейной принадлежности [2,4,5,].
Исследования проводили на молочно-племенном заводе ГУСП
совхоза «Алексеевкий» Уфимского района Республики Башкортостан
на коровах чистопородной голштинской породы пяти различных генеалогических линий таких как: Рефлекшн Соверинг 198998 (29%),
Вис Айдиал 0933122 (24%), Инка Суприм Рефлекшн 121004 (19%),
Силинг Трайджун Рокит 0252803 (16%), Осборндэйл Айвенго
1189870 (12%), которые содержались в одинаковых условиях кормления и содержания в соответствии с принятой в хозяйстве технологией (таблица 1).
Таблица 1 Продолжительность продуктивного долголетия коров
различных линий
Линия
Рефлекшн Соверинг
198998
Вис Айдиал 0933122
Инка Суприм Рефлекшн 121004
Силинг Трайджун
Рокит 0252803
Осборндэйл Айвенго
1189870
ПроНадой, кг*
должительМДЖ,
за лак- пожизность
%
тацию ненный
жизни,
дни
Продолжительность лактации,
дни
Продуктивное
долголетие, дни
359
1232
2005
9208
23182
3,91
354
1178
2041
8529
21911
3,82
353
1169
2172
8961
22810
3,85
356
1323
2185
9215
23027
3,90
353
1119
2154
8397
21945
3,79
*перевод на базисную жирность
Материалом для изучения послужили документы первичного зоотехнического и бухгалтерского учета по стаду коров голштинской
породы в ГУСП совхоз «Алексеевский». Как видно из таблицы,
наибольшей продолжительностью лактации отличались коровы линии Рефлекшн Соверинг 198998 и Силинг Трайджун Рокит 0252803
превосходившие животных других генеалогических групп.
Наивысшей продолжительностью продуктивного долголетия отличались коровы принадлежащие к линии Силинг Трайджун Рокит
0252803 – 1323 дня, которые превосходят коров других генеалогических групп на 91-204 дней; наименьшая продолжительность лактационного периода выявлена у коров линии Осборндэйл Айвенго
1189870 – 1119 дней, что меньше представителей других линий на 50204 дней.
Наибольшая продолжительность жизни у коров линии Силинг
Трайджун Рокит 0252803 – 2185 дня, а наименьшая – линии Рефлекшн Соверинг 198998 – 2005 дней, тогда как, надой за лактацию и
пожизненный надой коров линии Рефлекшн Соверинг 198998,
наибольший – 9215 и 23027 кг соответственно. Наименьшая молочная
продуктивность – у коров линии Осборндэйл Айвенго 1189870 (8397
и 21945 кг).
Таким образом, полученные данные свидетельствует о влиянии
линейной принадлежности коров на их продуктивное долголетие.
Литература:
1. Зеленков, П. И. Скотоводство [Текст]: учебник / П. И. Зеленков, А. И. Бараников, А.П.Зеленков – Изд. 2-е–Ростов. н/Д:Феникс,
2006.–571 с.
2. Карамаев, С.В. Бестужевская порода скота и методы ее совершенствования [Текст]: монография / С.В. Карамаев – Самара, 2002.378 с.
3. Костомахин, Н.М. Скотоводство [Текст]: учебник для вузов /
Н.М. Костомахин – СПб.: Изд. Лань 2009. – 431 с.
4. Красота, В.Ф. Разведение сельскохозяйственных животных
[Текст]: учебник / В.Ф . Красота, Т.Г. Джапаридзе, Н.М. Костомахин
– М.: КолосС, 2006. – 424 с.
5. Родионов, Г. В. Скотоводство [Текст]: учебник/ Г. В. Родионов,
Ю.С. Изилов, С.Н. Харитонов, Л.П. Табакова. – М.: КолосС , 2007. –
405 с.
УДК 636 .082.21
ВОСПРОИЗВОДИТЕЛЬНАЯ ФУНКЦИЯ КРУПНОГО
РОГАТОГО СКОТА ЧЁРНО-ПЁСТРОЙ ГОЛШТИНСКОЙ
ПОРОДЫ ООО ПХ «АРТЕМИДА»
Ю.И.Самойлов, С.М.Лукманов
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Очень важным моментом для правильной организации воспроизводства стада является экономически оправданная продолжительность межотельного цикла коров — периода времени от одного
отела до другого. Желательная продолжительность межотельного
цикла — 365—395 дней. Она зависит от продолжительности стельности коровы и сервис-периода, с одной стороны, и продолжительности
лактации и сухостойного периода — с другой.
Стельность — промежуток времени от плодотворного осеменения коровы до ее отела. Если учесть, что продолжительность стельности величина довольно постоянная и составляет в среднем 280—
285 дней, то большее влияние на межотельный цикл оказывает сервис-период — отрезок времени от отела коровы до ее плодотворного
осеменения. На продолжительность сервис-периода значительное
влияние оказывает выбор оптимального срока для осеменения коров
после отела. При установлении сроков осеменения коров после отела
учитывают состояние упитанности животных, уровень их продуктивности, а также конкретные условия хозяйства (кормление, содержание, направление скотоводства, сезон и др.)
Высокий уровень воспроизводства достигается за счет первого
отела в более раннем возрасте (23—24 мес.), более коротких интервалов между отелами и большего числа стельных животных. Однако
животных нельзя перекармливать; в противном случае они становятся слишком упитанными, что отрицательно сказывается на воспроизводстве и состоянии их здоровья.
Физиологически обосновано, что оплодотворение коров происходит только после окончания инволюции матки, поэтому осеменение необходимо осуществлять именно в это время. Установлено,
что инволюция матки после нормально прошедшего отела при правильном кормлении и содержании у большинства коров заканчивается в течение 30—50 сут, а вследствие неблагополучных отелов, родильного пареза, а также неполноценного кормления и нарушения
режима содержания (отсутствие прогулок, круглогодовое содержание
в стойлах, нарушение зоогигиенических требований и т. п.) — задерживается.
Полноценное кормление коров до и после отела имеет решающее
значение для своевременного их осеменения после отела. Так, наличие резервных запасов в организме коровы при отеле имеет большое
влияние на возможные осложнения во время и сразу после отела, молочную продуктивность и воспроизводительные качества животного
в течение предстоящей лактации. При недостаточном уровне кормления и из-за отсутствия достаточных резервов организма в ранний период лактации (отрицательный энергетический баланс) у животных
учащаются случаи возникновения некоторых метаболических заболеваний (кетоз, смещенный обомасум и т. п.), задерживается возобновление полового цикла после отела. При высоком уровне кормления
коров до отела значительно снижается кратность осеменения на одну
оплодотворенную корову. От уровня кормления зависит оплодотворяемость коров.
При высоком уровне кормления процент коров, пришедших в
охоту в течение 60 дней после отела, был выше в 2,65 раза по сравнению с группой животных, которых содержали при низком уровне
кормления.
У ожиревших животных встречается больше осложнений при
отеле; снижается количество потребленного сухого вещества кормов,
что, в свою очередь, ведет к возникновению определенных метаболических заболеваний (синдром жирной коровы, кетоз и т. п.),
снижению молочной продуктивности, нарушению полового цикла.
Исследования, проведенные учеными Международного института по исследованию и развитию молочного животноводства имени
Бабкока (США), показали, что фертильность (оплодотворяемость)
коровы зависит от баланса энергии в организме животног. Так, от
отела до 50-го дня лактации отмечается отрицательный энергетический баланс, то есть количество требуемой энергии не восполняется
за счет энергии, полученной с кормами. И только к 100—105-му дню
лактации устанавливается балансовое равновесие требуемой и полученной энергии. После 105-го дня устанавливается положительный
баланс энергии. Аналогичная ситуация характерна и для фертильносги коровы, то есть до 50-го дня лактации возможность ее оплодотворения составляет BOSS %, тогда как к 70—80-му дню эффективность оплодотворения достигает 60—65 %.
Таким образом, оптимальным и экономически оправданным сроком осеменения молочных коров после отела считают период между
50—90-м днем после отела. Срок оплодотворения зависит от состояния упитанности животного, его здоровья и уровня продуктивности.
В развитых западных странах (Великобритания, Франция и др.) средняя по стране продолжительность сервис-периода превышает 100
дней. Таким образом, чтобы межотельный период не превышал 365—
395 дней, продолжительность сервис-периода должна составлять
110—115 дней, не более.
Анализ воспроизводительной функции коров чёрно-пёстрой
голштинской породы ООО ПХ «Артемида» показал, что в хозяйстве
еще не мало проблем по вопросам воспроизводства стада. Высокий
уровень продуктивности коров в стаде требует и высокой уровень
культуры животноводства, но не всегда реалии жизни отвечают потребностям действительности.
Нами был проанализирован весь маточный состав стада коров за
последние 4 года в динамике и в разрезе лактаций по продолжительности стельности у коров с возрастом, сервис-периода и межотельного периода, уровню приплода на 100 коров и нетелей, наличию абортов, выкидышей и мёртворождённости. Анализ воспроизводительной
функции коров чёрно-пёстрой голштинской породы ООО ПХ «Артемида»представлен в таблице 1.
Таблица 1 Воспроизводительные качества коров
чёрно-пёстрой голштинской породы ООО ПХ «Артемида»
Количество
Показатель
Нетели
Пераотёлки
Коровы
Коровы
В среднем
Количест
во,
гол
Возраст,
отёлов
462
320
204
115
1101
1
2
3
-
мёртворожденных
55
10
11
5
80
Продолжительность, дней
абортов
стельности
сервиспериода
4
2
1
7
278,76
279,51
278,95
275,03
278,06
196,5
186,28
183,08
188,62
Анализ состояния воспроизводства стада показал, что уровень
мёртворожденности у нетелей был настолько высок и составил 11,905%.
Каждый 12 – ый телёнок рождался мёртвым из-за несвоевременного
родовспоможения. Уроки первого отёла изменили тактику и отношение ветслужбы и не могли не сказаться на результаты воспроизводства. В последующем отёлы проходили все легче и легче и у полновозрастных коров она бала сведена до минимума и составила 1,08 %
от отелившихся 115 коров.
Для племенных стад как ООО ПХ «Артемида», уровень продуктивности у которых приближается к 8000 рубежу проблема воспроизводства очень актуальна, удой за 2011 год в среднем по стаду чёрнопёстрой голштинской породы составил 7438 – 4,20 – 3,10.
Анализ воспроизводства даёт возможность выявить причины,
скрытые в технике разведения и позволяет в дальнейшем вести селекцию крупного рогатого скота чёрно-пёстрой голштинской породы
ООО ПХ «Артемида» по продолжительности стельности, что окажет
влияние и на крупноплодность новорождённых телят, что само сабой
повлечёт к легкости отёлов и позволит подбирать быков – производителей по массе их приплода, то есть вести селекцию на более высоком уровне.
Литература:
1. Гордон, А. Контроль воспроизводства сельскохозяйственных
животных. [Текст] /А.Гордон. М.: Агропромиздат, 1988. – 415 с.
2. Костомахин, Н.М. Воспроизводство стада и выращивание ремонтного молодняка в скотоводстве. [Текст] / Н.М.Костомахин. –
М.:»Колос», 2009. -109 с.
УДК 638.12
УЛУЧШЕНИЕ ХОЗЯЙСВЕННО-ПОЛЕЗНЫХ ПРИЗНАКОВ
МЕДОНОСНЫХ ПЧЕЛ
А.А. Саттарова, Д.В. Шелехов, Е.А.Смольникова
ФГБОУ ВПО Башкирский государственный агарный университет,
г.Уфа
Одним из основных путей сохранения и воспроизводство породы
медоносных пчел является улучшение хозяйственно полезных признаков пчелиных семей на основе обеспечения полноценными кормами с учетом потребности организма пчел и периода сезона [4,5].
Однако в пчеловодстве, кормовой базой которого является нектар и
пыльца, собираемый пчелами с определенной территории радиусом
до 3 км, где растительность по видовому составу может в корне отличаться от прилежащих территорий, нормализовать питание пчел
сложно. В связи с этим обогащение гомогенатом того уровня питания, которое существует в Республике Башкортостан является актуальным. Следует отметить, что в активный период пчеловодного сезона на пасеках уничтожают трутневый расплод с целью снижения
заклещенности пчел, который целесообразно использовать в качестве
дополнительной белковой подкормки.
Цель исследований – научное обоснование влияния гомогената
трутневого расплода (далее ГТР) в сравнительном плане с пыльцевой
обножкой (далее ПО) на хозяйственно полезные признаки пчелиных
семей. Для достижения указанной цели были поставлены следующие
задачи: определить качественные показатели рабочих пчел; выявить
влияние на экстерьерные признаки и биохимические показатели тела
пчел; изучить влияние отбора трутневого расплода на развитие пчелиных семей; выявить влияние на хозяйственно полезные признаки
пчелиных семей: развитие, продуктивность, результаты зимовки;
определить экономическую эффективность применения при производстве продукции пчеловодства.
Работу выполняли в условиях учебной пасеки кафедры биологии,
пчеловодства и охотоведения, лабораториях ФГБОУ ВПО Башкирский ГАУ. Объектом исследований были пчелы башкирской породы.
Пчелиные семьи содержали в 12-рамочных ульях в равных условиях
содержания, кормления и медосбора. Оценку хозяйственно полезных
признаков пчелиных семей проводили согласно методике проведения
научно-исследовательских работ в пчеловодстве [3]. Для проведения
исследований, используя принцип подбора семей пар-аналогов, формировали четыре группы семей по 5 в каждой. Все пчелиные семьи
подопытных групп получали 50 % сахарный сироп, контрольная –
чистый, 1, 2, 3 опытные группы – дополнительно ГТР, ПО, ГТР+ПО,
соответственно. Подкормку проводили с интервалом в 1 день, по
0,5 л на пчелиную семью в течение 12 дней, вечером в соты.
Результатами исследований установлено, что использование ПО
и ГТР (лучший результат), при подкормках в весенний период, способствовало увеличению массы суточных личинок на 3,3–5,5 %
(P≤0,001), массы суточных рабочих пчел на 3,4–4,5 % (P≤0,05), что
связано с их сложным химическим составом и оптимальным воздействием на физиологические процессы в организме пчел.
Применение подкормок с ПО оказало наименьшее, а ГТР
наибольшее влияние по сравнению с контролем на увеличение следующих экстерьерных признаков рабочих пчел – площади: крыла на
3,0–3,8 % (P≤0,01), 3-го стернита на 4,2–6,6 % (P≤0,01).
Результаты анализов показали, что к началу зимовки белковые
подкормки способствовали большему накоплению в теле пчел сухих
веществ – на 1,3–3,2 % (P≤0,01), азота – на 0,13–0,17 % (P≤0,01), что,
по литературным данным [5], является одним из основных факторов
повышения зимостойкости пчелиных семей.
К концу зимовки также установлено положительное влияние
подкормок на биохимические показатели тела пчел, что характеризуется повышенным содержанием сухого вещества на 0,1–0,8 %, азота –
на 0,01 %, углеводов на 0,07 %. Наилучшие результаты получены при
подкормке ГТР.
На основании результатов опыта выявлено, что в условиях Республики Башкортостан в весенний период получение от семей до 1,3
кг ГТР не снижало биологический потенциал пчелиных семей, а
наоборот, стимулировало их рост и развитие, что отразилось в повышении способности по выращиванию печатного (пчелиного) расплода на 8–13 % (P≤0,05).
После отбора трутневого расплода проведено биохимическое исследование его состава в 10-суточной стадии развития. Результатами
анализов выявлено, что в трутневом расплоде соотношение влаги и
сухого вещества 69,9 и 30,1 %, рH–7,7, азота–14,3 %, фосфора–
1,25 %, калия–1,86 %, кальция–0,29 %, натрия–0,24 %, что в основном
соответствует литературным данным [3].
Результатами исследований установлено, что добавление в сахарный сироп ГТР 10-процентной концентрации показало наилучший
эффект, его использование способствовало увеличению количества
выращенного пчелиного расплода семьями за 3 последовательных
учета (36 дней) в весенний период на 22,3–25,8 % (P≤0,05), в осенний
период на 8,9–12,2 %.
Результаты зимовки пчелиных семей во многом зависят от числа
выращенных пчел в конце лета и общей силы семьи [5]. Исследования показали, что пчелиные семьи опытных групп, получавших белковые подкормки в осенний период, перезимовали несколько лучше,
чем семьи контрольной группы. Наилучшие показатели имели пчелиные семьи, которые получали подкормку ГТР. Они израсходовали за
зиму корма меньше на 3,1–10,3 % (Р≤0,001), превосходили контрольную группу по силе на 8,2–25,0 %, имели лучшее состояние гнезда
(опоношенность была меньше) на 0–33,4 %, меньше количество погибших пчел (подмора) на 4,3–30,0 % (Р≤0,01) и непереваренных
остатков в заднем отделе кишечника на 11,1 % (Р≤0,01). Аналогичные
показатели у группы, получавшей подкормку ПО были выше по
сравнению с контролем на 6,1 % (Р≤0,01), 16,6 %, 33,4 %, 20,0 %,
9,8 % (Р≤0,001), соответственно. Таким образом, установлено, что
применение ПО и ГТР в период осеннего наращивания способствовало улучшению результатов зимовки.
Одним из важнейших хозяйственно полезных признаков пчелиных семей является их продуктивность, и, на данный показатель существенное влияние оказывает лётная активность пчел [5]. Результатами исследований установлено, что ГТР 10-процентной концентрации при подкормках весной показал наилучшие результаты, его использование способствовало увеличению силы семей, следовательно,
лётной активности пчел в период поддерживающего медосбора на
2,6–18,9 % (P≤0,05), в период главного медосбора на 25,0–27,0 %
(P≤0,05).
Результатами исследований установлено, что белковая подкормка
ГТР показала наилучший эффект, её использование способствовало
повышению медопродуктивности пчелиных семей на 17,8–18,8 %
(P≤0,01), воскопродуктивности на 16,6–24,2 %.
Экономическую эффективность результатов опытов определяли
по количеству полученного товарного меда и воска, неплодных маток
и пакетов пчел. При расчете данного показателя использовали планово-учетные цены, принятые в ГУ БНИЦ по пчеловодству и апитерапии в Республике Башкортостан. Данные по выходу всей продукции
показали (в расчете на одну пчелиную семью), что наилучшие показатели по сравнению с контролем получены при подкормках ГТР.
Расчеты показали, что наибольшие затраты приходятся на подкормку
пчелиных семей ПО, а наименьшие – на подкормку чистым сахарным
сиропом. Данный показатель при подкормке ГТР – средний, однако
за счет более высокой продуктивности семей отмечено больше прибыли по сравнению с контролем на 1 912 руб. Применение ПО и ГТР
(лучший результат) способствовало увеличению уровня рентабельности по сравнению с контролем на 11,0 и 18,7 %, соответственно.
Таким образом, в целях улучшения хозяйственно полезных признаков пчелиных семей в период весеннего и осеннего наращивания рекомендуется подкармливать семьи сахарным сиропом с добавлением ГТР
10-процентной концентрации в течение 12 дней с интервалом через день.
Литература:
1. Билаш, Г.Д. Селекция пчел. [Текст] : учеб. пособие /
Г.Д. Билаш, Н.И. Кривцов. – М.: Агропромиздат, 1991. – 304 с.
2. Бородачев, А.В.
Методы
проведения
научно–
исследовательских работ в пчеловодстве [Текст]: учеб. пособие
/А.В. Бородачев, А.Н. Бурмистров, А.И. Касьянов [и др.] – Рыбное:
НИИП, 2006. – 154 с.
3. Бурмистрова, Л.А. Физико–химический анализ и биохимическая оценка биологически активного трутневого расплода [Текст]: автореф. дис. …канд. биол. наук. – Рязань, 1999. – 24 с.
4. Еськов, Е.К. Экология медоносной пчелы [Текст]: учеб. пособие /Е.К. Еськов. – Рязань: Русское слово, 1995. – 392 с.
5. Кривцов, Н.И. Пчеловодство [Текст]: учебник / Н.И. Кривцов,
В.И. Лебедев, Г.М. Туников. – М.: Колос, 2007. – С. 180–193.
УДК 619:618.19-002:636.92
НОВЫЕ ПОДХОДЫ К ЛЕЧЕНИЮ МАСТИТА
У КРОЛЬЧИХ ПОРОДЫ БЕЛЫЙ ВЕЛИКАН
Р.Н. Сачук
Львовский национальный университет ветеринарной медицины
и биотехнологий им. С.З. Ґжицкого, г.Львов, Украина
Проведенный нами анализ ветеринарной отчетности и многочисленных научных публикаций свидетельствует, что кролиководство в
Украине приходит в упадок в связи с отсутствием современных научных разработок по вопросам полноценного кормления, технологии
содержания кроликов, недостаточного уровня ведения племенной работы и ветеринарного обеспечения [1].
В связи с этим важное значение приобретают меры, направленные на организацию воспроизводства поголовья, благополучного выращивания молодняка кроликов, искусственного осеменения крольчих в оптимальном возрасте с соответствующей живой массой, соблюдение научно обоснованных норм кормления и содержания самок
в период сукрольности, лактации, обеспечение своевременного и квалифицированного ветеринарного обслуживания животных с использованием инновационных достижений науки и передового опыта.
Доказано, что эффективное лечение животных с любым заболеванием обеспечивается при комплексном его проведении. Составля-
ющие комплексного лечения подбираются по принципу синергизма,
когда каждый из применяемых средств (методов) усиливает действие
других. Одновременно, его нельзя обременять второстепенными составляющими, которые существенно не влияют на общий результат
[2].
В последние годы все чаще наблюдается тенденция к созданию и
использованию препаратов, изготовленных из природного сырья. При
этом большинство из них имеют различную биологическую активность и в то же время вредны для организма.
Препараты природного происхождения имеют специфическое и
общее неспецифическое положительное воздействие на организм животного.
Таким образом, предотвращение акушерско-гинекологических
болезней и своевременного эффективного их лечения, в частности
мастита, необходимо рассматривать как важное звено в системе мер
по ликвидации заболеваний у крольчих. Поэтому разработка совершенных методов ранней диагностики, общей и специфической профилактики, а также средств терапии высокопроизводительных крольчих с маститной патологией, с учетом экономической эффективности,
способствует интенсификации их сохранности, снижению себестоимости, увеличению производства продуктов кролиководства, улучшению их качества.
Целью работы было выяснить эффективность применения препарата “Анфлурон” в составе комплексного лечения крольчих с распространенным стафилококковым заболеванием молочной железы – маститом.
Опыты проводили в течение 2009-2012 годов на предприятии
“Екокрол” Волочиского района Хмельницкой области на кролематках
породы белый великан 2-летнего возраста, умеренной упитанности,
со средней массой тела 6,8 кг. Животных в группы подбирали по
принципу аналогов, учитывая их возраст, массу тела, условия содержания и кормления.
Для диагностирования болезней молочной железы у крольчих
провели акушерскую и гинекологическую диспансеризацию. По данным диспансеризации крольчих в хозяйстве, на основе клинических
признаков анатомо-топографического состояния их молочной железы, диагностировали мастит.
Для изучения эффективности методов комплексной терапии отобрали 9 крольчих, из которых сформировали три группы по три жи-
вотных - две исследовательские и одну контрольную. Лечение проводилось в первые два дня после выявления признаков заболевания животных.
В контрольной группе больных животных лечили общепринятым
методом: наружном применении противомикробного и противовоспалительного крема “Доктор” производства ООО фирма “Фирма
КАЙ” г. Харьков, Украина. Препарат применяли в течение 6 дней.
Крольчихам первой опытной группы, кроме выше указанного
средства, добавляли антибактериальный препарат “Тромексин” (производитель “Invesa”, Испания) 2 г / л воды в течение 4 дней.
Животным второй опытной группы вместо антибактериального
препарата “Тромексин” добавляли препарат “Анфлурон” (производитель “Укрзооветпромпостач”, Украина). Раствор вводили внутримышечно в области ягодичной группы мышц в дозе 0,5 мл на голову в
течение двух дней.
“Анфлурон” – стерильный изотонический водный раствор белков. Применяется для лечения животных и профилактики болезней
различной этиологии (инвазионная, инфекционная, онкологическая,
иммунодефицитная) как противовирусное средство в случаях острых,
хронических и персистирующих вирусных инфекций; как иммуномодулятор общего действия - при лечении многих патологий, где необходима действенная активация клеточного и гуморального иммунитета, в том числе иммунодефицитные и иммуносупрессивные состояния, вызванные инвазивным или инфекционным агентом, антибиотико- или химиотерапией.
Мониторинг болезней показал, что на заболеваемость кроликов
племенного репродуктора “Екокрол” с 01.03.2009 г. по 01.02.2012 г.
приходится 122 случая, в том числе вирусные – 20 (16,4%), паразитарные – 24 (19,7%) , кормовые травмы – 35 (28,7%), акушерские и
гинекологические заболевания – 16 (13,1%) и болезни органов дыхания – 27 (22,1%).
Акушерские и гинекологические заболевания характеризовались
проблемными родами – 7 случаев (8,8% от общего количества сукрольних самок) и маститами – 9 случаев (11,3% от общего количества лактирующих самок), обусловленные чрезмерным поеданием
гранулированного корма крольчихами, перед родами и после них, что
привело к нарушению обмена веществ и негативно повлияло на здоровье животных.
Как показывают результаты эксперимента, в контрольной группе
животных курс лечения мастита крольчих составил 6 дней, в первой
опытной группе он составлял 4 дня. Высший терапевтический эффект
получили в крольчих второй опытной группы, которым в составе
комплексной терапии внутримышечно вводили препарат “Анфлурон”
в дозе 0,5 мл на голову в течение двух дней.
В результате проведенного лечения у животных второй опытной
группы после трехдневного лечения не наблюдалось клинической
картины мастита. Основные клинико-физиологические показатели их
организма были в норме.
Так, регулярное проведение акушерской и гинекологической
диспансеризации в хозяйстве позволяет своевременно и полно выявить заболевание у крольчих.
Комплексная терапия крольчих с маститом была эффективной во
второй опытной группе, где в составе с другими препаратами применили “Анфлурон”.
Литература:
1. Демчук, М. В. Повышение качества продукции кролиководства
на отдельных технологических этапах [Текст] / М. В. Демчук, Р. М.
Сачук // Научный вестник ЛНУВМ и БТ им. С.З. Гжицкого. Том 12 №
3 (45) Часть 4. 2010. – С. 173-179.
2. Преображенский, О. Н. Патогенетическая терапия заболеваний
половых органов и молочной железы [Текст] / О. Н. Преображенский,
С. Н. Преображенский // Ветеринария сельскохозяйственных животных. 2007. – № 10. – С. 40-44.
УДК 636.2.082 (470.57)
ВОСПРОИЗВОДИТЕЛЬНЫЕ КАЧЕСТВА
ИМПОРТНЫХ КОРОВ В УСЛОВИЯХ ЗАУРАЛЬЯ
РЕСПУБЛИКИ БАШКОРТОСТАН
И.Р. Сахаутдинов, С.Г. Исламова, Л.М. Муратова
ФГБОУ ВПО Башкирский государственный аграрный университет, г.Уфа
При перемещении животных в новые климатические условия, в
первую очередь, эти последствия отражаются на продуктивности и
воспроизводительных функциях, поэтому изучение оценки продуктивности и воспроизводительных способностей животных является
одним из основных показателей приспособленности организма к новым условиям внешней среды [1, 2].
В связи с этим целью нашей работы явилось изучение воспроизводительных способностей коров симментальской породы разного
происхождения. Исследования проводили на животных симментальской породы на базе ПЗ ОПХ «Баймакское». Объектом исследований
послужило стадо коров местной и австрийской селекции. Снижение
воспроизводительной способности наблюдается и у не давно ввезенного скота из-за рубежа, в частности коров и симментальской породы
австрийской селекции (таблица 1).
Таблица 1 Воспроизводительная способность коров
симментальской породы разной селекции
Показатель
Возраст 1 отела, дн.
Продолжительность
сервис-периода, дн.
Продолжительность сухостойного периода, дн.
МОП, дн.
КВС
Живая масса приплода, кг
местной селекции
М±m
Cv, %
27,4±0,14 2
3,6
австрийской селекции
М±m
Cv, %
27,6±0,14
3,64
52,22+1,13
15,3
43+2,74
45,2
57,4+1,36
16,8
55,3+1,63
20,9
329,8+4,08*
1,08±0,0139
37,14±0,367***
8,75
8,85
6,98
343,88+2,78 5,89
1,09±0,01
6,71
31,2±0,48
10,89
Примечание : * - Р<0,05; ***-Р< 0,001.
Нами установлено, что у коров австрийской селекции возраст
первого отела был только на 0,2 месяца больше, чем у местных, т.е.
значения мало отличались друг от друга и разница была недостоверной.
Коэффициент воспроизводительной способности австрийских
коров составил 1,08 и он ниже, чем у местных животных на 0,01.
Живая масса телят при рождении важный селекционный признак.
Исследованиями установлено, что по данному показателю потомство
австрийских коров имело превосходство почти на 6 кг. Эта разница
была достоверной (Р< 0,001).
Следует отметить, что по исследуемым показателям обе группы
коров были однородны (Cv 3,6...10,89%).
Для определения воспроизводительной способности коров необходимо проанализировать дополнительно такие показатели как про-
должительность сервис- и сухостойного, а так же межотельного периодов.
Нами отмечена, в целом, оптимальная продолжительность сервис-периода и сухостойного периода у обеих групп животных, но,
тем не менее, коровы местной селекции превосходили своих австрийских аналогов по продолжительности сервис периода на 9 дней, а по
продолжительности сухостойного периода на 2 дня. Однако межотельный период у австрийских коров в среднем был на 14 дней короче,
чем у сверстниц (Р<0,05).
Между тем, если по продолжительности межотельного периода
животные в обеих группах, были однородны, то по продолжительности сухостойного и особенно сервис-периода, установлена высокая
изменчивость, о чем свидетельствует коэффициент вариабельности
признаков (Cv-15,3...45,2%).
Таким образом, коровы и местной и, особенно, австрийской селекции обладают высокой индивидуальной изменчивостью, что
необходимо учитывать при отборе коров в данном стаде.
В целом, исходя из анализа полученных результатов, можно сказать, что процесс адаптации австрийских симменталов в условиях Зауралья Республики Башкортостан проходит удовлетворительно.
Литература:
1. Косилов, В. Воспроизводительные качества маток мясных пород и их помесей [Текст] / В. Косилов // Молочное и мясное скотоводство. - 2008. - №8. - С. 11-12.
2. Митяшова, О. Воспроизводство в высокопродуктивных стадах
[Текст] / О. Митяшова, А. Оборин // Животноводство России. - 2008. № 9. - С. 45 - 46.
УДК 636.2.082 (470.57)
МОЛОЧНАЯ ПРОДУКТИВНОСТЬ КОРОВ ЗАРУБЕЖНОЙ
СЕЛЕКЦИИ В УСЛОВИЯХ ЗАУРАЛЬЯ БАШКИРИИ
И.Р. Сахаутдинов, С.Г. Исламова, Л.М. Муратова
ФГБОУ ВПО Башкирский государственный аграрный университет, г.Уфа
Важнейшими показателями успешной адаптации завезенного
скота из-за рубежа является их высокая продуктивность, осуществление нормальной воспроизводительной функции, приспособление к
интенсивной промышленной технологии, местным климатическим
условиям, эффективность использования кормов. Однако в новых
экологических и кормовых условиях живой организм либо вырождается, либо приспосабливается к непривычным условиям, при этом
претерпевая определенные изменения в экстерьере, интерьере и хозяйственно полезных признаках [1, 3, 4].
Поэтому изучение хозяйственных и биологических признаков, а
также адаптационных способностей импортного скота в настоящее
время очень актуально. Для обогащения генофонда отечественной
симментальской породы за последние 20 лет в Россию завезено свыше 2 тыс. симменталов из Австрии и Германии. Однако процесс
адаптации импортных животных в условиях Уральского региона протекает весьма сложно [2].
В связи с этим целью нашей работы было сравнительное изучение продуктивных особенностей животных симментальской породы
отечественной и зарубежной селекции.
Исследования проводились в условиях ПЗ ОПХ «Баймакское»
Баймакского района Республики Башкортостан. Материалом для исследований послужило стадо клинически здоровых чистопородных
коров симментальской породы, завезенных в 2003 году из Австрии и
местной популяции в возрасте третьего отела. Для проведения исследований было сформировано 2 группы коров по 50 голов в каждой по
методу пар-аналогов.
Опытные группы находились в одинаковых условиях кормления
и содержания животных, принятых на производстве в данном хозяйстве. Молочную продуктивность коров оценили по данным контрольных доек и сведений из племенных карточек Ф-2М0Л за первые
три лактации. Биометрическую обработку данных проводили на ПК с
использованием программ MS Excel и Statistica, достоверность показателей определяли по Стъюденту. Полученные результаты приведены в таблице 1.
Так австрийские коровы по I лактации превосходили местных
по продуктивности на 892,4 кг, по жирномолочности - на 0,11%, а
белковомолочности - на 0,18%, по II лактации разница составила
291,36 кг, 0,4%, и 0,12 % соответственно в пользу австрийских коров.
Однако, по III лактации их удой и содержание белка оказался ниже,
чем у местных коров на 836,68 кг и на 0,05%.
Установлена четкая взаимосвязь между молочной продуктивностью и живой массой коров. С увеличением живой массы у коров
местной селекции возрастали удои.
Таблица 1 Характеристика коров по молочной продуктивности
и живой массе
Показатель
I лактация
Мест- Австрийные
ские
II лактация
Местные
Удой, кг
M±m
3660,6±66 4553±200,4 3836,64±114
Cv, %
15,41
9,8
16,21
Жир, %
M±m
3,79±0,02 3,9±0,1
3,8±0,08
Cv, %
5,20
2,5
9,3
Белок, %
M±m
3,16±0,01 3,34±0,03
3,07±0,01
Cv, %
6,5
8,7
3,1
Живая
масса, кг
M±m
531±13,1 656±21,9
572±9,7
Cv, %
7,4
5,5
11,6
Австрийские
4128,96±229
15,2
III лактация
АвстрийМестные
ские
4445,94±292 3609,26±176
18,91
19,2
4,2±0,06*
8,7
3,89±0,15
11,3
4,03±0,07
5,1
3,19±0,02
5,3
3,01±0,01
1,6
2,96±0,04
5,1
653±5,4
7,5
589±9,1
12,5
651±6,8
6,9
Примечание: p<0,05.
Следует отметить, что по живой массе и содержанию жира в
молоке австрийские коровы независимо от возраста оказались более
однородными, нежели их сверстницы местной селекции. Вместе с
тем, для них характерна была большая изменчивость по содержанию
белка в молоке.
Таким образом, коровы симментальской породы австрийской
селекции способны адаптироваться к условиям Зауралья и при этом
иметь высокие показатели молочной продуктивности.
Литература:
1. Любимов, А.И. Молочная продуктивность коров разной поведенческой активности [Текст] / А.И. Любимов, С.Д. Батанов // Зоотехния. - 2002. - №8. - с. 21-23.
2. Стрекозов, Н. Молочное скотоводство России: настоящее и будущее [Текст] / Н. Стрекозов // Зоотехния. - 2008. - №1. – С. 18-21.
3. Шевхужев, А.Ф. Адаптационные способности коров ярославской породы на Северном Кавказе [Текст] / А.Ф. Шевхужев, В.М.
Иванов, С.О. Кантемиров // Зоотехния. - 2008. - № 8. - С. 23 - 25.
4. Якупов, И.М. Адаптивные свойства коров симментальской породы зарубежной селекции в условиях Башкирского Зауралья [Текст]
/ И.М. Якупов, Р.Х. Авзалов // Достижения науки и техники АПК. М:. 2007. - №12. - С. 49-50.
УДК 636.2.082
ПОТОМСТВО АВСТРИЙСКИХ СИММЕНТАЛОВ
В НОВЫХ ЭКОЛОГО-КЛИМАТИЧЕСКИХ
И ХОЗЯЙСТВЕННЫХ УСЛОВИЯХ
И.Р. Сахаутдинов, Л.М. Муратова, С.Г. Исламова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
В России интерес к симменталам возник достаточно давно, их
начали завозить из Швейцарии и Германии еще в XIX в. и продолжили в XX. Проведенные в то время исследования указывали на хорошие приспособительные и продуктивные качества представителей
этой породы. Симментальская порода крупного рогатого скота широко распространена во всем мире, ее разводят по всей территории
России. Животные этой породы превосходят другие породы по интенсивности роста, меньше расходуют кормов на единицу продукции.
Однако, процесс адаптации к новым условиям климата напрямую
влияет на рост и развитие животного. Управление процессом индивидуального развития животных имеет огромное значение для практики
зоотехнии [1,2,3].
Исследования были проведены в условиях ОПХ «Баймакское»
Баймакского района на фоне изучения адаптационных качеств австрийских симменталов по росту и развитию потомства.
Для исследования были сформированы 2 группы животных контрольная и опытная, в каждой по 40 голов, в том числе по 20 голов
бычков и телочек. В опытную группу вошло потомство австрийских
симменталов, а в контрольную - местных коров. Кормление подопытных животных было сбалансированное одинаковое и соответствовало нормам. Динамику живой массы определяли с рождения до
18 месячного возраста. По результатам взвешивания вычислили абсолютную и относительную скорости роста по общепринятой методике.
Биометрическую обработку данных проводили на ПК по программе
Excel. Для характеристики роста животного обычно используют его
живую массу (таблица 1). Учет живой массы необходим для нормированного кормления, контроля за выращиванием или ходом откорма
и для отбора наиболее развитых животных. Из таблицы 1 видно, что
бычки и телочки, телята австрийских коров превосходят по живой
массе своих сверстников как при рождении (Р<0,05), так и по всем
периодам роста (Р>0,05). Масса бычков опытной группы в 18 месяч-
ном больше на 10 кг, а телок на 15,9 кг, чем у аналогов контрольной
группы (Р>0,05).
Таблица 1 Динамика живой массы потомства коров разной селекции
Возраст
при рождении
1 мес.
3 мес.
6 мес.
9 мес.
12 мес.
18 мес.
Австрийская селекция
бычки
телки
39,5 ±1,3
32,7±0,7*
61,5±2,4
55±4,3
111,2±3,3
97,6±4,7
182,7±7,3
161,7±9,05
251,3±2,6
225,6±9,4
322,2±2,5
290,1±9,4
450,9±8,9
403,7±14,4
Местная селекция
бычки
телки
37,7±0,8
30,7±0,5
60,2±0,9
52,4±1,3
109,1±1,6
93,7±2,7
183,1±1,6
157,1±4,1
249,1±7,7
219,7±6,2
314±5,8
279,5±6,9
441,6±7,4
387,8±3,8
Примечание: * - Р<0,05.
Для суждения о росте и развитии молодняка рассчитали абсолютную и относительную скорости их роста. Максимальный абсолютный среднесуточный прирост приходился на 3 месяц роста у австрийских бычков (827 г.) у местных (823 г.) на 6 месяц, минимальный же был в 18 месяцев у австрийских телочек (631 г.) и (602 г.) у
местных. В разрезе пола у бычков опытной группы среднесуточный
прирост выше, чем у контрольной во все периоды кроме 1 и 6 месяца.
У опытных телочек превосходство над сверстницами наблюдалось во
все периоды. Сравнительный анализ внутри группы показал, что
бычки превосходили телок во все периоды роста за исключением 1
месяца, когда в опытной группе телочки давали среднесуточный прирост больше, чем их сверстники бычки на 8 г.
Максимальные относительные приросты были замечены в 3 месяца на уровне 56-57%, далее значения постепенно снижаются и доходят до 23,1%. По межгрупповым различиям наблюдается несущественное превосходство у потомства коров местной селекции. Внутри
одной репродукции преимущество в относительной скорости роста
было у телочек обеих групп за весь период кроме 3, 9, 12 месяца.
Мясную продуктивность изучали по результатам контрольных
убоев австрийских и местных бычков в 18-месячном возрасте (табл. 2).
Рассматривая таблицу 2, можно сказать, что бычки австрийской
селекции отличались лучшими убойными качествами (Р<0,05...0,001).
Австрийские бычки по массе туши превосходили сверстников на 9,9
кг, по убойной массе – на 13,5 кг (Р<0,05), по выходу туши - на 1,7%
(Р<0,05), по массе жира-сырца на 3,3 кг (Р<0,001) и по выходу жира сырца на 0,67%.
Таблица 2 Результаты убоя бычков разной селекции
в возрасте 18 месяце
Австрийская
М±m
Предубойная масса, кг
440±10,4
Масса туши, кг
229,4±4,9
Убойная масса, кг
249,3±5,2*
Выход туши, %
52,1±0,6*
Масса жира-сырца, кг
19,6±0,53***
Выход жира-сырца,%
4,45
Убойный выход, %
56,6±0,1***
Примечание: * - Р<0,05; *** - Р<0,001
Показатель
Местная
М±m
431±7,3
219,5±3,5
235,8±4,9
50,9±0,03
16,3±0,6
3,78
54,7±0,03
Таким образом, результаты наших исследований свидетельствуют, в целом, о правильном выращивании молодняка, способствующем получению достаточно высоких приростов молодняка. Однако,
следует отметить, что бычки и телки - потомство коров австрийской
селекции дают более высокие приросты в отличие от потомства
местных симменталов. Следовательно, можно констатировать, что
процесс адаптации импортного скота к условиям Зауралья республики идет удовлетворительно.
Литература:
1. Дедов, М.Д. Симментальский и сычевский скот [Текст] / М.Д.
Дедов. - М.: Колос, 1975. - 320 с.
2. Щеглов, И.П. Симментализированный скот Дальнего Востока
[Текст]: учебник / И.П. Щеглов. - Хабаровск, 1964. - 264 с.
3. Юмагузин, И.Ф. Настоящее и будущее симментальской породы
в РБ [Текст] / И.Ф. Юмагузин, Г.В. Наширбанова // Достижения
науки и техники АПК. ГНУ Баш. НИИСХ Россельхозакадемии. 2010. - С. 54-56.
УДК 636.1.034:636.1.082.13
ИССЛЕДОВАНИЕ ПАРАМЕТРОВ МОЛОЧНОГО ТИПА
ЛОШАДЕЙ БАШКИРСКОЙ ПОРОДЫ В УСЛОВИЯХ
КРУГЛОГОДОВОГО ТАБУННОГО СОДЕРЖАНИЯ
А.А. Слинкин, Э.Э. Юмагузина, Р.Ф. Уразбахтин
Башкирский НИИ сельского хозяйства Россельхозакадемии
Продуктивное коневодство в Республике Башкортостан является
одним из приоритетных направлений сельского хозяйства, что связано с возрастающим спросом на диетический лечебный напиток – кумыс [1,2].
В последние годы в связи с широким использованием в практике
разведения производителей казахской породы, структура и породный
состав башкирской лошади претерпели определенные изменения изза увеличения в популяции удельного веса разнокровных помесей.
Поэтому для сохранения и дальнейшего совершенствования генофонда башкирской породы лошадей необходимо дать характеристику
ее современного состояния и структуры племенной базы, усовершенствовать методы ее селекции.
Для характеристики современного состояния башкирской породы
лошадей молочного направления продуктивности, в зоне круглогодового табунного содержания проведена оценка экстерьерноконституциональных и продуктивных качеств маточного поголовья
лошадей башкирской породы в СПК «Ишкул», ООО «Казмаш», ООО
«Идель+» Абзелиловского района (таблица 1).
Таблица 1 Характеристика маточного поголовья башкирских лошадей
Бонитировочный
класс
Количество
гол
%
1
2
3
Стандарт породы
Элита
52
83,9
I
10
16,1
Элита
31
67,4
I
15
32,6
обхват
пясти
7
18
Молочная
продуктивность
(М±m), кг
8
1600
Живая
масса,
(М±m),
кг
9
18,4±
0,10
18,3±
0,20
2163,7±
22,58
1977,8±
61,17
408,9±
1,81
409,6±
9,93
18,6±
0,10
18,0±
0,30
2195,4±
30,73
2027,2±
33,06
429,0±
2,41
413,0±
2,74
Промер (М±m), см
высота в косая длина обхват
холке
туловища груди
4
5
6
138
143
167
ООО «Идель+»
142,7±
151,4±
171,5±
0,23
0,22
0,30
141,8±
150,2±
171,6±
0,93
1,06
1,65
ООО «Казмаш»
142,5±
151,4±
175,5±
0,32
0,47
0,61
140,3±
148,1±
171,8±
0,51
0,50
0,09
Продолжение таблицы 1
1
2
3
Элита
44
62,9
I
26
37,1
Среднее
188
100
4
5
6
СПК «Ишкул»
142,3±
150,3±
176,0±
2,61
3,39
6,62
142,4±
150,3±
176,1±
2,59
3,40
3,40
142,0±
149,3±
173,0±
0,20
0,34
0,36
7
8
9
18,5±
0,58
18,5±
0,62
18,5±
0,20
2305,7±
148,64
1994,1±
287,70
2039,0±
19,40
436,1±
39,70
436,4±
38,28
423,3±
1,61
Комплексная характеристика жеребцов-производителей племенного состава хозяйств по основным признакам приведена в таблице 2.
Таблица 2 Характеристика жеребцов-производителей башкирской породы
Промер, см
Год
Порода,
рождевысота косая длина обхват обхват
кровность
ния
в холке туловища груди пясти
1
2
3
4
5
6
7
8
Стандарт породы
141
146
170 19,0
ООО «Идель+»
1
Орлик
2004
баш., ч/п
146
154
183 21,0
2
Янтарь
2003
баш., ч/п
146
152
172 20,0
3
26-07
2007
баш., ч/п
145
153
180 20,0
ООО «Казмаш»
1
Кусим
1998
баш., ч/п
146
159
177 19,5
2
Куюн
2002
баш., ч/п
146
154
185 20,0
3
Лимон 240
2000
баш., ч/п
146
155
174 20,0
СПК «Ишкул»
1
Учалы
2000
баш., ч/п
143
153
172 19,0
2
Буян
2004
баш., ч/п
146
151
178 19,0
3
Калинин
2001
баш., ч/п
149
156
180 20,0
4
Идрис
1999
баш., ч/п
144
157
177 20,0
5
Сибай
2000
баш., ч/п
147
157
176 19,0
145,8
177,6 19,8±
Среднее (M±m)
154,6±0,73
±0,46
±1,26 0,18
№
п/п
Кличка
и тавро
Живая
масса, Класс
кг
9
10
400 I класс
478
420
440
Элита
Элита
Элита
450
490
430
Элита
Элита
Элита
412
448
460
442
436
446,0
±7,02
Элита
Элита
Элита
Элита
Элита
-
Все жеребцы являются элитными. Промеры: 145,8-154,6-177,619,8 см, живая масса – 446,0±7,02 кг. Производители по всем промерам превышают требования стандарта породы, более значительна
разница в промерах косой длины туловища и обхвату груди (соответственно на 3,1 и 1,5%). Животные высокорослы, желательного молочного типа с удлиненным (индекс формата – 106,1%) и развитым
(индекс широкотелости – 121,8%) туловищем.
Из пробонитированных 188 кобыл башкирской породы к бонитировочному классу элита отнесены 137 гол (73%) и 51 гол (27%) – к I
классу.
Животные среднерослые, с хорошо развитым в длину (индекс
формата – 106,4%) и глубину (индекс широкотелости – 121,2%) туловищем.
В результате проведенной комплексной фенотипической оценки
лошадей башкирской породы в зоне круглогодового табунного содержания (племенные фермы СПК «Ишкул», ООО «Казмаш», ООО
«Идель+» Абзелиловского районов РБ), установлено, что племенное
поголовье (11 жеребцов-производителей и 188 маток) по комплексу
селекционируемых признаков соответствует бонитировочным классам «элита» и «первый». Племенные матки характеризуются желательным типом и средней молочной продуктивностью – 2039 кг, что
превышает стандарт породы на 27,4%.
Литература:
1. Ахатова, И.А. Молочное коневодство: Племенная работа, технологии производства и переработки кобыльего молока [Текст]: И.А.
Ахатова. Уфа: Гилем, 2004, 324с.
2. Сатыев, Б.Х. Коневодство Башкортостана [Текст]: Б.Х. Сатыев,
К.З. Махмутов, В.И. Самохвалов. Уфа, 2001, 262 с.
УДК 636.2.082
ИСПОЛЬЗОВАНИЕ ЭТОЛОГИЧЕСКИХ ИНДЕКСОВ
В ОЦЕНКЕ ВОСПРОИЗВОДИТЕЛЬНОЙ ФУНКЦИИ
МОЛОЧНЫХ КОРОВ
Е.В. Смирнова
ГНУ Всероссийский научно-исследовательский ветеринарный
институт патологии, фармакологии и терапии Россельхозакадемии, г.
Воронеж
Патологии органов репродукции и, как следствие, снижение плодовитости и сроков продуктивного использования молочных коров,
остаются одной из важнейших проблем ветеринарного акушерства и
гинекологии. Среди непосредственных причин, вызывающих нарушения воспроизводительной функции, основную роль отводят стрессовому воздействию промышленных технологий содержания и эксплуатации, а также генетически обусловленной высокой продуктивности, присущей данным животным. При этом индивидуальным особенностям организма, связанным с типом высшей нервной деятель-
ности, как правило, не уделяется должного внимания, хотя в фундаментальных работах И.П. Павлова, И.М. Сеченова, П.К. Анохина доказано их определяющее влияние на возникновение и характер течения патологического процесса. Д.А. Алпаровым [1] было установлено, что при спаривании животных одинаковой типологической реактивности, определяемой исходя из павловского рефлексологического
принципа, наблюдался стерилитет, малая выживаемость или замедленное развитие потомства у белых мышей, свиней и крупного рогатого скота. В исследованиях на лабораторных животных В.Н. Семагиным с соавт. [5]показано, что при стресс-воздействиях интенсивность и продолжительность нарушений репродуктивной функции более характерны для животных слабого и неуравновешенного возбудимого типа, тогда как при сильном уравновешенном подвижном типе животные обладают выраженными компенсаторно-защитными реакциями, благодаря которым в дальнейшем происходит восстановление у них нарушенных функций.
Для определения типологических особенностей нервной системы
существуют разнообразные методы, однако применение их зачастую
трудновыполнимо в условиях производства. В связи с этим особый
интерес приобретает методика, разработанная В.И. Великжаниным
[2] на основании зависимости проявления внешней активности животных от их нервной системы и наследственных факторов, подходящая для широкомасштабных опытов и не оказывающая стрессового
воздействия на объекты исследования. Согласно показателям индексов общей активности, определяемых в данной популяции, автор
предлагает разделять животных на четыре класса (инфрапассивные,
пассивные, активные и ультраактивные) и использовать полученные
результаты для практического применения в животноводстве. С.А.
Гаврилин [3], выявив в своих исследованиях достоверную закономерность в улучшении продуктивных качеств коров при их отборе с учетом этологических признаков, подтвердил эффективность сочетания
данной методики с традиционно сложившейся системой селекции.
Подтверждения зависимости риска развития акушерской патологии от типа нервной системы непосредственно у крупного рогатого
находят также в работах А.С. Колбаева [4] и А.Г. Нежданова с соавторами [6].
Целью наших исследований явилось определение взаимосвязи
типологических особенностей поведения глубокостельных коров с
характером течения у них родового акта и послеродового периода. В
опыт было включено 82 сухостойные коровы черно-пестрой голштино-фризской породы со среднегодовой молочной продуктивностью за
прошедшую лактацию 7-8 тыс. кг. Типологические особенности их
поведения определяли по методике В.И. Великжанина на основании
трехдневных трехчасовых наблюдений за актами приема корма и воды, жвачного процесса, отдыха, доения. Животные с индексом этологической активности 0,278-0,648 (0,525±0,023) были отнесены к
группе инфрапассивных, 0,657-0,741 (0,675±0,010) – пассивных,
0,750-0,824 (0,777-0,009) – активных и 0,839-0,963 (0,877±0,008) –
ультраактивных. Учет характера течения родов и послеродового периода у коров показал, что животные инфрапассивного и ультраактивного типов поведения имеют больший риск развития акушерской
патологии. Так, родовспоможение им оказывалось чаще в 1,99-1,64
раза, задержание последа зарегистрировано больше в 2,0-1,47 раза, послеродовой эндометрит – в 1,80-1,54 раза, хронический эндометрит – в
2,9-2,18 раза, лактационная дисфункция яичников – в 1,65-1,06 раз.
При оценке биохимического статуса подопытных коров разных
поведенческих реакций установлено, что для животных инфрапассивного типа поведения характерен пониженный уровень иммунной
и антиоксидантной защиты, что является предрасполагающим фактором к развитию патологического процесса.
Таким образом, определение индексов этологической активности
может быть использовано не только для селективного отбора, но и
для выявления коров с риском развития патологических состояний
репродуктивной системы, проведения своевременных профилактических мероприятий и разработки схем лечения с учетом индивидуальных особенностей животных.
Литература:
1. Алпаров, Д.А. Типологическая реактивность и функции размножения у животных [Текст]: автореф. дис. … к.б.н. М., 1955. 16с.
2. Великжанин, В.И. Методические рекомендации по использованию этологических признаков в селекции молочного скота. С.Петербург, 2000. 19с.
3. Гаврилин, С.А. Использование этологических индексов в селекции молочного и молочно-мясного скота [Текст]: автореф. дис. …
к.с/х.н. Воронеж, 2009. 23с.
4. Колбаев, С.В. Взаимосвязь гематологических показателей у
нетелей с различным типом высшей нервной деятельности [Текст]:
дис. … к.б.н. Рязань, 2002. 99с.
5. Семагин, В.Н., Зухарь А.В., Куликов М.А. Тип нервной системы, стрессоустойчивость и репродуктивная функция [Текст]: М.:
Наука, 1988. 136с.
6. Нежданов, А.Г. Этологическая индивидуальность молочных
коров и заболеваемость их послеродовым эндометритом и маститом
[Текст]: / Нежданов А.Г. с соавт.// Ученые записки УО ВГАВМ, 2011,
Т. 47, вып. 2, часть 2. С. 91-93.
УДК 636.2.053.087.8
ЭКОЛОГИЧЕСКАЯ БЕЗОПАСНОСТЬ ГОВЯДИНЫ
ПРИ ВКЛЮЧЕНИИ ДОБАВКИ «БИОГУМИТЕЛЬ»
В РАЦИОН МОЛОДНЯКА КРУПНОГО РОГАТОГО СКОТА
Х.Х. Тагиров, Ф.Ф. Вагапов, Г.Г. Ибатова
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
С целью оценки влияния кормовой добавки «Биогумитель» на
экологическую безопасность говядины мы провели научнохозяйственный опыт в колхозе «Герой» Чекмагушевского района.
Объектом исследования являлись бычки черно-пестрой породы, которые в 6-месячном возрасте по принципу групп-аналогов были разделены на 4 группы по 10 голов в каждой. В кормлении бычков I
(контрольной) группы использовали основной рацион. Бычкам II
(опытной) группы дополнительно к основному рациону вводили 0,35
г пробиотической кормовой добавки «Биогумитель» на 1 кг корма, III
(опытной) группы- 0,70 г на 1 кг корма, IV (опытной) группы - 1,00 г
на 1 кг корма. Мясную продуктивность оценили по результатом контрольного убоя 3 бычков из каждой группы в возрасте в 18 мес по методике ВАСХНИЛ, ВИЖ, ВНИИМП (1977).
Действие кормовой добавки в качестве противоинфекционной
защиты обусловлено выделением бактериями антибиотиков широкого спектра действия, подавляющих рост стрептоккоков кишечной и
синегнойной палочки, патогенных грибков, вирусов, но не влияющих
на рост нормальной микрофлоры. В этой связи проведена оценка экологической безопасности мяса бычков черно-пестрой породы по всем
возможным загрязнениям. Контролем по содержанию токсичных и
вредных веществ в мясе служили их предельно допустимые нормы.
Содержание тяжелых металлов в мясе определяли на атомноабсорбционном спектрофотометре, пестицидов – на газовом хроматогрофе, нитритов – с помощью селективного электрода, афлотоксин
В1 – методом измерения флуоресценции в длинноволновом УФ –
свете, радионуклидов – методом радиометрии. Содержание антибиотиков и микробиологические показатели определяли по общепринятым методикам (табл. 1).
Таблица 1 Содержание тяжелых металлов и вредных веществ
в длиннейшей мышце спины бычков
Группа
I
Показатель
X  Sx
Медь
Цинк
Свинец
Кадмий
Никель
Хром
Ртуть
Мышьяк
Афлотоксин В1
Пестициды
Стронций-90,
Бк/кг
Цезий-137,
Бк/кг
II
Cv
X  Sx
2,21
±0,018
48,2
46,0±0,13 0,55
±0,34
0,31
0,30±0,010 6,11
±0,014
0,015
0,014
10,13
±0,0009
±0,0004
0,11
0,12±0,004 8,31
±0,003
0,07
0,06±0,003 9,77
±0,005
2,20±0,022 1,05
III
показатель
X  Sx
Cv
IV
Cv
X  Sx
Cv
0,90
2,19±0,038 1,87 2,22±0,017 0,95
1,33
46,4±0,58
9,31
0,28±0,009 5,33 0,34±0,011 6,89
6,37
6,73
0,013
±0,0010
2,20
8,97
47,4±0,19
0,016
±0,0011
0,97
12,30
0,18±0,005 9,12 0,17±0,007 10,57
10,32 0,09±0,006 11,79 0,10±0,004 9,32
не обнаружено
не обнаружено
не обнаружено
не обнаружено
3,2±0,09
4,50
8,6±0,12
2,73
3,0
±0,10
8,4
±0,14
5,13
3,0±0,08
4,02
3,1±0,11
6,03
2,81
8,5±0,11
2,30
8,6±0,16
3,20
Экологический мониторинг мясной продукции, полученный при
убое бычков всех групп, свидетельствует о том, что по содержанию
солей тяжелых металлов, ртути, радионуклидов, пестицидов, микробиологическим показателям, антибиотиков она соответствовала требованиям экологической чистоты. Существенной разницы между
оцениваемыми группами по экологическим показателям нами не
установлено.
Литература:
1. Акчурина, Ф.И., Яруллин, Р.Р., Фасхутдинов, Р.В. Влияние
биотрина на мясную продуктивность бычков [Текст] /: //Зоотехния. –
2000. – №10. – С. 12 – 13.
2. Акопян, К.А. Ускоренный метод выращивания крупного рогатого скота [Текст]: Совхозное производство. – 1943. – № 12. – С. 25-29.
3. Никулин, В.Н. Биологические основы применения пробиотических препаратов в сельском хозяйстве. [Текст]: Оренбург: Изд. Центр
ОГАУ,2007. – С.18 – 24.
УДК 636.2.087
ВЛИЯНИЕ ПРОБИОТИКА «ВЕТОСПОРИН»
НА ИММУНОБИОЛОГИЧЕСКИЕ ПОКАЗАТЕЛИ У БЫЧКОВ
Н.В.Фисенко, В.В.Гимранов
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Иммунная система играет немаловажную роль в поддержании
гомеостаза организма. Однако при определенных воздействиях факторов внешней и внутренней среды её функциональная активность
изменяется [1]. Таким факторам относятся развитие воспалительных
процессов на фоне травм и других хирургических процессов. Специфическая профилактика и антибиотикотерапия указанных процессов
не всегда достаточно эффективны, в связи с этим становится актуальной проблема коррекции иммунной недостаточности и нарушения
метаболизма у молодняка сельскохозяйственных животных. В этой
связи, применение лекарственных средств, сочетающих метаболические и иммуностимулирующие свойства, имеют большое практическое значение[2]. Одним из этих препаратов является пробиотик Ветоспорин.
Ветоспорин - пробиотик нового поколения, представляет собой
взвесь живых бактерий сенной палочки штаммов Bacillus subtilis 11B
и Bacillus subtilis 12B. 1 мл препарата содержит не менее 100 млн.
живых бактерий. В отличие от пробиотиков, содержащих бактерии
нормофлоры кишечника (бифидо- и лактобактерии, кишечную палочку, например: бифидумбактерин, лактобактерин, лактобифидол,
бификол), Ветоспорин обладает повышенным уровнем антагонистической активности к бактериальным и грибковым патогенным микро-
организмам и вирусам (выделяет до 70 антибиотических веществ полипептидной природы проявляет выраженный антогонизм к штаммам
родов Staphylococcus, Proteus, Pseudomonas, Streptococcus, Escherihia
coli, Shigella, а так же к грибам родов Candida, Fusarium, Alternaria,
Penicillium и обладает устойчивостью к широкому кругу антибиотиков, что позволяет использовать его для лечения тяжелых форм инфекции, при одновременной терапии с антибиотиком).
Цель работы – изучить влияние пробиотика Ветоспорин на показатели иммунного статуса у крупного рогатого скота.
Исследования проводились в коллекционном дворе УНЦ Башкирского ГАУ в мае - июне 2012 на 10 бычках черно-пестрой породы
в возрасте 5-6 мес.
Ветоспорин в виде суспензии, в дозе 10 мл. выпаивали утром до
кормления в течение 7 дней.
В цельной крови и сыворотке бычков определяли показатели иммунограммы до применения пробиотика, и после семидневного его
использования, при этом устанавливали: количество лейкоцитов,
лимфоцитов, Т-лимфоцитов (Е-РОК), фагоцитоз с латексом, иммуноглобулины IgA, IgM, IgG, иммуноглобулин Е общий, циркулирующие иммунные комплексы. Такие показатели как С-реактивный белок (СРБ), антистрептолизин – О (АСЛО), ревмотоидный фактор
(РФ) в крови у здоровых животных отрицательны. Состояние популяций В-лимфоцитов определяли по антителам – классами иммуноглобулинов: IgA, IgM, IgG, IgЕ .
Таблица 1 Показатели иммунограммы при применении пробиотика
Ветоспорин
Показатель
Лейкоциты 10 тыс
Лимфоциты %
Т-лимфоциты(Е-РОК) %
Фагоцитоз с латексом
Иммуноглобулин – А, г/л
Иммуноглобулин – М, г/л
Иммуноглобулин – G, г/л
Иммуноглобулин – Е, МЕ/мл
ЦИК, Ед
До назначения
Ветоспорина
3,6±0,12
14,8±0.37
45,2±1,73
46,7±1,25
0,89±0,02
0,51±0,02
5,26±0,26
25,8±0.75
7,0±0,21
После 7-кратного
применения Ветоспорина
3,78±0,16
33,4±1,21
63,0±2,31
54,8±1,64
2,0±0,21
1,14±0,06
11,6±0,56
31,0±1.12
40,0±1,33
Полученные результаты. После семикратного применения пробиотика Ветоспорин по данным таблицы 1, в показателях иммунограммы животных имелись существенные различия по сравнению с
исходными показателями до применения препарата, за исключением
количества лейкоцитов, этот показатель практически не изменился.
При этом после семикратного применения пробиотика Ветоспорин
отмечалось более чем 2- кратное увеличение количества лимфоцитов,
количество Т-лимфоцитов увеличилось с 45,2±1,73% до 63,0±2,31%,
показатели Фагоцитоза с латексом увеличились на 17%. В тоже время
нужно отметить, что показатели IgA, IgM, IgG увеличились в более
чем в два раза. Содержание общего Иммуноглобулина Е на 20,15% .
Как показали наши исследования содержание циркулирующих иммунных комплексов после применения пробиотика увеличилось 5,71
раз. Все эти изменения характеризовались высокой степенью достоверности р<0,001.
Таким образом, проведенные исследования по применению пробиотика Ветоспорин крупному рогатому скоту, показали его высокое
иммуностимулирующее действие
Литература:
1. Анников, В.В Анализ гематологических и гистологических
данных травматологически больных животных при использовании
кафорсена [Текст]/ В.В.Анников, Е.А. Якимчук//Известия Оренбургского ГАУ .-2011.-№3(31).-С.114-117.
2. Гимранов, В.В. Состояние иммунного статуса у крупного рогатого скота при раневом процессе [Текст] / В.В.Гимранов,
И.З.Юсупов// Известия Оренбургского ГАУ .-2011.-№2(30).-С.81-82.
УДК 636.2.087
ВОСПРОИЗВОДИТЕЛНЫЕ ПОКАЗАТЕЛИ МЫШЕЙ
ПРИ ПРИМЕНЕНИИ ОВЕСОЛА И ПАНТОКРИНА
Р.М. Хабибуллин, С.Е.Фазлаева
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Изучение влияния биологически активных веществ на воспроизводительные функции животных вызывают большой интерес в последние
десятилетия. Биологически активные вещества (БАВ) производят из
сырья растительного и животного происхождения. В своей работе мы
поставили задачу изучить их влияние в сравнительном аспекте.
В качестве БАВ растительного происхождения применялся овесол, животного происхождения – пантокрин. Препараты были отобраны с учетом их воздействия на физиологию организма.
Для сравнительного испытания влияния на воспроизводительную функцию препаратов пантокрин и овесол, использовали самок
белых мышей, которые содержались в отдельных клетках, были помечены краской и пронумерованы. Все подопытные животные содержались в одинаковых условиях. Начиная с 40 дня, после рождения, проводили спаривание самок мышей.
Препараты пантокрин (клетка № 1) и овесол (клетка № 2) задавали самкам мышей, начиная с 20 дня после рождения в течение 10
дней.
Животным третьей опытной группы (клетка № 3) задавали, начиная с 10 дня после рождения, в течение 5 дней пантокрин, а после
двухдневного перерыва – овесол, также в течение 5 дней.
После спаривания самок взвешивали и помещали в клетку. В
клетке №1 (n= 3) содержались самки мышей, получавшие с водой
пантокрин; в клетке №2 (n= 3) – самки мышей, получавших с водой
овесол; в клетке № 3 (n= 3) – самки мышей, получавших последовательно пантокрин +овесол; в клетке № 4 - самки мышей контрольной
группы (препараты не получали). Препараты задавались согласно инструкций. После взвешивания за подопытными мышами велось
наблюдение до рождения приплода, при этом отмечали продолжительность беременности, плодовитость, живую массу мышат и массу
гнезда приплода от одной самки.
Взвешивание подопытных самок после спаривания (во всех группах n= 3) показало, что средняя живая масса самок первой опытной
группы (клетка № 1), которым задавали пантокрин, составила 25,83
г., что было меньше живой массы самок второй опытной группы
(овесол) на 1,08 г и на 0,09 г живой массы самок третьей опытной
группы (пантокрин + овесол). Но средняя живая масса самок первой
опытной группы (пантокрин) превосходила средняя живую массу самок контрольной группы на 0,46 г.
Средняя продолжительность беременности самок была самой короткой в первой опытной группе. Во второй опытной группе беременность самок продолжалась на 3 дня дольше; в третьей – на 2 дня и
контрольной – на 1 день.
Самая высокая плодовитость нами отмечалась в третьей опытной
группе, она превосходила плодовитость самок первой опытной группы на 1 голову, а плодовитость самок мышей второй опытной группы
и контрольной групп – на 2 головы
Живая масса мышат, в среднем по группе, была наибольшей в
третьей опытной группе. Мышата второй опытной группы уступали в
живой массе мышатам третьей опытной группы на 0,12 г первой
опытной группы - на 0,45 г. Мышата контрольной группы уступали в
живой массе одной особи мышат третьей опытной группы на 0,40 г.
Средняя живая масса приплода одной самки (гнезда) нами также
отмечена в третьей группе. Она превосходила данный показатель в
первой и второй опытной группах на 5,53 г и 4,70 г, соответственно.
А живая масса гнезда в контрольной группе была ниже относительно
живой массы гнезда в третьей группе на 6,66 г.Результаты наших
экспериментальных исследований сравнительной эффективности
влияния БАВ животного (пантокрин) и растительного происхождения
(овесол), а также их комбинированного применения показал, что
наиболее эффективное влияние на воспроизводительную функцию
мышей оказывает комбинированное применение препаратов пантокрин + овесол.
Несмотря на большую продолжительность беременности самок
мышей в третьей опытной группе, мы одновременно отмечаем в этой
группе наивысшую плодовитость, живую массу мышат и массу приплода (гнезда) одной самки.
Раздельное применение препаратов пантокрин и овесол (опытные
группы 1 и 2), также оказывают положительное воздействие на функцию воспроизводства мышей, т.к. показатели – плодовитость, живая
масса мышат, и массу приплода, были выше данных показателей в
контрольной группе.
УДК 686.2.087
ИСПОЛЬЗОВАНИЕ БАД В КОРМЛЕНИИ ЦЫПЛЯТ-БРОЙЛЕРОВ
Г.С. Хабибуллина, Л.В. Герасимова
ФГБОУ ВПО Башкирский государственный аграрный университет, г.Уфа
Целью исследования являлось изучение влияния биологически
активных добавок Ветоспорина и Гуми на продуктивные качества
цыплят-бройлеров.
Были проведены две серии опытов по сравнительному влиянию
пробиотика Ветоспорин в сочетании с Гуми на продуктивные показатели цыплят-бройлеров. Исследования проводились на птицефабрике
«Уфимская» Республики Башкортостан на кроссе цыплят-бройлеров
«ISA». Срок выращивания составил 42 дня.
По данным живой массы цыплят-бройлеров на 42 день выращивания 1-опытная группа, в которой задавался пробиотик Ветоспорин
в концентрации 1кг на тонну комбикорма, имела живую массу 2503,7
г, что достоверно было больше по отношению к контролю на 19%.
Использование Гуми в концентрации 50г на тонну комбикорма в
кормлении бройлеров 2-опытной группы также положительно повлияло на их живую массу, она составила 2338,3г, что достоверно превышало контроль на 11,2%. В 3-опытной группе, где цыплята получали ежедневно эти добавки в комплексе в тех же концентрациях,
различий с контрольной группой практически не отмечалось, что
объясняется, возможно, большой концентрацией биологически активных веществ.
С целью дальнейшего изучения комплексного действия пробиотика Ветоспорина и Гуми была сделана вторая серия опытов, где мы
заведомо снизили концентрацию Гуми до 25 г на тонну комбикорма
во 2- и 3-опытных группах.
Во второй серии опытов бройлеры контрольной группы росли
несколько хуже, чем в первой, и достигли к концу откорма живой
массы лишь 2034,5 г. При этом цыплята 3-опытной группы, где задавался Ветоспорин и Гуми в комплексе, имели достоверную положительную разницу по живой массе с контролем на 8,5%. Также достоверно лучше показали себя цыплята 2-опытной группы, получавшие
Гуми, где разность составила 6,9% по сравнению с контролем. Во
второй серии опытов ростостимулирующее действие Ветоспорина
присутствовало, но в меньшей степени, чем в первой, и было недостоверным. Бройлеры 1-опытной группы лишь на 2,7%, весили больше, чем их аналоги из контрольной.
Таким образом, биологически активные добавки Ветоспорин и
Гуми позволяют достоверно повысить живую массу бройлеров к концу откорма как по отдельности, так и в комплексе.
УДК 636.59.087
ИСПОЛЬЗОВАНИЕ НУПРО В ПЕРЕПЕЛОВОДСТВЕ
Л.Ш. Хайруллина, Р.Р. Гадиев
ФГБОУ ВПО Башкирский государственный аграрный университет,
г.Уфа
Сегодня разведение перепелов привлекает к себе все большее
внимание птицеводов-любителей и фермеров. Вот уже около 20 лет
ВНИТИП ведет научно-исследовательскую работу в области технологий выращивания и содержания этого вида птицы [2].
Перепелиные яйца и мясо обладают целебными свойствами при
заболеваниях сердца, малокровии, гипертонии, гастритах, язвенной
болезни желудка, сахарном диабете, астме, туберкулезе, пневмонии,
анемии и некоторых глазных заболеваниях [4].
И ученые и практики ищут пути дальнейшего увеличения яичной
и мясной продуктивности птицы. В повышении продуктивности птицеводства решающее значение имеет полноценное, сбалансированное
кормление.
На рынке кормовых добавок дрожжи известны давно. В широком
биологическом понятии дрожжи — это группа нескольких видов одноклеточных грибов различных классов (сумчатых, базидиальных,
несовершенных) [3]. В качестве источника полноценного протеина
используют кормовые дрожжи [1].
НуПро - натуральный продукт, содержащий специально выведенную для обогащения и балансирования рационов сельскохозяйственных животных культуру дрожжей Saccharomyces cerevisiae.
Ученые доказали, что использование дрожжевых экстрактов в
кормлении птицы улучшает показатели роста, развитие пищеварительного тракта и иммунные функции, что делает дрожжевой экстракт отличным продуктом для использования в рационе сельскохозяйственной птицы.
В связи с этим изучение данных вопросов имеет научное и практическое значение.
Целью наших исследований явилось повышение продуктивных
качеств перепелов при использовании кормовой добавки НуПро. Исходя из этого, нами были поставлены следующие задачи:
- изучить рост и развитие ремонтного молодняка перепелов;
- выявить наиболее оптимальные сроки продолжительности
кормления;
- рассчитать экономическую эффективность использования
НуПро при выращивании ремонтного молодняка перепелов.
Исследование проводили в условиях ОАО «Туймазинская Птицефабрика» Туймазинского района РБ.
Для проведения исследований использовали перепелов японской
породы. Комплектование групп проводили в суточном возрасте по
200 голов в каждой группе. Перепела контрольной группы получали
основной рацион, во все контрольные группы к основному рациону
добавляли 2% НуПро - в первой опытной группе в течение 7 дней, во
2 – 14 дней и в 3 опытной группе – в течение21 дня.
В ходе исследования учитывали следующие показатели: живую
массу, сохранность, относительный и абсолютный приросты, затраты
корма и экономическую эффективность.
В результате исследования нами было выявлено улучшение продуктивных качеств ремонтного молодняка перепелов (таблица 1).
Таблица 1 Сохранность молодняка, %
Период
0-7 дней
8-14 дней
15-21 дней
22-28 дней
За весь период
контрольная
группа
97,50
98,46
99,48
99,48
1 опытная
группа
98,00
98,47
99,48
99,48
2 опытная
группа
99,50
99,50
100,0
100,0
3 опытная
группа
99,50
100,00
99,50
100,00
94,92
95,43
99,00
99,00
Более высокая сохранность ремонтного молодняка была выявлена во 2 и 3 опытных группах и составила 99%, что на 4,08% было
выше по сравнению с контрольной группой.
Суточные перепелята очень маленькие и подвижные, но растут
быстро. При выращивании птенцов важно соблюдать температурный
режим, так как они очень чувствительны к колебаниям температуры,
сквознякам и сырости [2]. Динамика живой массы молодняка представлена в таблице 2.
Анализируя таблицу, следует отметить, что более высокая живая
масса в конце периода была выше во 2 опытной группе (114,38 г.),
где кормовую добавку НуПро использовали в течение 14 дней с суточного возраста, а в 3 опытной группе она незначительно уступала и
составила 114,37 г.
Таблица 2 Динамика живой массы молодняка, г
Период
1 сут.
0-7 дней
8-14 дней
15-21 дней
22-28 дней
контрольная
группа
7,38
29,74
42,44
75,07
112,38
1 опытная
группа
7,34
30,03
43,27
76,46
112,85
2 опытная
группа
7,36
30,00
44,35
77,41
114,38
3 опытная
группа
7,41
30,02
44,32
78,91
114,37
Таким образом, более высокие продуктивные показатели при выращивании ремонтного молодняка перепелов были выявлены во 2
опытной группе, где в рацион перепелов были включена кормовая
добавка НуПро в объеме 2% от основного рациона продолжительностью 14 дней.
Литература:
1. Голушко, О. Автолизат кормвых дрожжей – нетрадиционная
добавка [Тест]/ В.Заяц, М.Надаринская, О.Лапотко, В.Голушко // Животноводство России. – 2010. - №4. – 51 с.
2. Кочетова, З.И. Перепелиное яйцо – секрет здоровья и долголетия [Текст]/ З.И. Кочетова, Л.С. Белякова // Птица и птицепродукты. –
2006. – №2. - 51 с.
3. Подобед, Л. На каких дрожжах растет птица [Текст]/ А. Подобед // Животноводство России. – 2007. - №4. – 21 с.
4. Харчук, Ю. Разведение и содержание перепелов [Текст] / Ю.
Харчук; худож.- оформ. А. Киричёк. — Ростов н/Д. : Феникс, 2005. —
96 с. ил. — (Подворье).
УДК 619:612.82
УЧАСТИЕ СТРУКТУР ГОЛОВНОГО МОЗГА
В РЕПРОДУКТИВНЫХ ФУНКЦИЯХ ОРГАНИЗМА
З.Р.Хисматуллина
ФГБОУ ВПО Башкирский государственный университет, г.Уфа
Функционирование репродуктивной системы определяется сложными нейроэндокринными механизмами, в осуществлении которых
наряду с эндокринными железами принимают участие различные
структуры лимбической системы мозга. Изучение фундаментальных
закономерностей структурно-функциональной организации репродуктивных центров головного мозга формируют теоретический и
практический базис для разработки научно-обоснованных рекомендаций по коррекции нарушений деятельности репродуктивных центров, проявляющихся нарушением регулярности эстрального цикла, с
использованием медикаментозных препаратов.
Эффективность животноводства напрямую зависит от продуктивности сельскохозяйственных животных и предопределяется возможностями репродуктивной системы поголовья. Основу работы репродуктивной системы составляют сложные нейроэндокринные механизмы.
В многочисленных работах расшифрованы механизмы взаимосвязей гипоталамических центров регуляции секреции гонадотропинов и гонад [2,3] и на основе этих знаний разработаны лечебные мероприятия по коррекции нарушений деятельности репродуктивной
системы. Однако, о роли экстрагипоталамических образований,
включающихся в модуляцию деятельности гипоталамических центров, известно крайне недостаточно.
Экспериментальными исследованиями установлена вовлеченность миндалевидного комплекса (МК) мозга в регуляцию секреции
гонадотропинов, при этом большую роль играют обонятельные стимулы, анализ которых осуществляется в миндалевидный комплекс.
Формирование миндалевидного комплекса как нейроэндокринного центра мозга происходит в периоде половой дифференциации
мозга, что доказано выявлением на его территории активности маркерных ферментных систем метаболизма половых стероидов. Показано, что активность и метаболические перестройки, предопределяемые этими ферментными комплексами, различны в ростральных и каудальных частях МК, что предопределяет формирование зон полового
диморфизма в переднем (передняя амигдалярная область, переднее
кортикальное ядро) и заднем (дорсомедиальное ядро) отделе МК [1].
Несмотря на наличие большого количества экспериментальных
работ, посвященных вопросу участия МК в обеспечении нейроэндокринных взаимодействий, роль выявленных на его территории зон
полового диморфизма в регуляции репродуктивных процессов, остается не выясненной. Между тем, новые знания, способны приблизить
нас к пониманию фундаментальных закономерностей взаимодействия
гипоталамических и амигдалярных центров регуляции в модуляции
секреции гонадотропинов и дать ключ к пониманию механизмов син-
хронизации их деятельности. Понимание структурных основ и механизмов функционирования репродуктивных центров МК способно
сформировать теоретический базис для разработки научнообоснованных профилактических и лечебных мероприятий в ветеринарии. При этом немаловажно отметить, что такие мероприятия могут быть разработаны на основе интраназального введения медикаментозных средств, т.к. известно, что репродуктивные центры МК
имеют прямые связи с основной и добавочной обонятельными луковицами.
Целью настоящей работы являлось изучение структурно-функциональной организации репродуктивных центров переднего отдела
миндалевидного комплекса мозга и выяснение их роли в механизмах
регуляции эстрального цикла, а также интеграции модулирующего
влияния половых стероидов на стволовые центры мозга.
Проведен детальный анализ цитоархитектоники и нейронной
организации переднего отдела миндалевидного комплекса мозга, позволивший разработать классификацию его структур на основе учета
представительства двух основных принципов организации серого
вещества нервной системы – ядерного и экранного. Установлено, что
зоны полового диморфизма переднего отдела миндалевидного комплекса мозга – переднее кортикальное ядро и передняя амигдалярная
область – являются межуточными формациями и входят в состав редковетвистой нейронной системы. Впервые разработана цитологическая классификация нейроэндокринных нейронов изученных репродуктивных центров на светооптическом (кариохромные, светлые и
цитохромные нейроны) и электронно-микроскопическом (темные и
светлые) уровнях. Выявлены ультраструктурные перестройки, происходящие в нейроэндокринных нейронах переднего кортикального ядра и передней амигдалярной области и их синапсоархитектоники в
динамике эстрального цикла. Впервые в изученных репродуктивных
центрах и субъядрах центрального ядра выявлен CART-пептид и
установлено модулирующее влияние половых стероидов на уровни
его экспрессии. В вышеперечисленных структурах миндалевидного
комплекса, нейроны испытывают модулирующее влияние половых
стероидов, что важно для понимания механизмов интегративной деятельности мозга. В электрофизиологическом эксперименте с моделированием эстрального цикла выявлен механизм активации и взаимодействия двух основных репродуктивных центров, расположенных в
переднем и заднем отделах МК - переднего кортикального ядра и
дорсомедиального ядра. Впервые показано, что введение прогестерона на фоне предшествующих инъекций 17β эстрадиола вызывает одновременную десинхронизацию ритмической активности указанных
двух центров в β2 – диапазоне.
Таким образом, репродуктивные центры вовлечены в обеспечение обратных связей с гонадами, что проявляется:
а) изменением ультраструктурной организации нейроэндокринных нейронов в динамике эстрального цикла, свидетельствующим о
повышении функциональной активности на стадии эструса и его
снижением на стадии метэструса;
б) ремоделированием синапсов на фоне колебаний уровней половых стероидов, проявляющимся увеличением на стадии метэструса
числа аксо-соматических и числа симметричных синапсов;
в) уровень экспрессии CART-пептида зависит от колебаний содержания в половых стероидов плазме крови в динамике эстрального цикла.
г) внутрибрюшинное введение 17β эстрадиола совместно с прогестероном после двух предшествующих инъекций 17β эстрадиола
гонадэктомированным животным оказывает достоверное влияние на
спектральную плотность высокочастотных колебаний в β-диапазоне
(18-32 Гц, при p<0,05).
Полученные в работе результаты, раскрывающие фундаментальные закономерности структурно-функциональной организации
репродуктивных центров МК, формируют теоретический базис для
разработки научно-обоснованных рекомендаций по коррекции нарушений деятельности гипоталамических центров регуляции секреции
гонадотропинов, проявляющихся нарушением регулярности эстрального цикла, использованием интраназального введения медикаментозных препаратов, способных синхронизировать эстральные циклы,
что чрезвычайно важно для ветеринарной практики.
Литература:
1. Акмаев, И.Г. Миндалевидный комплекс мозга: функциональная
морфология и нейроэндокринология [Текст] / И.Г. Акмаев, Л.Б. Калимуллина. - М.: Наука, 1993. - 269 с.
2. Бабичев, В.Н. Нейроэндокринный эффект половых стероидов
[Текст] / В.Н. Бабичев // Успехи физиологических наук. – 2005. - Т.
36, № 1. - С. 54-67.
3. Резников, А.Г. Нарушение механизмов регуляции и их коррекции [Текст] / А.Г. Резников // 4 Всесоюзный съезд патофизиологов:
тезисы докладов. - Кишинев, 1989. - Т. 1. - С. 202.
УДК 619:615.847:636.5
СЕКРЕТОРНАЯ АКТИВНОСТЬ ЩИТОВИДНОЙ
И ПОДЖЕЛУДОЧНОЙ ЖЕЛЕЗ ЦЫПЛЯТ-БРОЙЛЕРОВ
В УСЛОВИЯХ ИСКУССТВЕННОЙ ИОНИЗАЦИИ ВОЗДУХА
Е.А. Царёва, С.И. Кузнецов, В.В. Литвинова
ФГБОУ ВПО Пензенская государственная сельскохозяйственная
академия, г.Пенза
Исследования проводились в условиях опытного хозяйства «Пензенской ГСХА». Объектом исследования служили цыплята-бройлеры
кросса «Кобб-500». Птицу содержали напольно, кормили полнорационными, сбалансированными кормами. Регистрация изменений живой массы проводилась еженедельно до 40-дневного возраста. Убой
клинически здоровой птицы проводили в 40 дней. В каждой группе
использовано по 100 голов.
На протяжении всего опыта уровень кормления во всех группах
был одинаковый, а именно: в первый период выращивания (1–30 дн.)
цыплята потребляли комбикорм марки ПК-5Б с содержанием 22%
сырого протеина и 296,6 ккал обменной энергии, во второй период
ПК-6Б (31– 40 дн.) – 20% и 332,2 ккал соответственно.
В ходе исследований учитывали следующие показатели выращивания цыплят: живую массу (еженедельно путем взвешивания 10 голов из каждой группы); сохранность цыплят; среднесуточный прирост массы; расход корма на 1 кг прироста; уровень гормонов щитовидной железы, активность пищеварительных ферментов поджелудочной железы [1, 2].
Приведенные нами исследования по влиянию аэроионизации на
продуктивность бройлеров Кобб-500 (таблица 1) показывают, что
аэроионизация оказывает влияние на характер биологических ритмов в
изменениях массы бройлеров, а следовательно, и на их продуктивные
показатели. Можно отметить достоверное превосходство по живой
массе цыплят опытной группы над показателями в контрольной группе.
Результаты исследований показали, что цыплята в начале эксперимента не имели достоверных различий по живой массе. Начиная с
4 недели цыплята опытной группы стабильно опережают своих
сверстников из контрольной группы.
Бройлеры опытной группы имели большие приросты при меньшем потреблении кормов, следовательно, переваримость питательных
веществ из рациона у них была выше. Затраты кормов на 1 кг прироста
живой массы в опытной группе была ниже контроля на 10%.
Таблица 1 Показатели продуктивности цыплят-бройлеров
Показатель
Живая масса, гр.
в начале опыта
в конце опыта
Среднесуточный прирост, гр.
% к контролю
Сохранность, %
Затраты корма
на 1 кг прироста
% к контролю
Контрольная группа
Опытная группа
42,2±2,9
1952,7±142,6
42,2±2,9
2154,8±161,8
47,7
100
96
52,8
109,4
98
2,01
100
1,81
90,04
Исходя из вышеизложенного, можно заключить, что изменение
живой массы цыплят-бройлеров опытной группы отражает эффективность течения биологических процессов в их организме. Именно
данный показатель является основным при выращивании бройлеров.
Следует отметить, что на рост (увеличение массы и размеров) расходуется основное количество питательных веществ, поступающих в
организм. Очевидно, что по мере развития организма все большее
значение приобретает именно регуляция, распределение питательных
веществ, т. е. координация процессов метаболизма под действием
окружающей среды.
Одним из главных факторов, влияющих на основной обмен веществ организма, принадлежит щитовидной железе, от деятельности
которой в значительной степени зависят уровень и интенсивность
обмена белков, углеводов и жиров, а также минеральных веществ,
воды и витаминов. Тироидные гормоны щитовидной железы необходимы для нормального развития и роста организма. При изменении
функционального состояния щитовидной железы изменяется интенсивность обменных процессов[1].
С целью оценки секреторной активности щитовидной железы
нами был изучен уровень содержания тиреоидных гормонов (тироксин и трийодтиронин), а также уровень содержания тиреотропного
гормона в сыворотке крови цыплят-бройлеров.
Уровень гормонов в сыворотке крови подопытных цыплятбройлеров представлен в таблице 2.
Нами отмечено повышение уровня общего тироксина в сыворотке крови цыплят опытной группы по отношению к цыплятам контрольной группы на 10,5 %, трийодтиронина на 12,4 %.
Таблица 2 Динамика показателей уровня гормонов в сыворотке крови
подопытных цыплят-бройлеров
Показатели
Тироксина, нмоль/л
Трийодтиронина, нмоль/л
Тиреотропный гормон, мкМе/мл
Группы цыплят
Контрольная
38,00±2,04
1,85±0,20
0,23±0,04
Опытная
42,00±1,22
2,08±0,31
0,18±0,02
Содержание тиреотропного гормона снижается в сыворотке крови цыплят опытной группы на 21,7 % по сравнению с контрольной.
На основании анализа уровня тиреотропного гормона в сыворотке
крови цыплят-бройлеров установлено, что введение аэроионизации
приводит к снижению синтеза ТТГ гипофизом как следствие повышения функциональной активности щитовидной железы.
Анализируя полученные данные исследований по определению
секреторной активности щитовидной железы цыплят-бройлеров,
можно сделать вывод, что аэроионизация обеспечивает оптимальную
секреторную активность щитовидной железы, что обусловливает более интенсивный уровень обмена веществ, следовательно, и высокие
продуктивные качества цыплят-бройлеров.
В пищеварительном тракте происходит гидролиз и всасывание
питательных веществ. Их переваривание осуществляется в основном
за счет ферментов поджелудочной железы и тонкого кишечника. Интенсивность расщепления питательных веществ зависит как от количества вырабатываемых ферментов, так и от их активности [2]. В
нашем эксперименте мы исследовали активность пищеварительных
ферментов поджелудочной железы цыплят-бройлеров, сведение о которой представлены в таблице 3.
Таблица 3 Активность пищеварительных ферментов поджелудочной
железы, мг/мл, мин
Показатель
Протеаза, мг/мл, мин
Липаза, мг/мл, мин
Группы цыплят
Контрольная
Опытная
8,52±0,7
9,43±1,15
1,9±0,43
2,4±1,37
Приведенные данные в таблице 3 свидетельствуют о том, что
протеалитическая активность опытной группе превосходят таковую
контрольной на 10,6%. Более стойкая тенденция к увеличению
наблюдается также в опытной группе. Это, в свою очередь, повлияло
на переваримость питательных веществ рациона цыплятами и в конечном результате сказалось на среднесуточных приростах их массы
(таблица 1).
Результаты исследования применения аэроионизации при выращивании цыплят-бройлеров кросса Кобб-500 показали, что данное
технологическое решение способствует наилучшему течению биологических процессов в их организме, что положительно сказывается на
продуктивности цыплят.
Литература:
1. Баркер, С.Б. Биохимия гормонов щитовидной железы: Щитовидная железа (физиология и клиника) [Текст]/ С.Б.Баркер Л., 1963. С. 16-21.
2. Батоев, Ц.Ж. Пищеварительная функция поджелудочной железы у кур, уток и гусей [Текст] / Ц.Ж. Батоев. - Улан-Удэ. - 1993.
УДК 619:615.847:636.5
ВЛИЯНИЕ АЭРОИОНИЗАЦИИ НА РАЗВИТИЕ
И ФИЗИОЛОГИЧЕСКИЙ СТАТУС ЦЫПЛЯТ-БРОЙЛЕРОВ
Е.А Царёва, С.И. Кузнецов
ФГБОУ ВПО Пензенская государственная сельскохозяйственная
академия, г. Пенза
При промышленном содержании птицы специалисты столкнулись с рядом проблем связанных с технологическими условиями ее
выращивания: плотность посадки, физическая и химическая чистота
воздуха, приемы вентиляции, условия и качество кормления. Адекватное сочетание внешних и внутренних факторов, безусловно, сказывается на организме птицы в целом, что необходимо учитывать при
любых технологических процессах[1].
Положительное влияние на физиологический статус организма
оказывает применение искусственной аэроионизации. Результаты
аэроионизации свидетельствуют о том, что искусственные аэроионы
кислорода увеличивают выход продукции и улучшают ее качество.
Аэроионы резко сокращают заболеваемость животных, летальность
молодняка [3].
В связи с этим цель нашего исследования – изучить показатели
роста и развития, а также изменения физиологического статуса цып-
лят-бройлеров в постнатальном онтогенезе под влиянием аэроионизации.
Исследования проводились в условиях опытного хозяйства «Пензенской ГСХА». Объектом исследования служили цыплята-бройлеры
кросса «Кобб-500». Птицу содержали напольно, кормление происходило полнорационными, сбалансированными кормами. Регистрация
изменений живой массы проводилась еженедельно до 40-дневного
возраста. Кровь у птицы брали из вены с внутренней стороны крыла
над локтевым сочленением путем прокола. Кровь для исследования
стабилизировали 1 % раствором гепарина. [2] Убой клинически здоровой птицы проводили в 40 дней. В каждой группе использовано по
100 голов.
Данные по динамике изменения живой массы цыплят-бройлеров
представлены в таблице 1.
Таблица 1 Возрастные изменения живой массы
Группа
цыплят
Контроль
Опыт
Р
1
42,2
±2,9
42,2
±2,9
7
14
144,3 352,2
±11,6 ±22,1
163,5 418,7
±12,1 ±32,6
0,05
0,01
Живая масса, г
Возраст, дней
21
28
676,5 1082,4
±51,3 ±92,2
772,3 1252,2
±59,8 ±98,2
0,05
0,05
35
1574,6
±119,5
1755,4
±126,4
0,05
40
1952,7
±142,6
2154,8
±161,8
0,05
Сохранность, %
96
98
Анализируя возрастные изменения живой массы можно отметить,
что в первые две недели опыта цыплята обеих групп растут равномерно. Максимальное опережение в росте цыплятами опытной группами на 15,6 % таковых контрольной происходило в 4-х недельном
возрасте, в последствии это опережение снижалось и к моменту забоя
составило 10,9 %.
Показателем продуктивности цыплят-бройлеров является и среднесуточный прирост живой массы. Динамика изменения среднесуточного прироста представлена в таблице 2.
Среднесуточный прирост живой массы за весь период откорма
составил в контрольной группе 47,7 г, в опытной 52,8 г, что на 10,7%
выше. Анализ среднесуточного прироста позволяет сделать вывод о
стимулирующем эффекте искусственной аэроионизации.
Важным показателем эффективности выращивания бройлеров
является конверсия корма. Расход корма представлен в таблице 3.
Таблица 2 Изменения среднесуточного прироста живой массы
Группы
цыплят
7
Контроль 14,5±1,1
Опыт
17,3±1,2
± к контр.
+2,8
Р
0,05
Среднесуточный прирост, г
Возраст, дней
14
21
28
35
29,7±1,9 46,3±3,6 57,9±4,2 70,3±5,2
36,4±2,8 50,5±4,5 68,5±4,1 71,8±5,1
+6,7
+4,2
+10,6
+1,5
0,05
0,05
0,01
0,05
40
75,6±5,3
85,84,9
+10,26
0,05
Таблица 3 Расход корма при выращивании цыплят-бройлеров
с использованием искусственной аэроионизации
Группа
Контрольная
Опытная
Расход корма на 1 кг прироста живой массы
норматив, кг
факт, кг
+ к нормативу
2,01
2,01
2,01
1,81
-0,2
Анализируя таблицу 3, можно отметить, что расход корма в
опытной группе снизился на 10 %.
Гематологические показатели крови птиц объективно отражают
как физиологический статус, и возможные патологические изменения
в организме.
Исследования крови позволили установить, что показатели морфологического и физиологического состава ее были в пределах физиологических границ, однако у цыплят-бройлеров опытной группы,
выращиваемых с использованием аэроионизации, они имели лучшие
значения. Гематологические показатели цыплят-бройлеров представлены в таблице 4.
Таблица 4 Гематологические показатели бройлеров
Показатели
Гемоглобин, г/л
Эритроциты,1012/л
Лейкоциты, 109/л
Гематокрит, %
Общий кальций, моль/л
Неорг. фосфор, ммоль
Резервная щелочность, об%/ СО2
Общий белок, г/л
Лизоцим, %
Бактерицидная активность сыворотки, %
Фагоцитарная активность лейкоцитов, %
Группы цыплят
контрольная
опытная
85,42±6,31
98,30±7,4
2,84±0,23
3,03±1,80
28,41±1,84
29,34±0,22
34,36±1,85
34,42±0,15
2,72±0,34
3,43±1,80
1,31±0,06
1,37±0,13
46,30±1,32
50,19±2,10
4,52±0,04
4,57±0,14
46,40±0,03
47,38±1,15
75,42±0,15
74,65±1,03
64,89±1,23
66,02±0,28
Анализируя таблицу 4, нами отмечено увеличение содержания
общего белка на 1,1 %, эритроцитов на 6,6 %, гемоглобина на 15 % в
опытной группе, что свидетельствует об усилении эритропоэза, повышении естественной резистентности организма, улучшении общего
физиологического состояния (повышению фагоцитарной активности
зернистых лейкоцитов, резервной щелочности) под влиянием
аэроионизации, в отличие от контрольной группы цыплят-бройлеров,
в которой эти показатели на протяжении всего эксперимента были
ниже.
Обобщая данные можно отметить, что аэроионы, будучи задействованы в регуляторно-метаболических процессах организма и осуществляя связь между внешней и внутренней средой организма, являются удобным способом воздействия на организм с целью лечения,
оздоровления, профилактики отдельных болезней и мобилизации резервных возможностей организма при воздействии неблагоприятных
факторов окружающей среды.
Литература:
1. Мачабели, М.С. Аэроионы и жизнь [Текст]/ М.С. Мачабели //
Новое в трансфузиологии.- М.: 1996.- Вып.ЛЗ.- С. 29-32.
2. Общие и специальные методы исследования крови птиц промышленных кроссов [Текст]/ Н.В. Садовников, Н.Д. Придыбайло,
Н.А. Верещак, А.С. Заслонов// Екатеринбург – Санкт-Петербург:
Уральская ГСХА, НПП «АВИВАК», 2009 -85 с.
3. Скипетров, В.П. Применение аэроионов в сельском хозяйстве
[Текст]/ В.П. Скипетров // Труды Мордовского государственного
университета.-Саранск.- 2003.- С. 122-123.
УДК 619:615
О ВОЗМОЖНОСТИ ФАРМАКОЛОГИЧЕСКОЙ
СТАБИЛИЗАЦИИ ПРОЦЕССОВ ПЕРЕКИСНОГО
ОКИСЛЕНИЯ ЛИПИДОВ С ПРИМЕНЕНИЕМ МЕТИЛОВОГО
ЭФИРА КЕТОТРЕТРАКАРБОНОВОЙ КИСЛОТЫ
И.В. Чудов, А.Ф. Исмагилова
ФГБОУ ВПО Башкирский государственный аграрный университет, г.Уфа
В настоящее время в ветеринарную практику активно внедряются
новые лекарственные средства, разрабатываемые на основе возобновляемых источников лекарственного растительного сырья, обла-
дающих высокой биологической активностью, и, широким спектром
фармакологического действия [1, 4]. Наиболее перспективными компонентами растений для разработки лекарственных средств являются
полусинтетические производные ди- и тритерпеноидов. В частности,
ранее нами уже был выявлен ряд фармакологических свойств монометилового эфира кетотетракарбоновой кислоты, отразившийся в
противоязвенной, противовоспалительной и гепатопротекторной активности, а также установлена возможность его применения при лечении катарально-гнойных эндометритов у коров.
Целью наших исследований явилось изучение влияния нового
полусинтетического тритерпеноида монометиловый эфир кетотретракарбоновой кислоты на течение процессов перекисного окисления липидов в организме кроликов и раскрытие его роли в механизмах гепатопротекторного, противовоспалительного и противоязвенного эффектов, а также в улучшении гормонального статуса у коров при лечении катарально-гнойного эндометрита.
Исследования проведены на кроликах двухмесячного возраста,
обоего пола, породы «Серебристый», содержащихся в одинаковых
условиях вивария согласно требованиям СанПИН № 1045-73. Рацион
кроликов состоял из сбалансированного по питательности, витаминам и минеральным веществам гранулированного корма «ПроКорм».
Опытные животные были распределены на 4 группы по 5 голов в
каждой. До начала исследований, а также на 14 и 30 сутки исследований осуществляли забор крови и определяли в ней основные показатели, характерезующие качество течения реакций перекисного окисления липидов. Животные 4 группы служили контролем, и не подвергались действию лекарственных веществ, животным 1-3 групп ежедневно, на протяжении 7 дней с кормом назначали метиловый эфир
кетотетракарбоновой кислоты в дозах 10 мг/кг, 25 мг/кг и 50 мг/кг
соответственно. Монометиловый эфир кетотретракарбоновой кислоты, использованный в опытах, был синтезирован в институте органической химии Уфимского научного центра РАН под руководством
доктора химических наук О.Б. Казаковой.
Уровень диеновых конъюгатов в сыворотке крови определяли по
методу В.Б. Гаврилова и М.И. Мишкорудной [2]. Уровень малонового диальдегида в сыворотке крови оценивали по методу М. Mihara
[5]. Концентрацию ретинола в сыворотке крови определяли по методике Бессея в модификации В.И. Левченко [3]. Концентрацию αтокоферола по реакции комплексообразования с α,α`-дипиридилом
[3]. Определение активности глутатионредуктазы и глутатионпероксидазы и каталазы эритроцитов проводили кинетическим методом с
применением стандартных реактивов VitalDiagnosticsSpb на полуавтоматическом биохимическом анализаторе StatFax 1904+. Статистическую обработку проводили с использованием стандартного пакета
анализа данных приложения MS Excel.
В результате проведенных исследований нами установлено, что
семидневное профилактическое назначение метилового эфира кетотетракарбоновой кислоты кроликам внутрь, в дозах от 10 до 50 мг/кг
способствует значительному улучшению течения процессов перекисного окисления липидов у кроликов. Антиоксидантные свойства метилового эфира кетотетракарбоновой кислоты отразились в увеличении уровня глутатионзависимых антиоксидантных ферментов:
гемотетрамерного селенопротеина глутатионпероксидаза,
принимающего активное участие в регуляции тиолдисульфидного
равновесия в тканях за счет катализа процесса восстановления перекисей липидов в соответствующие спирты, а также процесса восстановления водорода пероксида и водорастворимых органических гидроперекисей (алифатических и циклических углеводородов, полиненасыщенных жирных кислот, глицерина, холестерина, прогестерона и
простагландинов);
глутатионредуктазы, являющейся классическим цитозольным ферментом класса оксиредуктаз, катализирующим восстановление дисульфидных связей окисленного глутатиона до его восстановленной сульфгидрильной формы.
Так, на четырнадцатый день исследований, уровень глутатионпероксидазы в эритроцитах кроликов, получавших метиловый эфир кетотетракарбоновой кислоты в дозах 25-50 мг/кг на протяжении семи
дней, повысился до ~16,6 мкмоль/мл/мин, что на ~11,9% больше в
сравнении с показателем в начале исследований (14,84±0,42
мкмоль/мл/мин) и на ~25,7% больше в сравнении с значением этого
показателя у животных контрольной группы (13,21±0,11
мкмоль/мл/мин). При этом активность глутатионредуктазы составила
~2,33 мкмоль/мл/мин, что на ~28,7% больше значения этого показателя в контрольной группе (1,81±0,04 мкмоль/мл/мин) и на ~4,0%
выше в сравнении со значением в начале исследований (2,24±0,02
мкмоль/мл/мин).
Помимо повышения уровня глутатионзависимых антиоксидантных ферментов в эритроцитарных клетках крови кроликов, получав-
ших метиловый эфир кетотетракарбоновой кислоты в дозах 25-50
мг/кг, к четырнадцатому дню исследований нами также установлено
и повышение активности их синергиста в реакциях обезвреживания
водорода пероксида – каталазы. Активность каталазы при этом составила ~36,0 ммоль H2O2/л, тогда как в эритроцитах крови кроликов
контрольной группы она составила 34,57±0,28 ммоль H2O2/л, что на
~4,1% ниже сравниваемого значения.
Достоверное (Р<0,05) повышение уровня токоферола и ретинола
в сыво-ротке крови кроликов, получавших метиловый эфир кетотетракарбоновой кислоты в дозах 25-50 мг/кг, с 1,88±0,02 мкг/мл до
~2,1мкг/мл (на ~11,7% больше в сравнении с начальным значением
показателя и на ~16,0% больше в сравнении с значением показателя
животных контрольной группы) и с 0,23±0,01 мкг/мл до ~0,34 мкг/мл
(на ~47,8% больше в сравнении с начальным значением показателя и
на ~54,6% больше в сравнении с значением показателя животных
контрольной группы) соответственно, к четырнадцатому дню исследований, нами связано с уменьшением их затрат в системе антиоксидантной защиты на фоне активации ферментативного звена и сопряженного с этим понижения уровня маркеров перекисного окисления
жиров и оксидативного стресса, представленных как диеновыми
конъюгатами, так и малоновым диальдегидом, образующимися в организме животных в результате дегидратации полиненасыщенных
жиров активными формами кислорода. Так уровень малонового
диальдегида к четырнадцатому дню исследований понизился с
1,08±0,01 нмоль/мл до ~0,80 нмоль/мл (на ~25,9% меньше исходного
значения показателя и значения в контрольной группе), уровень диеновых конъюгатов, к тому же сроку исследований, понизился с
1,68±0,01 нмоль/мл до ~1,45 нмоль/мл (на ~13,7% меньше значения
начального показателя и на ~15,2% меньше значения показателя в
контрольной группе).
К тридцатому дню исследований в группе животных, в течение
семи дней получавших с кормом метиловый эфир кетотетракарбоновой кислоты в дозах 25-50 мг/кг и кратностью один раз в день, рассматриваемые показатели стремились к значениям в контрольной
группе, но, не достигая их, формировали более позитивное состояние
активности антиоксидантной защиты в системе перекисного окисления липидов.
Необходимо также отметить, что дозы метилового эфира кетотетракарбоновой кислоты ниже 10 мг/кг, при семидневном внутреннем
назначении кроликам, не приводили к достоверно лучшим эффектам в
сравнении с контрольной группой. Повышение дозы метилового эфира кетотетракарбоновой кислоты с 10 до 25 мг/кг приводило к достоверному усилению эффекта антиоксидантной защиты и не имело его
достоверного улучшения при повышении дозы до 50 мг/кг.
Семидневное назначение метилового эфира кетотетракарбоновой кисло-ты в дозах 10-50 мг/кг не вызывает развития цитотоксическиого эффекта в тканях организма животных, а семидневное ее
назначение в дозе 25 мг/кг способствует качественному улучшению
течение реакций перекисного окисления липидов в органах и тканях,
предотвращая процессы свободнорадикального окисления. В свою
очередь, указанный факт дает основание предполагать о возможности
применения метилового эфира кетотетракарбоновой кислоты при патологиях, характеризующихся гипоксическими явлениями, а также
при интоксикациях эндо- и экзогенного характеров с явлениями цитолизиса, как результата образования свободнорадикальных оксидантов (О , Н2О2, –ОН, Н–О–Cl и т.п.) и ДНК-аддуктов, реализующих
основные механизмы мута-, канцерогенеза и преждевременного старения клеток. Учитывая то, что железосодержащий протопорфирин
каталаза в наибольших количествах содержится в цитозоле и пероксисомах гепатоцитов (до 40% всего белка), то повышение уровня этого фермента совместно с глутатионредуктазо и глутатионпероксидазой, при назначении метилового эфира кетотетракарбоновой кислоты,
может являться ключевым звеном в ее механизме протекторного действия при патологиях печени, сопряженных с нарушением различных
биомолекулярных клеточных структур (нуклеиновых кислот, белков
и липидов) в результате активации свободнорадикального оксиления.
Литература:
1. Аджиев, Д.Д. Исследование продуктов перекисного окисления
липидов, неферментативной и ферментативной антиоксидантной системы в возрастной динамике самцов кроликов [Текст]//Вестник ВОГиС. –2010. –№4. –Т.14. –С. 674-684.
2. Гаврилов, В.Б. Спектрофотометрическое определение содержания гидроперекисей липидов в плазме крови [Текст] / В.Б. Гаврилов, М.И. Мишкорудная/Лаб. дело. –1983. –№ 3. –С. 33-35.
3. Кондрахин, И.П., Методы ветеринарной клинической лабораторной диагностики. [Текст]/И.П.Кондрахин, А.В.Архипов, В.И. Левченко/ –М.: Колос, 2004. –С. 186-187, 195-196.
4. Петрович, Ю.А. Свободно-радикальное окисление и роль в патогенезе воспаления, ишемии и стресса [Текст] / Ю.А.Петрович,
Д.В.Гуткин /Патологическая физиология и экспериментальная терапия. –1996. –№5. –С.85-92.
5. Mihara, M., Uchiyama, M., Fukuzawa, K. Thiobarbituric acid value
on fresh homogenate of rat as a parameter of lipid peroxidation in aging,
CCl4 intoxication and vitamin E defi ciency //Biochem. Med. 1980. V. 23.
№ 3. P. 302–311.
УДК 619: 618.19
ЛЕЧЕБНАЯ ЭФФЕКТИВНОСТЬ БИОГЕННЫХ
СТИМУЛЯТОРОВ «ЭПЛ» И «ПДЭ» ПРИ НЕКОТОРЫХ
ФОРМАХ МАСТИТА У ЛАКТИРУЮЩИХ КОРОВ
Р.К. Шаев, М.А. Багманов
ФГБОУ ВПО Казанская государственная академия ветеринарной
медицины имени Н.Э.Баумана, г.Казань
В обеспечении населения страны продуктами питания важнейшее
значение отводится молочному скотоводству, необходимым условием интенсивного ведения которого является обеспечение здоровья
маточного поголовья.
Решению этой задачи мешает широкое распространение мастита
коров. Воспаление молочной железы - мастит у коров наносит огромный экономический ущерб за счет снижения удоев, санитарных и
технологических качеств молока [1].
В настоящее время актуальной задачей является создание экологически безопасных, обладающих высокой профилактической и терапевтической эффективностью средств [2].
Именно поэтому ветеринарные врачи для лечения маститов, в
настоящее время всё шире и шире применяют препараты изготовленные на основе растительного и животного сырья. Такие препараты
абсолютно безопасны для организма, не оказывают негативного влияния на состав молока [3].
В связи с этим перед нами была поставлена цель, изучить в сравнительном аспекте лечебную эффективность биогенных стимуляторов «ЭПЛ» (экстракт плаценты с лещинником) и «ПДЭ» (плацента
денатурированная эмульгированная) при субклинической и острой
серозной формах мастита у коров.
«ЭПЛ» является лечебным препаратом, состоящий из двух действующих компонентов: экстракта плаценты коров и жидкой фракции «лещинника» продукта сухой возгонки биомассы лесной орешины. Относится к группе биологически активных веществ, обладающим бактерицидным, фунгицидным, биогенным и гормональным
действием, вызывает улучшение процессов обмена и использования
питательных веществ, нормализирует и активирует регулирующее
влияние центральной нервной системы.
Опыты по лечению коров больных маститом, проводили на коровах холмогорской породы татарстанского типа, принадлежащие хозяйству СХПК имени «Вахитова» Кукморского района. Для этого
были сформированы две группы коров по 22 головы в каждой, больных субклинической и острой серозной формой мастита. Данные
группы по принципу пар-аналогов были разделены на опытную и
контрольную, с учетом возраста и продуктивности.
Подбор животных проводили после клинического обследования
и учета реакции секрета молочной железы с быстрым маститным тестом «Ибромаст» на молочно-контрольной пластинке ПМК-2. Диагноз на субклинический мастит ставили с учетом положительной реакции секрета вымени с диагностическим реактивом, подтвержденный повторным исследованием через 24 часа и пробой отстаивания.При клиническом исследовании коров, больных острой серозной
формой мастита выявили, что общее состояние характеризовалось
депрессией, снижением аппетита, повышением температуры тела,
учащением пульса и дыхания. Больные четверти вымени были значительно увеличены в объеме, болезненны, отечны, плотной иногда каменистой консистенции, становилась горячей, кожа вымени гиперемирована. Количество суточного и разового удоя больных животных
уменьшилось почти в 2 раза.
Для лечения коров опытных групп использовали следующую
схему:
а) туалет вымени (обработка вымени и сосков многоразовой индивидуальной салфеткой с дезинфицирующим 0,5% раствором «Дермисана» до доения и окунание сосков в стакан с «Блю Гард» после
доения.
б) тщательное выдаивание пораженных четвертей два раза в сутки.
в) биогенный стимулятор «ЭПЛ» вводили согласно утвержденной инструкции подкожно в область наружного пахового лимфатиче-
ского узла, отступя вентрально на 1-2 см от края узла в лимфатическую сеть в дозе 0,1 мл на кг массы тела двукратно с интервалом 48
часов. Контрольным группам коров, после проведения вышеизложенных обработок и тщательного выдаивания пораженных четвертей, в область наружного пахового лимфатического узла, отступя
вентрально на 1-2 см от края узла в лимфатическую сеть вводили
препарат «ПДЭ» согласно утвержденному наставлению.
За всеми животными вели наблюдение и учитывали сроки выздоровления по отрицательной реакции с быстрым маститным тестом
«Ибромаст».
Результаты исследования по изучению лечебной эффективности
препаратов при субклиническом мастите у коров, в период лактации
представлены в таблице 1 .
Таблица 1 Результаты лечения коров биогенными стимуляторами
Подвергнуто
Продолжительность
Выздоровело Кратность
лечению
лечения
Группа
введения
голов
гол/%
дни
Субклинический мастит
Опытная
11
11/100
2
3,7±0,2*
Контрольная
11
9/81,8
4
4,7±0,3
Острый серозный мастит
Опытная
11
9/81,8
2
4,1±0,2*
Контрольная
11
7/63,6
4
5,1±0,3
Примечание:* - Р<0,05.
По данным таблицы 1 видно, что после лечения коров больных
субклиническим маститом, в опытной группе произошло выздоровление всех животных (100%) при кратности введения два раза. Лабораторные исследования молока пробой отстаивания и двукратно
«Ибромастом» были отрицательны. Продолжительность лечения было достоверно ниже (Р<0,05) чем в контрольной группе и составило в
среднем 3,7 дней. В контрольной группе полного выздоровления не
произошло и составило 81,8%. Продолжительность лечения выздоровевших животных в среднем составило 4,7 дней.
После лечения коров больных острым серозным маститом, в
опытной группе произошло выздоровление 9 (81,8%) и улучшение
состояния у оставшихся 2-х коров при кратности введения два раза.
Продолжительность лечения было достоверно ниже (Р<0,05) чем в
контрольной группе и составило в среднем 4,1 день. У коров опытной
группы уже спустя сутки после введения препарата начались изменения температуры тела, пульса, дыхания с нормализацией к концу лечения. На протяжении курса лечения улучшалось общее состояние
животных, угасали признаки воспаления и болезненности пораженных четвертей и лимфатического узла. Внешний вид секрета из леченных четвертей не отличался от молока здоровых коров, а при исследовании его на наличие мастита диагностикумом, давили отрицательный результат. В контрольной группе полного выздоровления не
произошло и составило 63,6%. У 2 коров наблюдали улучшение состояния, и у 2 коров изменения в состоянии молочной железы не
наблюдали. Продолжительность лечения выздоровевших животных в
среднем составило 5,1 дней.
Таким образом, биогенный стимулятор «ЭПЛ» является более
эффективным средством для лечения субклинической и острой серозной формы мастита у коров в период лактации, чем препарат
«ПДЭ». Кроме того применение данного способа лечения, не снижает
качества молока, в отличие от применения антибиотиков и вызывает
лактогенный и противомикробный эффекты.
Литература:
1. Демидчик, Л.Г. Доксиветин – антибиотик пролангированного
действия [Текст] /Л.Г. Демидчик // Журн. Ветеринария. Реферативный журнал – 2001.- Т.1,- С.69.
2. Дольникова, М.Н. Новые эффективные препараты для животных [Текст]/ М.Н. Дольникова, Ю.Г. Попов // Практик./ Санкт Петербург.- 2002. - № 12. –– С. 32 – 36.
3. Чурсин, А.В. Терапия суклинического и клинически выраженного мастита коров новым антимикробным препаратом линдомаст
[Текст] / А.В. Чурсин // Международный вестник ветеринарии - 2008
- 3. - С 49
УДК 619:616.136:591.463
ОЦЕНКА ВОССТАНОВЛЕНИЯ СТРУКТУРНОЙ ОРГАНИЗАЦИИ
СЕМЕННИКОВ ПРИ ЭКСПЕРИМЕНТАЛЬНОЙ ПАТОЛОГИИ
ПЕЧЕНИ
Шаяхметов М.Ш., Шакирова С.М.
ФГБОУ ВПО Башкирский государственный аграрный университет, г.Уфа
Проблема воздействия агрессивных факторов на мужскую репродуктивную систему является актуальной, поскольку гипоталамогипофизарно-тестикулярная система обладает высокой чувствительностью к различным токсическим воздействиям 3]. Имеются сообщения о негативном влиянии хронического экспериментального поражения печени матери на структурно-функциональное становление
семенников потомства 1]. Было показано о значительном изменении
строения извитых семенных канальцев при интоксикации животных
гербицидом 2,4 - ДА 2, 5]. В этой связи дальнейшие исследования о
влиянии экотоксикантов на органы воспроизводства и особенности
восстановления данных органов после лечения животных является
актуальными.
В эволюции мужских гамет отбор действовал в направлении создания большей частью подвижных образований, что связано с необходимостью успешного отыскания яйцевой клетки и соединения с
ней в процессе оплодотворения. Задача эта решена путем сильного
уменьшения размеров, связанного обычно с утратой значительной
части цитоплазмы и наиболее экономной и компактной группировкой
всех основных компонентов клетки в единое целое, как бы в один пакет 4].
Эксперименты по интоксикации проводили на 32 самцах неинбредных крыс массой 180-200 г. Условия опыта были идентичны для
контрольных и опытных групп. Животные были разделены на 4 группы. 1 группа — контроль (интактные животные). У животных 2,3,4
групп развитие острого токсического гепатита вызывали однократным введением четыреххлористого углерода (50% раствор в оливковом масле в дозе 0,3 мл/кг). Через пять дней крыс 3 группы лечили в
течение 5 дней путем внутримышечной инъекции гептрала в дозе 0,1
мл/кг и микровитама в дозе 0,1мл/кг. Крыс 4 группы через 5 дней после интоксикации в течение 5 дней лечили гепалоном 0,1 мл/кг и
микровитамом в дозе 0,1мл/кг. Материал фиксировали в 12%-ном
водном растворе нейтрального формалина, срезы окрашивали гематоксилином - эозином и по Ван-Гизону. Для ультраструктурных
исследований проводили фиксацию в глутаровом альдегиде, дофиксацию в 1%-ном растворе четырехокиси осмия. Исследования проводили на электронном микроскопе JEM 100S.
У здоровых крыс извитые семенные канальцы имеют ровные
контуры. Сустентоциты (клетки Сертоли) в семенных канальцах выполняют опорную, трофическую, фагоцитарную функции и также
участвуют в формировании гематотостикулярного барьера. В связи с
большим количеством выполняемых функций, они характеризуются
наличием разнообразных органелл: рибосом, митохондрий, пластинчатого комплекса, лизосом. При активизации фагоцитарной функции
в сустентоцитах увеличивается количество фагосом и остаточных телец. В норме извитые семенные канальцы располагаются довольно
плотно друг к другу. Между канальцами в небольших пространствах
находятся элементы микроциркуляторного русла и оксифильно
окрашенные эндокриноциты Лейдига, характеризующиеся высоким
ядерно - цитоплазменным отношением.
У крыс второй группы интоксикация четыреххлористым углеродом вызывает токсический гепатит. Мы установили значительные деструктивные и некробиотические изменения в печени, которые сопровождаются нарушением процесса сперматогенеза в семенниках:
деформацию и разрывы стенок извитых семенных канальцах.
Уменьшается количество извитых канальцев в поле зрения, многие
имеют суженый диаметр. Деструктивный процесс наиболее выражен
в клетках сперматогенного эпителия, находящихся в фазе созревания
и формирования. Просветы семенных канальцев заполнены скоплением гипертрофированных оксифильных клеток, в которых наблюдается гомогенизация цитоплазмы и ядра.
У крыс третьей группы после лечения гептралом и микровитамом
мы наблюдали на светооптическом уровне в семенниках наряду с деструктивными изменениями ряд компенсаторно-приспособительных
процессов, которые в основном проявлялись в извитых канальцах.
Следует отметить, что около 15% канальцев имели интактное строение, в 20% канальцев сохранены деструктивные морфологические
изменения, как в семенниках крыс 2 группы. В отдельных извитых
канальцах наблюдали вакуолизацию клеток поверхностного слоя и
поддерживающих сустентоцитов, однако большинство клеток в
сперматогенном эпителии имели закономерную локализацию и
окрашивание. Просвет многих извитых семенных канальцев заполнен
клетками в результате их слущивания. В сперматогенном эпителии
увеличена доля клеток с пикнотичными ядрами. Представляет интерес наличие метафазных пластинок, что является свидетельством
восстановления сперматогенеза в клетках, локализующимся в зоне
размножения и роста. Следует отметить, что восстановление строения белочной оболочки семенника и эндокринных клеток происходит
относительно медленно. Отмечается нарушение плотности располо-
жения коллагеновых волокон относительно друг друга, а также
уменьшение количества фибробластов в интерстиции. При изучении
ультраструктуры семенников крыс после лечения гептралом и микровитамом в клетках сперматогенного эпителия наблюдается восстановление структуры ядра, в цитоплазме увеличивается содержание
полисом и митохондрий, многие имеющие интактное строение крист
и матрикса. Наиболее выражены процессы функциональной активизации в сустентоцитах. Они имеют крупные светлые ядра с деконденсированным хроматином и крупными ядрышками и большим числом
РНП-гранул. В цитоплазме увеличивается количество полисом, митохондрий, фагосом.
У крыс 4 группы после лечения гепалоном и микровитамом мы
наблюдали разнообразные морфологические варианты процессов
восстановления. Более четко восстановление процессов сперматогенеза осуществляется в сперматогониях и первичных сперматоцитах.
Вторичные сперматоциты, сперматиды и спермии в фазе созревания
и формирования отечные и оксифильные. Следует отметить, что в белочной оболочке семенника между коллагеновыми волокнами образуются щели различной ширины. Многие фиброциты пикнотичны. В
эндокриноцитах наблюдали резкое уменьшение размеров цитоплазмы
и ядра. В артериях, венах и микроциркуляторном русле гиперемия
сохранена. Ультраструктурный анализ показал в клетках сперматогенного эпителия увеличение количества полисом и митохондрий.
Однако в части митохондрий наблюдались деструктивные изменения.
В процессе спермиогенеза наблюдали компактизацию ядер и формирование аксонемы, в промежуточной зоне жгутика. Некоторые митохондрии имели нарушение ультраструктуры.
Микротрубочки в аксонеме окружены цитоплазмой низкой электронной плотности. В сустентоцитах в стенках извитых канальцев как
и у животных 3 группы наблюдается активизация функциональной
активности. Но некоторые из них перегружены деструктивными мембранными образованиями, крупными фагосомами и липофусцином.
Нами установлена корреляция восстановительных процессов в
семенниках с состоянием морфологии печени. Исследование структуры печени и семенников показало более высокую эффективность
применения гептрала в комплексе с микровитамом. Таким образом,
мы можем сделать заключение, что органы воспроизводства, чрезвычайно чувствительны к воздействию экотоксикантов.
Литература:
1. Брюхин, Г.В., Влияние хронического экспериментального поражения печени матери на струкутрно-функциональное становление
семенников потомства //Актуальные проблемы биологии и ветеринарной медицины мелких домашних животных [Текст]: мат. межд.
научно - практической конф. (Троицк). – Троицк, 2005 – С. 22 – 23.
2. Галимов, Ш.Н.Гормонально-метаболические механизмы нарушения мужской репродуктивной функции при экспериментальной
интоксикации диоксинсодержащим гербицидом 2,4 ДА [Текст]: Автореф. дис. докт. мед. наук. - Уфа, 2000. - 49с.
3. Никитин, А.Н. Вредные факторы среды и репродуктивная система человека (ответственность перед будущими поколениями)
[Текст]: - СПб.:ЭЛБИ – СПб., 2005. - 216с.
4. Соколов, И.И. Цитологические основы полового размножения
многоклеточных животных [Тескт]: - Руководство по цитологии, т.2,
Изд-во: Наука, Москва-Ленинград, 1966, с.390-461.
5. Шакирова, Г.Р., Имашев,А.В., Шакирова, С.М. Ультраструктура семенников крыс при интоксикации гербицидом 2,4 - ДА и лечении Т-активином и токоферолом //Интеграция аграрной науки и производства: состояние, проблемы и пути решения [Текст]: тез. докл.
Всерос. научно-практической конф. (Уфа). – Уфа, 2008. - Ч.9. -С.156.
УДК 636.2.082.2
ХАРАКТЕРИСТИКА ПРОДУКТИВНЫХ КАЧЕСТВ
КОРОВ ИМПОРТНОЙ СЕЛЕКЦИИ РАЗЛИЧНЫХ ЛИНИЙ
И.Ф. Юмагузин, И.Р. Сахаутдинов, А.Г. Уразбахтина
ГНУ Башкирский научно-исследовательский институт
сельского хозяйства Россельхозакадемии, г.Уфа
Любая порода скота – категория исторически сложившаяся и в
новых для себя экологических и кормовых условиях либо вырождается, либо приспосабливается к непривычным условиям, претерпевая
при этом определенные изменения в экстерьере, интерьере и хозяйственно-полезных признаках.
Важнейшими показателями успешной адаптации завезенного
скота из-за рубежа является его высокая продуктивность, осуществление нормальных воспроизводительных функций, приспособленность к интенсивной промышленной технологии и к местным климатическим условиям. Этими вопросами занимались многие ученые [И.
Калюжный, Н. Баринов, 2008; А. Кучеренко, 2009; Г. Шаркаева, 2010
и др.]. Однако в связи с резким увеличением завоза скота из регионов
России и из-за рубежа эти проблемы стали особенно острыми и значимыми. Завозу генетического материала извне должно предшествовать обоснование эффективности данного мероприятия с учетом финансовых, кормовых, трудовых, технологических и других ресурсов
хозяйства. Для увеличения валового производства молока в ГУСП
«Тавакан» Кугарчинского района Республики Башкортостан в декабре 2009 г. и январе 2010 г. из Словакии было завезено 386 нетелей
черно-пестрой голштинской породы. Технология эксплуатации коров
предусматривает беспривязное содержание, доение – в доильном зале. В комплексе используется оборудование фирмы DeLaval. Все технологические процессы автоматизированы и компьютеризированы,
управление системой осуществляется через главный процессор
ALPRO, туда же поступают все данные о животных. При исследовании племенных и продуктивных качеств завезенных животных были
использованы данные их племенных свидетельств.
Генеалогическая структура импортных нетелей представлена ведущими линиями голштинского скота:
 Уес Идеал 933122 – 67,3%;
 Рефлекшн Соверинг 198998 – 17,1%;
 Монтвик Чифтейн 95679 – 14,5%;
 Пабст Говернер 882933– 1,1%.
Средний возраст первотелок при первом отеле составил 26,4 месяцев при живой массе 480 кг.
Для характеристики продуктивных качеств женских предков были использованы абсолютные показатели по наивысшей лактации –
удой, содержание жира и белка в молоке, выход продукции молочного жира и белка, которые являются первостепенными признаками при
селекции скота (таблица 1).
Удой матерей завезенных нетелей составил в среднем 7744 кг при
выходе продукции молочного жира 322,6 кг и белка 253,4 кг. Продуктивность женских предков по отцовской стороне оказалась еще выше,
соответственно, 14663, 572,7 и 455,8 кг. Таким образом, приобретенное
поголовье крупного рогатого скота, судя по родословной, происходит
от женских предков по материнской и отцовской линии с высоким генетическим потенциалом продуктивности, а его реализация в полной
мере будет зависеть от условий кормления и содержания животных.
По результатам отчета о бонитировке КРС за 2010 г. средний
удой по стаду составил 5855 кг жирномолочностью 3,68% и белково-
молочностью 3,03%. Коэффициент молочности (удой на 100 кг живой
массы) в среднем по стаду составил 1130 кг, что является высоким
показателем для коров-первотелок.
Таблица 1 Продуктивность женских предков нетелей,
завезенных из Словакии
Статистические
Мать нетели
параметры
Признак
Кол-во животных с учтенной
продуктивностью
Удой
Содержание жира в молоке
Продукция молочного жира
Содержание белка в молоке
Продукция молочного белка
Мать отца
нетели
n, гол
245
218
Lim, кг
M+m, кг
CV, %
Lim, кг
M+m, кг
CV, %
Lim, кг
M+m, кг
CV, %
Lim, кг
M+m, кг
CV, %
Lim, кг
M+m, кг
CV, %
4920-12525
7744+77,9
15,7
2,93-7,19
4,19+0,040
14,8
146,6-570,8
322,6+4,03
19,6
2,80-3,79
3,28+0,010
4,7
159,1-388,3
253,4+2,36
14,6
8590-17538
14663+169,2
16,5
3,29-4,50
3,93+0,022
8,1
312,7-718,3
572,7+6,15
15,4
2,90-4,39
3,12+0,018
8,0
273,2-561,2
455,8+4,88
15,3
Молочная продуктивность первотелок в зависимости от их линейной принадлежности представлена в таблице 2.
Таблица 2. Распределение коров различных линий по продуктивности
Линейная
принадлежность
Рефлекшн Соверинг
Уес Идеал
Монтвик Чифтейн
Пабст Говернер
Количество,
гол
41
119
28
3
Удой, кг
Жир, %
Белок, %
6187+124,2
5782+69,1
5661+179,7
6023+300,2
3,66+0,007
3,69+0,006
3,68+0,012
3,70+0,010
3,01+0,003
3,04+0,006
3,04+0,003
3,03+0,005
Наибольшую молочную продуктивность (6187 кг) имели коровы
линии Рефлекшн Соверинг. Они с достоверностью превосходили животных линии Монтвик Чифтейна на 526 кг (p<0,05) и линии Уес
Идеала – на 405 кг (p<0,01). Коэффициент вариации по удою в линиях колебался от 9,1 до 18,8% и в среднем составил 15,4%, что харак-
теризует существенный разброс показателей по удою. Различия по
жирно- и белковомолочности между сравниваемыми линиями животных были незначительными и недостоверными.
Анализ сложившейся селекционно-генетической ситуации и
имеющихся ресурсов хозяйства свидетельствует о возможности в
ближайшие годы сформировать в данном хозяйстве высокоценное
маточное стадо голштинского черно-пестрого скота с удоем 8000 и
более кг молока. Это возможно при условии создания в хозяйстве
прочной кормовой базы (80-90 ц к.ед. на каждую корову и 23-25 ц
к.ед. на 1 среднегодовую ремонтную телку), при обязательном интенсивном выращивании ремонтных телок со среднесуточным приростом 750-850 г и путем проведения целенаправленной селекции животных по основным хозяйственно полезным признакам (удой, содержание жира и белка в молоке, живая масса животных, пригодность коров к машинному доению и др.).
Литература:
1. Калюжный, И., Здоровье импортных животных спустя пять месяцев [Текст]/И.Калюжный, Н. Баринов//Животноводство России. –
2008. - №3. – С. 6-8.
2. Кучеренко, А. Ошибки при закупке импортного скота [Текст]:
Животноводство России. – 2009. - №3. – С. 6-7.
3. Шаркаева, Г. Племенные ресурсы импортного скота в Российской Федерации [Текст]: Молочное и мясное скотоводство. – 2010. №4. – С. 5-7.
УДК 636.2.053.03
ВЛИЯНИЕ ГЕНОТИПА НА МЯСНУЮ ПРОДУКТИВНОСТЬ
МОЛОДНЯКА КРУПНОГО РОГАТОГО СКОТА
Якупова Д.Р.1, Петрухина Е.А.2
1
ФГБОУ Башкирский государственный аграрный университет,г.Уфа
2
ФГБОУ Волгоградский государственный аграрный университет,
г. Волгоград
Изыскание резервов увеличения производства говядины является
одной из важнейших задач агропромышленного комплекса России. В
решении этой задачи значительная роль отводится повышению эффективности использования имеющихся породных ресурсов крупного рогатого скота. Это, прежде всего, касается черно-пестрой породы,
которая в нашей стране получила широкое распространение. В последние годы для улучшения технологических качеств животных
этой породы интенсивно используется голштинская [3].
С целью оценки влияния проводимой голштинизации на мясную
продуктивность нами был проведен научно-хозяйственный опыт в
СПК «Базы» Чекмагушевского района республики Башкортостан.
Объектом исследования явились бычки, которых сформировали в три
группы. В первую группу входили чистопородные животные, во вторую – полукровные помеси и в третью – помеси III поколения по
голштинской породе. Все опытное поголовье молодняка содержали
по технологии ручной выпойки до 6-месячного возраста, после чего
они были переведены на откормочную площадку до завершения откорма. Условия кормления и содержания животных были идентичными в соответствии с методикой оценки по собственной продуктивности на основе рационов, принятых в хозяйстве.
После завершения откорма был проведен контрольный убой трех
бычков из каждой группы (таблица 1). В результате убоя животных,
оцениваемых генотипов, были получены тяжеловесные туши.
Данные табл. 1 свидетельствуют о превосходстве помесного молодняка над чистопородным по основным рассматриваемым показателям. Так, бычки III группы превосходили своих сверстников из I и
II групп по предубойной массе на 44,3 (Р>0,999) и 22,3 кг соответственно. По массе парной туши установлено преимущество молодняка III группы над I в 30,7 кг (10,6%, Р>0,999), над II – 11,7 кг (4,1%).
Таблица 1 Результаты контрольного убоя бычков в возрасте 18 мес
Показатель
I
471,7±6,01
258,0±3,21
54,7±0,41
Предубойная живая масса, кг
Масса парной туши, кг
Выход туши, %
Масса внутреннего жира19,3±0,33
сырца, кг
Выход внутреннего жира4,1±0,08
сырца, %
Группа
II
III
493,7±12,99
516,0±6,08***
277,0±6,43
288,7±3,53***
56,1±0,34
55,9±0,08**
18,7±0,33
17,7±0,88
3,8±0,03
3,4±0,15
Убойная масса, кг
277,3±3,48 295,7±6,74
Убойный выход, %
58,8±0,48
59,9±0,36
Примечание * - Р>0,95; ** - Р>0,99; *** - Р>0,999
306,3±4,26**
59,4±0,22
В то же время чистопородные животные по выходу внутреннего
жира-сырца опережают бычков из II группы на 0,3% и III – на 0,7%.
По убойному выходу животные I группы уступали помесям первого и третьего поколения на 1,1 и 0,6 % соответственно.
Качество мяса во многом обусловлено химическим составом
мышечной ткани (табл. 2) [1].
Таблица 2 Химический состав и энергетическая ценность мяса
Показатель
Сухое вещество, %
в т.ч. протеин, %
жир, %
зола, %
Энергетическая ценность 1 кг
мякоти, МДж
I
31,6±0,48
18,3±0,15
12,5±0,38
0,9±0,05
Группа
II
30,9±0,47
18,3±0,50
11,6±0,09
0,9±0,03
III
31,9±0,49
18,8±0,33
12,1±0,14
1,0±0,04
7,9±0,17
7,7±0,07
7,9±0,11
Данные таблицы 2 свидетельствуют, что по содержанию сухого
вещества незначительное преимущество имели бычки с большей степенью кровности по голштинской породе. Так, их превосходство по
данному показателю над молодняком черно-пестрой породы составляло 0,26 %, над полукровными помесями – 1,03%. Бычки II и III
групп превосходили животных I по содержанию протеина на 0,09 % и
0,42 %. А вот по жироотложению чистопородный молодняк на 0,32 –
0,83% превосходит помесных сверстников. По энергетической ценности предпочтительнее была говядина от чистопородных животных
[2]. Так они превзошли по данному показателю помесей II поколения
на 3,88 %, III – на 0,50 %.
Для характеристики биологической ценности говядины был
определен аминокислотный состав (таблица 3).
Таблица 3 Биологическая полноценность длиннейшей мышцы спины
Показатель
Триптофан, мг/%
Оксипролин, мг/%
I
338,74±5,72
55,10±1,65
Группа
II
352,10±2,54
56,96±2,28
III
342,34±7,81
53,46±2,47
Данные таблицы 3 свидетельствует, что по триптофану полукровные бычки превосходили чистопородных на 13,36 мг/% (3,79 %)
и помесей третьего поколения – 9,76 мг/% (2,85 %). Оксипролина
больше содержалось в мякоти молодняка II группы, чем в I и III на
1,86 мг/% (3,27 %) и 3,50 мг/% (6,14 %) соответственно. В тоже время
голштинизированные животные третьего поколения характеризовались наибольшим значением белкового качественного показателя –
6,44, за счет меньшего содержания оксипролина.
Контроль экологической чистоты мяса проводили методом атомно-абсорбционной спектрофотометрии в лаборатории ВНИИМС по
всем основным загрязнителям: тяжелым металлам, радионуклидам,
остаточному количеству пестицидов, антибиотикам, токсинам плесневых грибов в соответствии с ГОСТами. Анализ полученных данных
свидетельствует, что во всех группах концентрация тяжелых металлов не превышает ПДК (предельно допустимых концентраций).
Таким образом, проводимая голштинизация черно-пестрого скота
в СПК «Базы» повышает мясную продуктивность, не оказывая, при
этом, отрицательного влияния на экологическую безопасность продукции.
Литература:
1 Косилов, В.И. Мясные качества черно-пестрого и симментальского скота разных генотипов [Текст]/ В.И. Косилов и [др]. – Оренбург: Издательский центр ОГАУ, 2006. – 196 с.
2 Тагиров, Х.Х. Учено-методическое пособие по проведению
научно-исследовательских работ в скотоводстве [Текст]/ Х.Х. Тагиров, Р.С. Гизатуллин, Т.А. Седых. – Уфа: БГАУ, 2006. – 80 с.
3 Шакиров, Р.Р. Продуктивные качества молодняка чернопестрой породы и ее голштинизированных помесей [Текст]/ Р.Р. Шакиров, Р.Ш. Давлетов, Х.Х. Тагиров. – Уфа: ПЛ-1, 2005. – 134с.
СОДЕРЖАНИЕ
Лебедева Л.Ф. Состояние и перспективы технологии трансплантации
эмбрионов в коневодстве .............................................................................. 3
Терлецкий В.П., Доронин Д.О., Тыщенко В.И., Вахрамеев А.Б Аллельные варианты генов, контролирующих хозяйственно-полезные
признаки у кур генофондных пород ............................................................ 6
Терлецкий В.П., Крутикова А.А., Никиткина Е.В., Доронин Д.О., Тыщенко В.И. Выявление микроплазменной инфекции у лошадей методом полимеразной цепной реакции ....................................................... 10
Храброва Л.А. Использование генетических маркеров в селекции лошадей.....13
Абдулгазина Н.М., Сафаргалин А.Б., Юмагужин Ф.Г. Зависимость каталазной активности ректальных желез у медоносных пчел от длины и веса прямой кишки ............................................................................. 17
Абдуллина Г.Г., Талипов А.Н., Юмагужин Ф.Г. Новые технологии по
замене пчелиных маток ............................................................................... 21
Алимгафаров В.В., Лукманов С.М. Анализ воспроизводства крупного
рогатого скота симментальской породы австрийской селекции
ООО ПХ «Артемида» .................................................................................. 23
Базекин Г.В., Исмагилова А.Ф. Влияние глицирризиновой кислоты на
ветеринарно-санитарные показатели мяса во время хронический
интоксикации фосфорорганическими соединениями ............................. 26
Баишева Г.А., Андреева А.В. Коррекция микробиоценоза кишешника
поросят в ранний постнатальный период как биотехнологический
прием профилактики желудочно-кишечных заболеваний ..................... 29
Баишева Г.И, Андреева А.В. Особенности технологии выращивания
свиней в Дании............................................................................................. 33
Баймишев М.Х., Пристяжнюк О.Н. Профилактика послеродовых
осложнений у коров в условиях интенсивной технологии производства молока ............................................................................................. 36
Балхиева Л.Х., Табанакова Т.М., Хисматуллина З.Р., Мусина Л.А.
Структурная организация сетчатки глаз крыс линии WAG/Rij,
имеющих различия генотипа по локусу Таg1А DRD2............................. 39
Башаров А.А., Хазиахметов Ф.С. Применение пробиотиков на основе
штаммов BACILLUS SUBTILLIS в рационах телят ................................ 42
Бекашева И.В., Мартынов А.Н., Турков В.Г. Неадьювантная химиотерапия рака молочной железы третьей стадии кошек ............................... 45
Вагапов Ф.Ф., Ибатова Г.Г. Естественная резистентность молодняка
крупного рогатого скота при использовании пробиотической кормовой добавки .............................................................................................. 48
Валитов Ф.Р., Ильясова Э.И., Долматова И.Ю. Иммуногенетическая
характеристика разных пород крупного рогатого скота Республики
Башкортостан ............................................................................................... 51
Гайнуллина К.П., Юнусова Л.Н., Юрьева А.А. Изучение полиморфизма микросателлитных локусов лошадей башкирской породы ............... 54
Гадиев Р.Р., Фаррахов А.Р., Галина Ч.Р. Межпородное скрещивание –
основа повышения продуктивности гусей ................................................ 56
Гадиев Р.Р., Михайлова О.Л.Сапропель в рационах утят ............................ 60
Галлямова А.Р., Гумеров У.Р., Исламова С.Г. Рост, развитие молодняка крупного рогатого скота различных генотипов каппа-казеина ......... 63
Ганиева И.Н., Долматова И.Ю. Оценка генетического разнообразия
внутрипородных линий пекинских уток по данным полиморфизма
митохондриальной ДНК ............................................................................. 65
Гареева И.Т., Долматова И.Ю. Межпородные различия по частотам
аллелей гена В-лактоглобулина (LGB) у коров черно-пестрой, бестужевской и симментальской пород ......................................................... 69
Говорливых А.С., Валитов Ф.Р., Каримова С.Г. Сравнительная характеристика роста и развития гибрида стерляди и калуги ......................... 72
Гребенькова Н.В. Формирование, периодизация и критические фазы
развития матки коров в пренатальном онтогенезе .................................. 75
Гребенькова Н.В., Сковородин Е.Н. Развитие матки и яичников коров
в постнатальном периоде онтогенеза в норме и при патологии ............ 78
Гумеров У.Р., Исламова С.Г. Воспроизводительные качества коров в
связи с антигенным составом эритроцитов крови ................................... 81
Давлетова В.Д. Влияние препарата солмивин селен на воспроизводительную способность мускусных уток, рост и развитие утят ................ 83
Дмитриева Т.О. Профилактика акушерской патологии у высокопродуктивных коров в сухостойный период .................................................. 84
Дюдьбин О.В. Селен в птицеводстве .............................................................. 87
Ильясов А.Г., Долматова И.Ю. Сравнительный анализ генетической
структуры по полиморфным белкам и ферментам крови у лошадей
башкирской и русской тяжеловозной пород ............................................ 89
Ильясова Э.И., Валитов Ф.Р., ДолматоваИ.Ю., Ильясов А.Г. Сравнительная характеристика генофонда черно-пестрой и симментальской пород крупного рогатого скота Республики Башкортостан по
группам крови .............................................................................................. 93
Исмагилова Э.Р., Ибрагимова Л.Л. Влияние гомеопатического препарата
«Фоспасим» на репродуктивные качества кроликоматок при стрессе ...... 96
Кацараба О.А. Гормональный профиль организма мясных коров при
гипофункции яичников ............................................................................... 99
Каюмова Г.Р., Якупова Д.Р. Рост и развитие трансплантированных
телят голштинской породы в условиях ООО «Алатау» Кармаскалинского района ......................................................................................... 103
Кононенко Т.В., Долматова И.Ю. Генетический полиморфизм гена
тиоэстеразы синтазы S – ацил жирных кислот (S-AFAST) уток.......... 105
Лукманов С.М. Современные методы воспроизводства стада .................. 109
Лыткина Д.Ю., Уколов А.В., Герасимова Л.В. Перспективы использования искусственного осеменения песцов и лисиц в Республике
Башкортостан ............................................................................................. 113
Макулова А.Б., Карнаухов Ю.А. Воспроизводительная способность
чистопородных и помесных телок ........................................................... 116
Мартынова Ю.С., Мартынов А.Н., Турков В.Г., Сапронова С.Г. Лечебная тактика при диабетическом кетоацидозе на фоне етэструсассоцированного сахарного диабета у сук .............................................. 118
Малофеев А.А., Метальникова Д.В., Хохлов Р.Ю. Изучение действия
монохроматического освещения на рост сердца куриных эмбрионов .. 121
Мартынов А.Н., Турков В.Г. Влияние новообразований в тканях молочной железы у сук на гомеостаз ........................................................... 124
Метальникова Д.В., Малофеев А.А., Хохлов Р.Ю. Динамика количества эритроцитов в крови куриных эмбрионов при воздействии отрицательных аэроионов ............................................................................ 127
Миронова И.В., Масалимов И.А. Качество шкур бычков бестужевской
породы и их помесей с салерс и обрак .................................................... 131
Мифтахутдинов А.В. Оценка показателя тонической неподвижности
кур при изучении стрессовой чувствительности кур ............................ 135
Мурдашов Р.Р., Ахметгариев М.Ф., Шамсутдинов Д.Х., Шайхутдинова А.З. Особенности строения волосяного покрова в процессе адаптации животных герефордской породы австралийской селекции ......... 138
Разяпов М.М., Фазлаев Р.Г. Патогистологические изменения в печени
и почках кроликов при псороптозе.......................................................... 141
Ракина Ю.А., Валитов Ф.Р., Долматова И.Ю. Влияние полиморфизма генов молочных белков на молочную продуктивность коров
черно-пестрой и бестужевской пород ..................................................... 144
Рахимкулова Г.Р., Мударисов Р.М. Продуктивное долголетие коров
голштинской породы в условиях ГУСП совхоз «Алексеевский» ........ 147
Самойлов Ю.И., Лукманов С.М. Воспроизводительная функция крупного рогатого скота черно-пестрой голштинской породы ООО ПХ
«Артемида» ................................................................................................ 150
Сатарова А.А., Шелехов Д.В., Смольникова Е.В. Улучшение хозяйственно-полезных признаков медоносных пчел .................................... 153
Сачук Р.Н. Новые подходы к лечению мастита у крольчих породы Белый великан ................................................................................................ 157
Сахаутдинов И.Р., Исламова С.Г., Муратова Л.М. Воспроизводительные качества импортных коров в условиях Зауралья Республики Башкортостан ........................................................................................ 160
Сахаутдинов И.Р., Исламова С.Г., Муратова Л.М. Молочная продуктивность коров зарубежной селекции в условиях Зауралья Башкирии .. 162
Сахаутдинов И.Р., Исламова С.Г., Муратова Л.М. Потомство австрийских симменталов в новых эколого-климатических и хозяйственных условиях .................................................................................... 165
Слинкин А.А., Юмагузина Э.Э., Уразбахтин Р.Ф. Исследование параметров молочного типа лошадей башкирской породы в условиях
круглогодового табунного содержания .................................................. 168
Смирнова Е.В. Использование этологических индексов в оценке воспроизводительной функции молочных коров ........................................ 170
Тагиров Х.Х., Вагапов Ф.Ф., Ибатова Г.Г. Экологическая безопасность говядины при включении добавки «Биогумитель» в рацион
молодняка крупного рогатого скота ........................................................ 173
Фисенко Н.В., Гимранов В.В. Влияние пробиотика «Ветоспорин» на
иммунобиологические показатели у бычков ......................................... 175
Хабибуллин Р.М., Фазлаева С.Е. Воспроизводительные показатели
мышей при применении овесола и пантокрина ..................................... 177
Хабибуллина Г.С., Герасимова Л.В. Использование БАД в кормлении
цыплят-бройлеров ..................................................................................... 179
Хайруллина Л.Ш., Гадиев Р.Р. Использование Нупро в перепеловодстве ... 181
Хисматуллина З.Р. Участие структур головного мозга в репродуктивных функциях организма .......................................................................... 183
Царева Е.А., Кузнецов С.И., Литвинова В.В. Секреторная активность
щитовидной и поджелудочной желез цыплят-бройлеров в условиях
искусственной ионизации воздуха .......................................................... 187
Царева Е.А., Кузнецов С.И. Влияние аэронизации на развитие и физиологический статус цыплят-бройлеров ............................................... 190
Чудов И.В., Исмагилова А.Ф. О возможности фармокологической стабилизации процессов перекисного окисления липидов с применением метилового эфира кетотретракарбоновой кислоты ..................... 193
Шаев Р.К.. Багманов М.А. Лечебная эффективность биогенных стимуляторов «ЭПЛ» и «ПДЭ» при некоторых формах мастита у лактирующих коров ........................................................................................ 198
Шаяхметов М.Ш., Шакирова С.М. Оценка восстановления структурной организации семенников при экспериментальной патологии
печени ......................................................................................................... 201
Юмагузин И.Ф., Сахаутдинов И.Р., Уразбахтина А.Г. Характеристика
продуктивных качеств коров импортной селекции различных линий .. 205
Якупова Д.Р., Петрухина Е.А. Влияние генотипа на мясную продуктивность молодняка крупного рогатого скота ....................................... 208
Научное издание
СОВРЕМЕННЫЕ ОСНОВЫ
РАЦИОНАЛИЗАЦИИ
ТЕХНОЛОГИИ ВОСПРОИЗВОДСТВА
СЕЛЬСКОХОЗЯЙСТВЕННЫХ ЖИВОТНЫХ
В УСЛОВИЯХ ИНДУСТРИАЛЬНОЙ
СИСТЕМЫ ПРОИЗВОДСТВА В АПК
Материалы
всероссийской молодежной научной школы
в рамках Федеральной целевой программы
«Научные и научно-педагогические кадры
инновационной России» на 2009-2013 годы
(Уфа, Россия, 11-14 сентября 2012 г.)
Печатается в авторской редакции
Технический и художественный редактор Н.А. Николаенко
Подписано в печать 13.08.2012. Формат бумаги 60×841/16. Усл. печ. л. 12,56
Бумага офсетная. Гарнитура «Таймс». Печать трафаретная. Заказ 376. Тираж 70 экз.
–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Типография ФГБОУ ВПО «Башкирский государственный аграрный университет»
450001, г. Уфа, ул. 50-летия Октября, 34
Скачать

Сборник материалов научной школы