Транспорт полной последовательности
кодирующей дистрофин в мышечные клетки при
помощи высоко-вместительного гибридного
вирусного вектора с сайт- специфичекими
интегративными возможностями.
1.
2.
3.
4.
5.
6.
7.
8.
9.
Manuel A. F. V. Gonçalves1,*,
Gijsbert P. van Nierop1,
Marloes R. Tijssen1,
Pierre Lefesvre2,
Shoshan Knaän-Shanzer1,
Ietje van der Velde1,
Dirk W. van Bekkum2,
Dinko Valerio1, and
Antoine A. F. de Vries1
+ Author Affiliations
1.
2.
1
2
Gene Therapy Section, Department of Molecular Cell Biology, Leiden University Medical Center
Crucell N.V., Leiden, The Netherlands
Миодистрофия Дюшена вызвана мутациями в гене дистрофина, что определяет цель для генной
терапии. Однако, не многие векторы могут переносить 14-kb кДНК в мышечную ткань in vivo или
пролифирирующую мышечную ткань in vitro для дальнейшей трансплантации. Был представлен метод
использования двойного высоко-вместительного аден-ассоциированного вектора (hcAd/AAV, который
переносит две последовательности для синтеза полного дистрофина. Вектор генерирован при помощи
вводной линейной молекулы ДНК первично репликацированной и упакованной в Ad капсид. После
инфицирования клеток Ad вектором, репликации вирусной ДНК, клетки заражают ААV вирусом с
конечным терминальным повтором(ITR) , вирусная ДНК репливируется, ДНК упаковывается в вирусный
капсид. Такие двойные гибридные вектора используются для экспрессии дистрофина в кардиомиоцитах in
vitro и восстановления синтеза дистрофина в мышечных тканях mdx мышей in vivo. Введение в
человеческие клетки данного генома может быть особенно полезно для лечения таких болезней как
миодистрофия Дюшена
Летальная Х-сцепленная рецессивная миодистрофия Дюшена- наиболее часто встречающееся
мышечное заболевание, встречающееся с частотой 1:3500 новорожденных мальчиков. Миодистрофия
Дюшена обусловлена мутацией гена белка дистрофина 427-kDa. В нормальных миофибриллах дистрофин
крепит внутренний цитоскелет к мембране (4).Отсутствие такой связи в дистрофин-дефицитных волокнах
способствует повреждению сарколеммы при механическом напряжении. Поврежденные мышечные клетки
реплицируются при помощи спутниковых клеток. Истощение пула спутниковых клеток приводит к
замещению мышечной ткани жировой и соединительной тканью. Что обуславливает значительное
снижение мышечной функции примерно в возрасте 12 лет, а после 20 лет нарушение дыхательной и
сердечной функции.
Хотя соматическая генотерапия может потенциально ликвидировать причину рецессивных
моногенетических нарушений, поставляя функциональные копии дефектных генов в пораженные клетки,
генетическое лечение миодистрофии представляет собой проблему из-за большого размера гена (14 КБ),
а так же большого объема мышц. На данный момент происходит разработка стратегий системной
поставки в естественных условиях или улучшение векторов для переноса генов или пересадка клеток с
миогенным потенциалом. Одновременно, разрабатывается рекомбинантный генетический код
микродистрофина, стремящийся к максимальной функциональности и минимальному размеру для
переноса в вирусным вектором, таких как аден-ассоциированнный вирус или ретровирусы. (45). Недавние
исследования у трансгенных мышей предполагают, что микродистрофин мог бы быть эффективным в
предупреждении повреждения мышц, хотя он не приводит к полному восстановлению мышц.(21).
Кроме того степень, до которой микродистрофин спасает страдающий дистрофией фенотип у более
крупных животных и людей, неизвестна. Векторы AAV тем не менее обещают быть эффективным
средством переноса генов, потому что они могут преобразовать неделящиеся клетки, и достигнуть
долгосрочной трансгенной экспрессии в иммунокомпетентных моделях животных человеческих болезней,
таких как мышечные дистрофии (18, 21).Эти векторы основаны на дефектном не патогенном человеческом
вирусе, который может встраивать свой геном в пораженные участки генома. (30, 43,29). Интеграция в 19
локус этой хромосомы зависит от взаимодействия AAV Rep78 или Rep68 с специфическим сайтом в
повторяющейся последовательности AAV (ITRs) (7, 33),недавно идентифицированном элементе
эффективной интеграции (p5IEE) (38, 39) что совпадает с промотером AAV на карте в 5 позиции (p5)
(33), и в локусе AAVS1 (54).
Эта особенность AAV уникальна среди всех известных вирусов эукариот и его использование
значительно улучшает
интеграцию и устойчивую экспрессию терапевтической ДНК. Однако,
инкорпорация определенной сайт-специфической ДНК в обычные векторы AAV уменьшила бы их уже
ограниченную способность кодирования, таким образом требуя использования еще меньшего
микродистрофина для генотерапии миодистрофии Дюшена, который вряд ли будет эффективен.
Альтернативный маршрут
генотерапии МДД - развитие улучшенного аденовируса высокой
вместительности (hcAd), который не только разрешит поставку комплементарной ДНК во всю длину и
таким образом синтез абсолютно функционального дистрофина, но также и включение генетических
элементов для увеличения синтеза. С тех пор hcAd векторы сохраняют только сигналы, вовлеченные в
реплекацию ДНК и инкапсуляцию, остальные функции возлагаются на
упаковочно-дефектные Аd
векторы , обеспечивающие
неструктурные и структурные белки. hcAd векторы сохраняют
непревзойденную эффективность переноса генов в делящиеся и неделящиеся клетки, но испытывают
недостаток в вирусных генах, которые делают их более безопасными, и лучше приспособленными для
длительной трансгенной экспрессии (28).Эти атрибуты продолжают изучаться.(36, 44, 51). Недавно был
разработан двойной hcAd вектор путем упаковки в Ad капсид молекулярно клонированный тандем двух
участков ДНК, содержащих промотер CAG. В настоящее время эта конструкция обладает наибольшей
экспрессией в скелетных мышцах mdx мышей (11, 12). Однако ДНК доставленная Ad вектором не может
длительно корегировать генетический дефект, как стволовые клетки (34, 25, 42, 46). Терапевтическое
применение этих клеток как источник пересаживаемых аутогенных миогенных клеток потребует их
постоянной генетической модификации. Это может лучше всего быть достигнуто через трансгенную
интеграцию в хромосомную ДНК. Предпочтительно, интегрированная ДНК не должна содержать
генетические элементы с активностью промотора направленной наружу, как существующим в
ретровирусных длинных терминальных повторениях, чтобы избежать активации онкогенов. Идеально,
интеграция должна предназначаться для предопределенного места в человеческом геноме, чтобы
уменьшить риск инсерционного мутагенеза.
Мы описываем здесь новую hc вирусную векторную систему, которая усиливает эффективность hcAd
векторов, обеспечивая их способностью к сайт специфической интеграции чужеродной ДНК и
удваивоению числа трансгенных копий, упакованных в каждой частице. Используя эти так называемые
двойные hcAd/AAV гибридные векторы, эффективную поставку и экспрессию человеческой
последовательности кодирующей дистрофин во всю длину, мы обрабатывали крысиные кардиомиоциты
с достижением эффекта. Далее мы обнаружили синтеза белка дистрофина во всю длину в комбаловидных
мышцах mdx мышей в естественных условиях. Наконец, в доказательство провели эксперимент с
человеческими клетками, мы продемонстрировали, что двойные hcAd/AAV гибридные векторы могут
использоваться, вместе с AAV Rep78 и Rep68, для доставки чужеродной генетической информации в
локус AAVS1.
Материалы и методы
Рекомбинантная ДНК. Получение рекомбинантной ДНК было выполнено согласно инструкции с
использованием специфических реагентов.(41). Все hc векторные шаблоны ДНК были вставлены в
pBR322-производный вектор клонирования. Во-первых, плазмида pBR-HD-RE1.d5 была сделана. Эта
конструкция содержит нуклеотиды 1 - 454 из серотипа человека Эда 5 геномов (Ad5). Эта 454-bp область
охватывает левый ITR плюс и была амплифицирована (15). . Эти последовательности сопровождаются
серотипом AAV 2 (AAV2) от положений 153 - 300 нуклеотида, которые охватывают p5IEE и p5
промоторы. Эта 147-bp последовательность была получена посредством
ПЦР усиления
при
использовании
pBR.RepCap.
TAA-не
как
шаблон
и
PR127
(5′CCATCGATTGGAGTCGTGACGTGAATTACGTCATAGGGTTAGGGAGGTCCTGTATT AGAGGTCACG3′) и PR128 (5′-CCACTAGTCCCGCTTCAAAATGGAGACC-3′) Плазмида pBR.RepCap.TAA-Not содержит
остаток 191 от 4492 дикого типа генома AAV2 , но имеет кодон ATG в позиции 321замененный при
помощи остановки кодона TAA. Конец p5 последовательности ошибка региона Ad5 позиции нуклеатидов
от 35533 до 35938. Эта 405-bp 3′-терминальная некодирующая последовательность включает
исправленный регион Ad5 ITR и была амплифицирована ПЦР с использованием pWE/AflIIrITR.pac.Rfib5 (26), вместе с PR25 (5′-GCCACTGCAGCCTTACCAGTAAAAAAGAAAAC-3′) and PR26 (5′ACCTGGGCCCATCATCAATAATATACCTTA). ПЦР амплификация Ad и AAV cis-acting элементов
выполнена с использованием платинового Taq DNA Polymerase High Fidelity (Invitrogen), и отсутствие
мутаций в ПЦР амплифицированных последовательностях подтверждено ДНК секвенированием. В
последующем плазмида pBR/NC-RE1.d5 получена при использовании pBR/HD-RE1.d5 с заменой 405bp 3′-терминальной последовательности Ad5 фрагментом ДНК содержащим 145-bp AAV2 ITR. Позже
ДНК была получена из pAAV/AdTRΨ.5 (15). В последствие фрагменты содержащие ген промотер
человеческого 1α (EF1α) фактора из pEFO (подарок L.-M. Houdebine [48]), полилинкер and the ген βглобина кролика pA из pCAGGS ( любезно предоставленный J.-i. Miyazaki [35]) был клонирован p5IEE и
3′ Ad ITR в pBR/HD-RE1.d5 и p5IEE и AAV ITR в pBR/NC-RE1.d5. Этот маневр проведен с
конструкциями pBR/HD-RE1.EF и pBR/NC-RE1.EF, соответственно. Следующим шагом стало очишение
EGFP-дистрофин ORF при помощи pDysE (предоставленный J. Tremblay [6]) и вставленный в
полилинкер обеих pBR/HD-RE1.EF и pBR/NC-RE1.EF, pAd.eDYS и pAd/AAV.eDYS, соответственно.
Челночная плазмида
pAd.DsRed и pAd/AAV.DsRed получены из pAd.eDYS и pAd/AAV.eDYS,
соответственно, при помощи замены EGFP- кодирующей последовательности ДНК EGFP-дистрофин
фрагментом содержащим красный флюоресцентный протеин (DsRed) ORF и обезьяний вирус 40 (SV40)
pA. Фрагменты получены из pDsRed.T4-N1 (предоставленный B. Glick [3]). В итоге плазмиды pAd.EGFP
и pAd/AAV.EGFP получены из pAd.eDYS и pAd/AAV.eDYS, соответственно, при помощи замены EGFP
кодирующего участка ДНК EGFP-дистрофина с фрагментом содержащим EGFP ORF и ген
человеческого гормона роста pA. EGFP ORF принесенная плазмидой pEGFP (Clontech), в то время как
человеческий гормон роста pA получен из конструкции pEFO. Конструкция pKS.P5.Rep содержала
AAV2 rep под контролем эндогенных промотеров и следовательно Rep78, Rep68, Rep52, и Rep40 белков.
Плазмида pGAPDH.Rep78/68 направляла синтез только Rep78 и Rep68, поскольку есть нововведение в
геноме AAV2 в позиции 993 триплет GGG в месте Rep52 и Rep40. Ген промотер человеческой
глицералделегид 3-фосфат дегидрогеназы был получен из плазмиды pGAP489CAT (предоставленной S.
Yanagisawa [1]). Полная нуклеотидная последовательность всех конструкций были доступны по
требованию.
Клетки. Условия роста для клеток человеческого цервикального рака (HeLa) были ранее описаны. (16).
Культуры кардиомиоцитов новорожденной крысы были любезно предоставлены А. ван дер Лаарсом.
Процедуры по обслуживанию этих культур описаны в другом месте. (52). Все клетки сохранялись в
увлажненном воздухе 10% CO2 и 37°C.
Первое поколениеAd векторов. Производство, очистка, и титрование векторов Ad floxedΨ и Ad ΔE1.
EGFP с удаленным E1 были детализированы в другом месте (16, 17).
Испытание упаковки hc векторной ДНК, кодирующей красный флуоресцентный белок. Четыре миллиона
PER.tTA.Cre76 клеток в питательной среде (DMEM; Invitrogen) с 10%-ой эмбриональной бычьей
сывороткой (FBS; Invitrogen), и 10мМ MgCl2 были отобраны на шесть пластин (Greiner). Впоследствии,
монослои были инфицированы вирусом в трех экземплярах 2.5 мкг pAd/AAV.DsRed или 2.5 мкг
pAd/AAV.DsRed и 0.5 мкг плазмиды экспрессии AAV pKS.P5.Позитивные контрольные образцы
состоявшие из PER.tTA.Cre76 клеток, инфицированы 2.5 мкг одной только обычной
hcAd векторной плазмидой pAd.DsRed или вместе с 0.5 мкг pKS.P5.Rep. Приорететные
для трансфекции, pAd/AAV.DsRed и pAd.DsRed. были обработаны MssI (Fermentas),
сопровождаемый инактивацией фермента рестрикции в течение 15 минут при 65°C. Перед добавлением к
клеткам плазмиды были разбавлены в DMEM до объема 100 мкл. Затем раствор ДНК был смешан с 100
мкл катионной липосомной суспензии, состоящей из 10 мкл Lipofectamine (Invitrogen) и 90 мкл DMEM.
Липосомным ДНК комплексам позволили сформироваться при комнатной температуре в течение 30
минут. Тем временем монослои были ополоснуты 1 мл DMEM. Впоследствии, липосомные ДНК
комплексы были разбавлены в DMEM к заключительному объему 1 мл и добавлены к вымытым клеткам.
После 3-ех часового инкубационного периода в 37°C,добавлен 1 мл DMEM, содержащего с 20%-ым FBS и
20 мМ MgCl2,. После ночной инкубации питательная среда трансфекции была заменена новым DMEM,
содержащим 10%-ый FBS, 10 мМ MgCl2, и Ad.floxedΨ. После инкубации в течение 5 часов при 37°C, был
удален прививочный материал, и добавлено 3.5 мл DMEM, с 10%-ым FBS и 10 мМ MgCl2. После
обнаружения полного цитопатического эффекта (CPE), приблизительно через 72 часа после инфекции
(p.i). Клетки были собраны и подверглись трем циклам замораживания (ванна жидкого азота) и
размораживание (37°C водяная баня). Затем, продукты распада клеток были центрифугированы при 208
× г в течение 10 минут, и разъяснены фильтрацией через 0.45-μm-pore-size, MILLEX-ХА (Millipore).
Полезные действия переноса генов DsRed были определены проточными цитофотометриями следующим
образом. Клетки HeLa были отобраны по 105 клеток на 24 - хорошо пластины (Greiner). После ночной
инкубации сливные слои клеток получили 500 мкл пятикратных последовательно разбавленных лизатов.
Два дня спустя клетки были проанализированы на экспрессию DsRed при использовании счетной камеры
потока FACSort (Becton Dickinson). Во всех случаях был проведен анализ при использовании
программного обеспечения CellQuest (Бектон Дикинсон Иммунокитометри Системс). Действия переноса
генов были вычислены из линейного диапазона кривых реакции дозы. Зараженные клетки HeLa
использовались, чтобы определить второстепенные интенсивности сигнала.
Распространение, и определение количества двойных hcAd/AAV гибридных векторов, кодирующих
белок EGFP-дистрофин. Двойные hcAd/AAV.eDYS частицы были амплифицированы последовательным
размножением на культуре PER.tTA.Cre76 клеток. Начальное шаги по освобождению и сбору(определял
P0) были выполнены с MssI-линеаризовавшим pAd/AAV.eDYS тем же самым методом что и при
получении DsRed-кодирующих hc векторов. Затем, одна десятая основного hcAd/AAV.eDYS была
смешана с новой питательной средой и добавлена к 5.0 × 10^6 недавно отобранных PER.tTA.Cre76 клеток
на шести пластинах вместе с Ad.floxedΨ в MOI 2 IU/клетках. После инкубации 5 - 6 часов прививочный
материал был заменен на 3.5 мл DMEM, с 10%-ым FBS и 10-мМ MgCl2. Клетки производителя были
собраны после обнаружения CPE (обычно 3 - 4 дня p.i.) . Вышеупомянутая процедура была повторена во
время последующих опытов с 7.0 × 106 PER.tTA.Cre76 клеток в 25-см2 колбах (Greiner) для пассажа P2,
2.2 × 107 PER.tTA.Cre76 клеток в 75-cм2 колбах (Greiner) для пассажа P3, и 8.7 × 107 PER.tTA.Cre76 клеток
в 175-cм2 колбах (Greiner) для пассажа P4. Для каждого раунда распространения использовалась одна
десятая лизата из предыдущего пассажа.
Очищенные запасы гибридных векторных частиц были подготовлены из лизатов приблизительно 2.6 × 108
PER.tTA.Cre76 клеток в 12 75-см2 колбах в третьем пассаже (P3). Схема очистки состояла из
ультрацентрифугирования, сопровождаемого тремя циклами ультрафильтрации, используя фильтры
(Millipore). До ультрацентрифугирования лизаты клеток производителя были обработаны
дезоксирибонуклеазой I (Скала) в 25мкг/мл в течение 30 минут в 37°C. Векторные запасы были разделены
на 50-мкл порции, которые были заморожены в жидком азоте и сохранены при −80°C.
Концентрации функциональных двойных hcAd/AAV.eDYS частиц в очищенных гибридных векторных
растворах были определены титрованием на клетках HeLa, используя цитометрию потока и на
Ad.floxed?-инфицированных PER.tTA.Cre76 клетках при использовании проточной цитометрии и прямой
флюоресцентной микроскопии. В общей сложности 105 клеток HeLa были отобраны на 24 пластины.
После ночной инкубации сливные слои клеток получили 500 мкл пятикратных последовательных
разведений двойных hcAd/AAV.eDYS гибридных векторов. Два дня спустя клетки были
проанализированы на экспрессию EGFP-дистрофина в счетной проточной камере FACSort, как описано
выше. В общей сложности 5 × 105 PER.tTA.Cre76 клеток были отобраны в двойном экземпляре на 24
пластинах. После ночной инкубации сливные слои клетки получили Ad.floxed? в MOI 2 IU/клетках, вместе
с пятикратными последовательными разбавлениями гибридных векторов. После 4-ой инкубации при 37°C,
пластины были подвергнуты центрифугированию в течение 20 минут при 1 500 × г, после которой была
заменена питательная среда. Клетки на одной пластине были взяты через 20 часов для проточной
цитометрии . PER.tTA.Cre76 клетки, зараженные AdfloxedΨ использовались, чтобы определить
второстепенные интенсивности сигнала. Слои клетки на другой пластине были покрыты агарозой на 3.0
мл, подготовленной, раствором 9.0 мл фенола в питательной среде (Invitrogen), 0.36 мл
FBS, 0.18 мл MgCl2 на 1 М., 1.3 мл PBS , и 7.2 мл 2.5 % (wt/vol) агарозы SeaPlaque
(FMC). Действия переноса генов на последней пластине были определены через 20 и 120 h p.i., считая
EGFP-дистрофин позитивные клетки , соответственно, при помощи инверсионного флюоресцентного
микроскопа Olympus IX51.
Извлечение ДНК . Очистка ДНК была выполнена как ранее описано. (15).
Извлечение ДНК двойного hcAd/AAV гибридного вектора .Кратные количества очищенного гибридного
вектора обработанные дезоксирибонуклеазой I при заключительной концентрации 0.3 мкг/мл в течение 30
минут в 37°C в присутствии 10-мМ MgCl2. Впоследствии, нуклеаза была инактивирована добавлением
EDTA (pH фактор 8.0), сульфат додецила натрия, и протеиназы K (Скалы) в концентрациях 10 мМ, 0.5 %,
и 0.1 мкг/мл, соответственно. Образцы при 56°C в течение 1часа
извлечены дважды со смесью
буферизованного фенола, хлороформа, и изоамил алкоголя (25:24:1) и единажды с хлороформом.
Гибридная векторная ДНК была восстановлена этаноловым осаждением.
Саузерн-блот-анализ. После электрофореза геля агарозы ДНК подверглась капиллярному действиею
мембраны из нейлона (Hybond-XL; Эмершем Байосайенсес). Все исследования ДНК были маркированы
[α-32P] dCTP (Эмершем Байосайенсес) при использовании системы маркировки ДНК HexaLabel
(Fermentas).
Трансдукция кардиомиоцитов новорожденной крысы и иммунофлюоресцентная микроскопия.
Приблизительно 2 × 105 кардиомиоцитов новорожденной крысы, отобранных на стеклах на ишесть
пластин, были преобразованы двойным hcAd/AAV.eDYS или Ad.?E1. Векторы EGFP в MOIs 10 3
формирующих центр единиц (FFU) / клетках и 102 IU/клетках, соответственно. Ad. ΔE1. EGFP - первое
поколение Ad5-на-основе вектора, содержащего вместо E1 EGFP ORF под транскрипционным контролем
человеческого раннего промотора цитомегаловируса и SV40 pA (17).
Отрицательные контрольные образцы состояли из фективно преобразованных клеток. Двойные
hcAd/AAV.eDYS гибридные векторные частицы также использовались, чтобы преобразовать клетки HeLa
в MOI 2 × 102 FFU/cell. После ночной инкубации культуры кардиомиоцитов были вымыты дважды с PBS
и пополнены новой питательной средой. Через 2 дня p.i. преобразованные и фективно преобразованные
культуры были вымыты дважды с PBS в течение 5 минут. Клетки были фиксированы с 4 % (vol/vol)
параформальдегид в PBS в течение 15 минут при комнатной температуре. Фиксатор был удален
четырехкратным промыванием в течение 5 минут с 10-мМ глицином в PBSG. Затем, клетки были связанны
5 минут 1 % (vol/vol) Тритон X-100 в PBS при комнатной температуре. Детергент был удален тремя
промываниями 5 минут с PBSG. Впоследствии, блокирование было выполнено обработкой клеток в
течение 1 часа с PBSG, содержащим 5%-ый FBS. Моноклональные антитела (MAb), направленный против
определенного тропонина-I кардиотонического маркера (cTNI; HyTest), был разбавлен 1:100 в PBSG с 5%ым FBS. После ночной инкубации при 4°C, клетки были ополоснуты три раза PBS и окрашены Cy3антимышинными иммуноглобулинами осла (IgG) (H+L) антитело (Лаборатории Джексона
Иммуноресирча) разбавленными 1:100 в PBSG, содержащем 5%-ый FBS. После инкубации 45 минут при
4°C, лишние вторичные антитела были удалены четыремя промываниями. Ядрами клетки были окрашены
Hoechst 33342 (Молекулярные Исследования) при заключительной концентрации 10 мкг/мл в PBS. Клетки
были выдержаны в течение 5 минут в темноте при 4°C и, впоследствии, Hoechst, 33342 был удален
четырьмя промываниями с PBS. Исследования проводились
при использовании инверсионного
флюоресцентного микроскопа Olympus IX51. Цифровые изображения были сделаны при использовании
ColorView Peltier- камеры и использовано аналитическое программное обеспечение (Soft Imaging System).
Иммуногистохимия скелетных мышц. Двойные hcAd/AAV.eDYS гибридные векторные частицы (2 ×
108 FFU) в 100 мкл PBS, содержащей 7%-ый глицерин), были введены иглой в левую икроножную мышцу
6-недельных C57BL/10ScSn-Dmdmdx/J мышей. В икроножные мышцы C57BL/10ScSn и C57BL/10ScSnDmdmdx/J мышей были введены 100 мкл PBS с 7%-ым глицерином, они использовались в качестве
положительных и отрицательных контрольных групп для иммуногистохимии, соответственно.
Экспериментирование с животными было выполнено в соответствии с протоколом исследования,
одобренным комитетом по этике животных Лейденского университета. Целые икроножные мышцы были
собраны через 6 дней и заморожены в жидком азоте. Последовательные поперечные секции криостата с
толщиной 10 мкм и охвата всей длины мышцы были получены каждые 30 мкм. Секциям позволили
высохнуть быстро при 37°C. После регидратации секции были погружены в метанол, содержащий H2O2
0.035 % в течение 20 минут, и впоследствии ополоснуты с PBS. Секции были выведены в течение 45
минут в PBS, подкрепленной 4%-ым бычьим сывороточным альбумином (BSA), чтобы предотвратить
неопределенное окрашивание. Человеческий дистрофин был обнаружен иммуногистохимией, используя
антитела MAb NCL-DYS2 (Novocastra) направленные против С окончания белка. Этот MAb IgG1 изотип
(подарок Ginjaar), был разбавлен 1:40 в PBS, содержащей 1%-ый BSA, и маркирован 20fold-diluted пероксидазой (HRPO) Затем, смесь антител была добавлена к образцам без
дальнейшего разбавления, с инкубацией в течение 60 минут при комнатной температуре. После
промывания секции были фиксированы 4%-ым формальдегидом в PBS в течение 30 минут и снова
промыты PBS. Комплексы антител визуализировались инкубацией секций в 20-миллиметровом ацетате
натрия (pH фактор 5.2) содержащий 5 % диметилформамид, 400 мкг 3-амино-9-этилкарбазол (Сигма) / мл,
и H2O2 на 0.02 %. Промывание образцов водой остановило ферментативную реакцию. Впоследствии,
секции были контрастно окрашены гематоксилином-эозином и произведена светомикроскопическая
оценка. Отрицательные контрольные группы состояли из секций ткани, которые перенесли всю красящую
процедуру, но были выведены с HRPO-фрагментами, разбавленными 40-кратный в PBS, содержащей 1%ый BSA вместо HRPO-маркированного NCL-DYS2.
Проба для определения места интеграции ДНК. В общей сложности 8 × 104 клеток HeLa были
отобраны. После ночной инкубации клетки были инфицированы вирусом 0.5 мкг любого pKS.P5,
pGAPDH.Rep78/68, или pEFO.DsRed. T4 при использовании 2.4 мкл ExGen500 (Fermentas) согласно
инструкциям изготовителя. Клетки, инфицированные вирусом с последней конструкцией, служили и как
отрицательный контроль и как контроль для процедуры трансфекции ДНК. Инфицированные вирусом
клетки HeLa были преобразованы с двойными hcAd/AAV.eDYS гибридными векторными частицами в
трех различных MOIs (то есть, 18, 90, и 450 FFU/cell). После 2-х часовой инкубации клетки были вымыты
PBS и время лизиса составило 3 дня ,затем они были собраны, и геномная ДНК была извлечена как
описано ранее (17). Образцы, содержащие 240 нанограммов хромосомной ДНК, были подвергнуты PCR с
AAVS1-определенным инициатором pAAVS1b(24), вместе с
инициатором бетта R1 (5 ′GCCAGATTTTTCCTCCTCTCC-3 ′) нацаленным на ген β-глобина кролика pA существующий в двойном
hcAd/AAV химерном геноме. Каждый инициатор использовался при заключительной концентрации 0.2
мкM. Смеси ПЦР, содержащие 2 % (vol/vol) деионизированный формамид, 200 мкM трифосфатов
дезоксинуклеозида, и 2.5 полимеразы ДНК SuperTaq U (Биотехнология HT), были помещены в ООНтермоблок (Биоматка), и программа ПЦР была начата с инкубации в течении 3 минут при 94°C,
сопровождалась 20 циклами 94°C в 60 сек, периода отжига 60 сек с температурой, уменьшающейся 0.5°C
каждый цикл от 69 до 59°C, и дополнительный шаг 2 минуты при 72°C. Когда программа ПЦР достигла
более низкой температуры отжига 59°C, 28 дополнительных циклов были выполнены при использовании
вышеупомянутых условий за исключением использования постоянной температуры отжига 59°C. Реакции
были закончены инкубацией 10 минут при 72°C. Впоследствии, 3 мкл каждого образца ПЦР были
подвергнуты
ПЦР
с
AAVS1-определенным
инициатором
Cr2-AAVS1
(5
′ACAATGGCCAGGGCCAGGCAG-3 ′), вместе с олигодиоксирибонуклеотидом Бетой. R1. Те же самые
условия циркуляции как описано выше были применены для ПЦР, после которого, две 3-мкл фракции
каждой смеси реакции были подвергнуты электрофорезу в геле агарозы. Затем, каждый набор фрагментов
ДНК был передан посредством капиллярного действия мембранам Hybond-XL. Одна мембрана была
выведена с 677-bp гибридным вектором определенного для ДНК исследования, тогда как другая мембрана
была подвергнута воздействию 353-bp AAVS1. (10) Обе пробы были очищены QIAEX. Параллельно,
продукты ПЦР были очищены от геля и вставлены в pCR4-TOPO (Invitrogen) при использовании TOPO TA
клонирующаяся системы (Invitrogen). Готовые рекомбинантные плазмиды были переварены с EcoRI.
Впоследствии, продукты переваривания, соответствующие pCR4-TOPO плазмиды и усиленные AAVS1гибридные векторные соединения ДНК, были разделены в двойном экземпляре электрофорезом в геле
агарозы. Впоследствии, саусен блот анализ с 677-bp гибридным вектором с специфической ДНК или с
353-bp AAVS1 были выполнены. Наконец, последовательности нескольких нуклеотидов клонировались,
фрагменты ПЦР были определены как ранее описано (16) при использовании инициаторов T3 (5 ′ATTAACCCTCACTAAAGGGA-3 ′) и T7 (5 ′-TAATACGACTCACTATAGGG-3 ′).
Результаты
Накопление двойного hcAd/AAV гибридного вектора. Комплекс , заключенный в AAV содержал ДНК
AAV ITRs примыкающий или дикий тип последовательности AAV или рекомбинантная ДНК, также как
двойные линейные молекулы, названные мономерными или димерными репликативными формами AAV.
Димерные структуры возникают, когда AAV Rep78-или Rep68-зависимый разрыв в терминальном
сайте(trs) AAV ITR терпят неудачу до переинициирования синтеза ДНК (23). Мы рассуждали, что могли
эксплуатировать этот AAV ITR зависимый процесс димеризации и соединить его с репликацией ДНК,
чтобы собрать в клетках. Ad репликоны со структурой от хвоста к хвосту, кодирующей
две копии трансгена между элементами продвижения интеграции ДНК AAV p5IEE и
ITR. Наша гипотеза была в том, что 5 ′ Ad, ITR обеспечит прохождение репликации комплекса
полимеразы ДНК , тогда как 3 ′ AAV ITR обуславливала образование ковалентно связанных
двухспиральных димеры от хвоста к хвосту. Кроме того, при разумном выборе размера ДНК гибрида
Ad/AAV, процесс димеризации пошел бы на поколение молекул, больше чем ∼28-КБ, а это более низкий
предел размера генома, требуемый для эффективной упаковки ДНК (37) , но меньший чем максимальный
размер, который помещается в капсулы вируса (2). С этой целью плазмида pAd/AAV.DsRed была
построена (Рис. 1A). В этой плазмиде человеческий ORF и единица экспрессии гена DsRed созданы ITR и
упаковывающий сигнал плюс вышеупомянутые элементы AAV (Рис. 1A). Плазмиды. DsRed, которые
закодировали регулярной hcAd векторной ДНК, содержит от генома Ad исключительно оба окончания,
включая происхождение репликации (расположенный в пределах ITRs) и упаковочные элементы (Рис.
1A). Эта конструкция использовалась в качестве шаблона в экспериментах, описанных ниже. До
трансфекции, pAd/AAV.DsRed и рDsRed были переварены с MssI. Переваривание MssI освобождает
большую часть плазмид с их поворотом, что повышает эффективность субстанции для инициации Ad
ДНК зависимой репликации. (22). MssI- усиленные pAd.DsRed и pAd/AAV.DsRed перенесены в E1комплементарные PER.tTA.Cre76 клетки вмести или в отдельности от pKS.P5.Rep(16) Белки Rep78 и
Rep68 связанные с AAV ITRs и содействующие инициации репликации обоих дикого и рекомбинантного
геномомв. Мониторинг за DsRed-позитивными PER.tTA.Cre76 клетками при помощи флюоресцентной
микроскопии выявил сравнимую эффективность трансфекции во всех образцах. Затем активность
помощника Ad необходима для амплификации и упаковки ДНК шаблонов, проведенной при помощи
инфекции Ad.floxedΨ. Ad.floxedΨ- Ad вектор с делецией Е1, чьи упаковочные сигналы захвачены при
помощи прямого повторения сайтов loxP бактериофага Р1. PER.tTA.Cre76 клетках экспрессирующих P1
Cre рекомбиназу, собрание Ad.floxedΨ частиц предотвращено в значительной степени при помощи
Cre/loxP-опосредованного отсечения Ad упаковочных элементов (16). После появления CPE, убирается
продуцирующая клеточная культура и чистые лизаты используются для инфицирования
индикаторных клеток HeLa. После 2 дней установлен эффективный транспорт генов по
наличию лизиса клеток при помощи проточной флюоресцент-активной цитометрии.
Лизаты, переданные клеткам инфицируют pAd/AAV.DsRed и pKS.P5.Rep, показывают
наивысшую активность генного транспорта. Образцы произошли из клеток, которые
получили pAd. DsRed и pKS.P5. У pAd.DsRed и pKS.P5.Rep было 15.5 % ± 6.2 %
активности переноса генов, обнаруженной в анализах у pAd/AAV.DsRed-и pKS.P5.Rep.
инфицированных клеток. Лизаты клеточных культур, инфицированных вирусом Аd
DsRed или pAd/AAV.DsRed показали полезные действия передачи репортерного гена 21.2
% ± 1.1 % и 25.5 % ± 13.2 %, соответственно, достигнутого с образцами, полученными из
pAd/AAV.DsRed-и pKS.P5.Rep инфицированных клеток. Отрицательные контрольные
образцы , соответствующие инфицированным вирусом клеткам, которые не были
заражены Ad floxedΨ, не приводили к экспрессии репортерного гена выше фона (не показанный). Из этих
экспериментов мы приходим к заключению, что возможно включить в капсулы вируса Ad/AAV химерные
геномы и что белки Rep AAV, действительно увеличивают процесс освобождения/сборки.
Структура репликационных форм двойного hcAd/AAV гибридного вектора. В следующем наборе
экспериментов мы исследовали структурную организацию репликационной гибридной векторной ДНК. С
этой целью мы построили pAd/AAV.eDYS. У этой плазмиды есть точно то же самое устройство Ad и AAV
cis-активные
элементы такие,
как pAd/AAV.DsRed. Однако, вместо того, чтобы управлять
транскрипцией DsRed, генный промотор EF1α ведет экспрессию рекомбинантного генетического кода
продуктом слияния EGFP и человеческого дистрофина во всю длину (Рис. 2A). Конструкция
pAd/AAV.eDYS была получена из pAd.eDYS (Рис. 2A), кодируя обычный hcAd векторный геном, заменяя
3 ′ Ad- специфичными сегментами с AAV ITR. Следовательно, EGFP-дистрофин кодирующие hcAd и
hcAd/AAV геномы отличаются друг от друга только в их 3 ′ окончаниях. Накопление EGFP-дистрофин
кодирующей hc векторной ДНК было начато трансфекцией MssI-переваренный pAd/AAV.eDYS или MssIперевареной pAd.eDYS в PERtTA.Cre76 клетках. Продуцирующие клетки были впоследствии заражены
Ad.floxedΨ. После развития CPE, клеточные культуры были собраны и заново посеяны PER tTA.Cre76
клетки с одной десятой каждого очищенного лизата. Функции Ad помощника были снова обеспечены
Ad.floxedΨ. Отрицательный контроль состоял из свежее посеянных PER tTA.Cre76 клеток, зараженные
одним только Ad.floxedΨ. После того, как инкубационный период 48 час прошел, ДНК была извлечена из
клеток, переварил с BamHI или EcoRV и подвергнута саусен блот анализу (Рис. 2A) . Плазмида
pAd/AAV.eDYS переваренная с теми же самыми ферментами обеспечила шаблоны для
надежного управления гибридизаций ДНК. Переваривание с BamHI произвело
фрагменты 0.7, 8.6, и 10.6 КБ (Рис. 2B, переулок 1), тогда как с EcoRV выдавало продукты 1.9, 2.4, 6.9, и
8.6 КБ (Рис. 2B, переулок 2) после инкубации со смесью обоих проб. И BamHI-и EcoRV-леченная
экстрахромосомальная ДНК от PER.tTA.Cre76 клеток, зараженных одним только Ad floxedΨ, не
производили сигнала гибридизации, подтверждающего специфичность обоих проб (не показанно).
Используя ту же самую комбинацию проб, экстрахромосомальной ДНК из двух независимых
экспериментов и распространения начался с MssI-леченных pAd.eDYS продуктов 0.7, 2.7, 4.5, и 8.6 КБ
когда переварено с BamHI (Рис. 2B, 3 и 5) и 1.9, 2.4, 4.8, и 6.9 КБ после переваривания с EcoRV (Рис. 2B,
4 и 6). Эти результаты показывают превосходство репликационных форм векторной ДНК после одного
раунда распространения hcAd.eDYS частиц в разрешающих клетках. При тех же самых условиях саусен
блот анализ экстрахромосомальной ДНК из трех независимых экспериментов освобождение/сборки и
распространения с MssI-переваренным pAd/AAV.eDYS, использующим пробу 2832 один или вместе с
иробой 6563, показали наличие дополнительного фрагмента EcoRV 9.0 КБ (Рис. 2B, переулки 8, 10, 12, и
16). Эти особые разновидности ДНК соответствуют репликационным формам ДНК с тандемной
организацией от хвоста к хвосту (Рис. 2C). Лечение экстрахромосомальной ДНК с BamHI произвело
внутренние сегменты кодирующие дистрофин на 8.6 КБ, которые не достаточно от ожидаемых определили
димер- фрагменты ДНК на 8.4 КБ (Рис. 2B, переулки 7, 9, и 11). Мы подтвердили наличие определенных
димер фрагментов на 8.4 КБ при использовании пробу 2832 один (Рис. 2B, переулок 15), тогда как как
ожидалось внутренние определенные ДНК – специфические сегменты дистрофина на 8.6 КБ были
обнаружены пробой 6563 (Рис. 2B, переулок 13). Интересно, хотя менее видный чем те, которые
соответствуют hcAd.eDYS мономерные репликационные формы, фрагменты ДНК, совместимые с
гибридными мономерами Ad/AAV.eDYS (Рис. 2C), были также обнаружены (Рис. 2B,). Эта интерпретация
далее подтверждена обнаружением 4.2 и 4.5 КБ сегментов после того, как гибридизации с 3 ′-концом
специфической пробы 2832, но не с пробой 6563 (Рис. 2B, сравнивают).
Чтобы определить, способствует ли межмолекулярная рекомбинация через AAV
ITRs поколение структур ДНК от хвоста к хвосту PER.tTA.Cre76 клетки, были
инфицированы вирусом с равным количеством pAd/AAV.DsRed и pAd/AAV.EGFP
(Рис. 3A). Эксперименты контроля были выполнены с эквимолярными смесями
DsRed и EGFP (Рис. 3A,). Все конструкции были переварены с MssI до
трансфекции. Прямая флюоресцентная микроскопия
через 20 часов после
трансфекции показала, что значительное количество клеток PER.tTA.Cre было
позитивно из-за наличия маркера, демонстрирующих одновременное наличие
DsRed-и EGFP-кодирующей плазмиды в пределах этих клеток (Рис. 3B). После
инфекции с Ad floxedΨ и развитием CPE, были собраны клеточные культуры , и к
Рисунок 2
одной десятой
очищенных лизатов была добавлена
Ad.floxedΨ к свежее посеянным PER. tTA.Cre76 клеткам. Один день спустя слои клеток были проверены
на DsRed-и EGFP-маркеры прямой флюоресцентной микроскопией (Рис. 3C). Как показано выше, при тех
же самых экспериментальных условиях, мы наблюдали димеры от хвоста к хвосту при использовании
hcAd/AAV гибридных векторных плазмид кодирования ДНК (Рис. 2B, 8, 10, 12, 15, и 16), тогда как в
экспериментах контрольной группы с обычными hcAd векторными конструкциями мономеры были
единственной обнаруженной структурой (Рис. 2B, 4 и 6). Следовательно, трансфекция PER. tTA.Cre76
клеток со смесью MssI-переваренной . pAd DsRed и pAd EGFP в присутствии Ad floxedΨ, как ожидают, не
породит hcAd частицы, которые могут передать оба репортерных гена (Рис. 3A, правильная группа). AAV
ITR-опосредованная межмолекулярная рекомбинация между химерными геномами Ad/AAV, в дополнение
к гомодимерам, экспрессия одного из этих двух репортерных генов, выдал бы гетеродимеры, кодирующие
и DsRed и EGFP (Рис. 3A, оставленный группу). Следствия трех независимых экспериментов показали,
что DsRed-и EGFP-позитивные-клетки были редки (Рис. 3C, оставленный группу). Подобные результаты
были получены в группе контроля (Рис. 3C, правильная группа), указывая, что клетки с DsRed и EGFP
являются, наиболее вероятно, результатом двух независимых событий трансдукции единственной клетки
вместо того, чтобы быть вызванными передачей упакованных гетеродимеров. Взятые вместе, эти данные
предполагают, что гетеродимеризация через межмолекулярную рекомбинацию в AAV ITRs не играет
значительную роль в блоке от хвоста к хвосту hcAd/AAV химерных геномов.
В заключение комбинация 5′Ad с 3′AAV ITRs в pAd/AAV строит пары Ad зависимой ДНК репликации к
ITR-зависимой димеризации, приводя к блоку, в клетках производителя, двойных hcAd/AAV
фантастических геномов с от хвоста к хвосту геномная организация. Таким
образом AAV ITR может использоваться
гетерологичной
Ad ДНК
репликацией, чтобы произвести димерного Ad репликоны с определенной
структурой.
Распространение и определение количества двойных hcAd/AAV гибридных
векторных частиц. Впоследствии, мы определили, могли ли после блока
двойные hcAd/AAV.eDYS векторные частицы быть эффективно усилены
последовательным распространением. С этой целью, PER. tTA.Cre76 клетки
были инфицированы вирусом с MssI-переваренным pAd/AAV.eDYS, зараженным AdfloxedΨ, пока CPE не
наблюдался. Клеточные культуры, соответствующие этому начальному шагу (P0) , были собраны, и одна
десятая очищенных лизатов была добавлена к недавно отобранному PER. tTA.Cre76 клетки, вместе с
AdfloxedΨ в MOI 2 IU/клетками (отрывок P1). Эта схема инфекции была повторена в последующих
пробах (то есть, P2 через P4), за исключением использования увеличивания числа клеток. Из-за
маркировки N-терминального конца дистрофина EGFP, усиление векторных частиц могло быть с
готовностью проверено при помощи прямой флюоресцентной микроскопии (не показано) и проточной
цитометрии (Рис. 4). Следствия трех независимых проб, начатых с MssI-леченным pAd/AAV.eDYS,
показали эффективное усиление двойных hcAd/AAV.eDYS гибридных векторных частиц с процентом
EGFP-дистрофин позитивных клеток, увеличивающихся от 3.3 ± 0.46 в P1 до 92.0 ± 1.26 в P4 (Рис. 4).
Пробы контроля с непереваренным pAd/AAV.eDYS выдавали очень немного PER. tTA.Cre76 клеток
EGFP-дистрофин позитивных, указывая на небольшое количество высвобожденных химерных геномов
Ad/AAV от ковалентной присоединенной прокариотической ДНК, для достижения эффективного
образования поколения двойных hcAd/AAV гибридных векторных частиц.
Осветленные лизаты клеток, полученные после трех раундов векторного распространения, были очищены
ультрацентрифугированием CsCl. Затем, функциональные титры очищенных гибридных векторных
образцов были определены двумя различными методами. Первый метод определил количество активности
переноса генов EGFP-дистрофина, существующей в двойных hcAd/AAV гибридных векторах
титрованиями результата на клетках индикаторах HeLa при использовании проточной цитометрии
(Таблица 1). Вторая процедура состояла из титрований результата на PER. tTA.Cre76 клетках,
разрешавших реплекацию ДНК двойного hcAd/AAV гибридного вектора при инфекции АdfloxedΨ
помощника. Эта схема компенсирует тусклую флюоресценцию белка EGFP-дистрофина усилением
сигнала флюоресценции EGFP-дистрофина в преобразованных клетках индикатора. Основанные на
репликации пробы были разработаны для более высокой чувствительности и таким образом лучшиего
определении приблизительного числа EGFP-дистрофин преобразованных частиц в гибридных векторных
образцах. В этих экспериментах титрования действия переноса генов было определено количественно
проточной цитометрией и прямой флюоресценцентной микроскопией.
При прямой флюоресценции распространение EGFP-дистрофина через собранные de novo векторные
частицы было предотвращено присоединением агара. При этих условиях флюоресценция EGFPспецифического дистрофина была ограничена отдельными клетками индикатора в (Рис. 5A). С
прогрессией репликационного цикла единственные EGFP-дистрофин позитивные клетки, как ожидалось,
развивались во флуоресцентные фокусы, обнаруженные прямой флюоресценцентной микроскопией через
5 дней . (Рис. 5B). Определение количества этих фокусов показало, что их число было немного выше чем
таковые из единственных EGFP-дистрофин позитивных клеток, предполагая, что это основанно на
репликации проб, определеное действий переноса генов двойных hcAd/AAV.eDYS гибридных векторов
после 20 часов. Титры, полученные прямой флюоресцентной микроскопией были в среднем втрое ниже
чем измеренные после 20 часов при помощи проточной флюоресцентной цитометрией клеток
индикатора, которые не были покрыты агаром. Это различие не может быть приписано вторичным хитам,
так как свидетельства роста сигнала EGFP-дистрофина не наблюдался при прямой флюоресценцентной
микроскопии после инкубационного периода 20 часов. Независимо от используемой пробы титрования
можно прийти к заключению, что двойные hcAd/AAV.eDYS гибридные векторные частицы относительно
легко произвести и могут быть сконцентрированы в высоких титрах. Структура двойных hcAd/AAV
гибридных векторных геномов. Чтобы исследовать структурную организацию упакованных химерных
геномов Ad/AAV, ДНК была извлечена из очищенных гибридных векторных частиц. Затем,
восстановленная ДНК была переварена с HincII, BamHI или EcoRV и подвергнута
Саузерн-блот-анализу со смесью двух специфичных для вектора проб. Результаты,
показаны на Рис. 6A, совместимы исключительно с тандемной от хвоста к хвосту
геномной организации для упакованной гибридной векторной ДНК Ad/AAV (Рис.
6B), демонстрируя, что ранее идентифицированные от хвоста к хвосту
репликационные формы (Рис. 2B, переулки 8, 10, 12, 15, и 16, и Рис. 2C) являются
упаковочно-компетентными субстратами. Значительно, никакие добавочные формы
ДНК или любые другие геномные конструкции такие как лицом к лицу или димеры
головы к хвосту не были идентифицированы. Интересно, что фрагменты ДНК,
соответствующие мономерным геномам, ранее обнаруженным в клетках производителя во время первого
раунда распространения гибридных векторных частиц, не были упакованы (сравните Рис. 2B, 7, 9, и 15, с
Рис. 6A, B, и сравните Рис. 2B, 8, 10, и 16, с Рис. 6A, E).
Передача человеческой последовательности кодирующей дистрофин во всю длину крысиным
кардиомиоцитам in vitro двойными hcAd/AAV.eDYS гибридными векторами. В общей сложности 95 %
людей с МДД имеют повреждение миокарда, и 10 - 15 % из них умирают из-за порока сердца (8). Сердца
этих пациентов повреждены механическими силами из-за отсутствия функционального дистрофина в
кардиомиоцитах (9).
Клетки сердечной мышцы известны тем, что были невосприимчивыми к
большинству способов трансгенеза. Однако, Ad
векторы
с делецией
E1-, как показывали,
преобразовывали кардиомиоциты in vitro, так же как в естественных условиях(20). Таким образом мы
решили проверить, могли ли мы предоставить человеческий ORF во всю длину в кардиальные клетки
двойной hcAd/AAV.eDYS гибридной векторной трансдукцией. С этой целью in vitro модели
использовалась
культуры кардиомиоцитов новорожденной крысы. Эти культуры были
мнимо
преобразованны или преобразованны с помощью 103 FFU двойного hcAd/AAV.eDYS гибридного вектора
и, прямая флюоресцентная микроскопия и иммунофлюоресцентная микроскопия использовались, чтобы
обнаружить EGFP-дистрофин и cTNI белки, соответственно. Основные культуры
крысиных кардиомиоцитов, преобразованные Ad вектором с удаленным E1 и
кодирующий EGFP, служила контролем. Другой контроль состоял из клеток HeLa,
преобразованных двойными hcAd/AAV.eDYS гибридными векторными частицами.
Векторы Ad преобразуют эти клетки человека очень хорошо. Прямая флюоресценция
EGFP-дистрофина показала наличие белка слияния в> у 90 % клеток HeLa (Рис. 7A и
B) и у 70 - 80 % сердечных клеток (Рис. 7C и D). Иммунореактивность клеток
определена для кардиотонического маркера TNI (Рис. 7F, H, J, L, и N) и их ритмичное
сокращение, которое продолжалось после трансдукции (не показанный), подтвердило,
что значительная фракция клеток в этих культурах действительно кардиомиоциты.
Кроме того характерная полосатая структура объединения cTNI в кардиальных
мышечных клетках различалась (Рис. 7J). Обнаружение белка EGFP-дистрофина (Рис.
7E и G) в значительном большинстве TNI-позитивных-клеток (Рис. 7F и H) указывает на эффективную
трансдукцию кардиомиоцитов двойными hcAd/AAV.eDYS гибридными векторными частицами. Наконец,
сравнение внутриклеточного распределения EGFP и EGFP-дистрофина показало, что, в то время как
первый проникал во всю клетку, включая ядро (Рис. 7 K), последний был исключен из ядер и был найден
связанным с плазмолеммой кардиомиоцитов (Рис. 7 г и I). Эти результаты - в согласии с известной
внутриклеточной локализацией дикого типа дистрофина
и с данными, восстановленными из
экспериментов с этим геномом EGFP-дистрофина в контексте невирусных трансфекций ДНК (6).
Наконец, мнимо преобразованные клетки не показывали зеленую флюоресценцию, показывая, что этот
сигнал был определенным для наличия EGFP в преобразованных вектором клетках (Рис. 7M и N).
Передача последовательности
содержащий человеческий дистрофин во всю длину страдающей
дистрофией скелетной мышце мишей в естественных условиях двойными hcAd/AAV.eDYS гибридными
векторами. Основная генетическая причина дистрофии у mdx мышей находится в преждевременной
остановке кодона в экзоне 23 гена дистрофина (47). За исключением редких так
называемых ревертантных волокон мышц, дистрофин не наблюдается в ткани мышцы mdx
мышей. Скелетные мышци взрослых mdx мышей показывают определенную
гистопатологическую особенность МДД такогую как гетерогенность в диаметре волокон
мышц и высокую распространенность расположенных в центре ядер. Эти признаки делают
mdx мышей привлекательной образцовой системой для того, чтобы оценить процедуры,
направленные на восстановление синтеза дистрофина, особенно на гистологическом
уровне.Для оценки эффективности двойной hcAd/AAVгибридной вектор-опосредованной
генной доставки, мы провели инъекции икроножных мышц у 6-ти
недельных mdx мышей с
2 × 108 FFU двойных hcAd/AAV.eDYS
гибридных векторов. Отрицательная контрольная группа составляла из икроножных мышц, в которые
введен буферный раствор, тогда как позитивная контрольная группа состояла из дикого типа мышей.
Через 6 дней после инъекции секции мышцы от каждой из экспериментальных групп были подвергнуты
иммуногистохимии при использовании MAb, направленного против C-терминальной части дистрофина.
Иммуногистохимические исследования позитивной контрольной группы полученных из мышей дикого
типа, показали сарколемное окрашивание в однородных по размеру волокнах мышцы с периферическими
ядрами (Рис. 8A), тогда как таковые из введенных симуляцией мышц не показывали дистрофинположительные волокна (Рис. 8B). Результаты, полученные с положительными и отрицательными
образцами контроля, свидетельствуют о специфичности иммуногистохимической пробы для дистрофина.
Исследования поперечных разрезов, полученных из образца мышц мышей получивших инъекцию
двойного hcAd/AAV.eDYS гибридного вектора , показали ясную и широко распространенную
рекомбинантную экспрессию дистрофина во всю длину (Рис. 8C к F)., ограниченную в сарколемме
страдающих дистрофией волокон мышцы, как упомянуто выше, широким диапазоном размеров
поперечного сечения и центральных ядер (Рис. 8C и D). В дополнение к сильной маркировке сарколеммы
некоторые волокна также показали поддающееся обнаружению эндоплазматическое окрашивание,
обусловленное трансгенной чрезмерной экспрессией (Рис. 8E). Взятые вместе, эти эксперименты
демонстрируют способность двойных hcAd/AAV.eDYS гибридных векторов эффективно поставлять и
экспрессировать последовательность кодирующую
человеческий дистрофин во всю длину в
кардиомиоцитах in vitro так же как во взрослой страдающей дистрофией скелетной мышце в естественных
условиях.
Нацеленная интеграция ДНК после трансгенеза двойного hcAd/AAV гибридного вектора. Наконец, мы
занимались исследованиями, могло ли введение двойных hcAd/AAV химерных геномов в клетки
человека. С этой целью клетки HeLa были инфицированы вирусом или с плазмидой экспрессии
pGAPDH.Rep78/68 кодирующий AAV Rep78 и Rep68 или с плазмидой
экспрессии pKS.P5. Элемент кодирующий Rep78, Rep68, Rep52, и Rep40.
Контрольные группы состояли из ложно-инфицированных вирусом клеток HeLa
и из клеток HeLa, инфицированных вирусом с плазмидой pEFO.DsRed. T4,
содержащий DsRed ORF вместо AAV. Затем, клетки были пребразованы
двойными hcAd/AAV.eDYS гибридными векторными частицами в трех
различных MOIs. Через 3 дня p.i., геномная ДНК была извлечена из этих клеток,
и ПЦР проба интеграции ДНК была выполнена, чтобы обнаружить AAVS1гибридные векторные соединения ДНК, используя два набора инициатора (Рис.
9A).Эти инициаторы отжигают гибридный векторный геном и хромосому 19,
где вставки ДНК AAV были картированы (30, 32, 43). ПЦР-усиленные образцы были подвергнуты
электрофорезу в геле агарозы и соусен блот анализу или с гибридным вектором - или с AAVS1специфической пробой (Рис. 9B, верхние и более низкие группы, соответственно). В обоих случаях
накоплении по-другому размерных фрагментов ДНК, мигрирующих, поскольку, мазок наблюдался в
образцах инфицированных вирусом и двойных hcAd/AAV.eDYS-инфицированных клеток (Рис. 9B, 3 - 5,
7, и 8). Образцы произошли из клеток HeLa, которые были преобразованы двойными hcAd/AAV
гибридными векторными частицами будучи или мнимо или pEFO.DsRed. T4-инфицированны (Рис. 9B, 1
и 2, соответственно) не выдавал сигналы гибридизации. Эти результаты демонстрируют Rep зависимую
нацеленную интеграцию AAV гибридной векторной ДНК в AAVS1. События интеграции ДНК AAV не
сайт специфичны, определенные в классическом смысле, так как они не имеют место в единственном
положении нуклеотида, но в относительно протяженном участке ДНК. Следовательно, AAVS1-гибридные
векторные соединения ДНК, произведенные посредством интеграционного процесса ДНК AAV, обычно
присутствуют как единственные копии в пределах AAVS1- клеток. Поэтому, наблюдаемый мазок
наиболее вероятно отражает усиление смеси AAVS1-гибридных векторных соединений ДНК с
различными длинами. Чтобы исследовать это, продукты ПЦР были клонированы в вектор pCR4-TOPO.
Рекомбинантные плазмиды из рандомизированно отобранных колоний были переварены с EcoRI, чтобы
выпустить вставки. Исследования электрофорезом в геле агарозы показали вставки с различными
размерами, отражающими разнообразие размеров фрагмента ДНК, наблюдаемых в Рис. 9B (Рис. 9C,
верхняя группа).
Чтобы далее подтвердить природу этих вставок, как являющихся AAVS1-гибридными векторными
соединениями ДНК, образцы ДНК были переданы в двойном экземпляре
и
инкубированны отдельно с пробами, изображенными в Рис. 9A. После ауторадиографии
оба гибридных вектора - и AAVS1-специфические пробы признали всех
проанализированных клонов (Рис. 9C, середина и более низкие группы,
соответственно), подтверждая это они представляют соединения между местом
перед интеграцией AAV на хромосоме 19 и гибридной векторной ДНК. Вставки
клонов Л13, Х1, и H8 (Рис. 9C, средняя группа) и 8 (Рис. 9C, более низкая
группа) были обнаружены после увеличения времени выдержки в отсутствие
любых других сигналов гибридизации (не показано). Интересно, для обоих проб
сила сигнала изменились у различных клонов (Рис. 9C, середина и более низкие
группы). Кроме того, большинство клонов реагировало до различной степени с
двумя пробами (Рис. 9C, сравните середину и более низкие группы). Эти
результаты указывают на существование определенных для клона усечений не
только в области AAVS1, но также и в пределах гибридного векторного воздействия ДНК, до различных
степеней, отжига исследования. Поэтому, чтобы изучить в мелких деталях структуру AAVS1-гибридных
векторных соединений ДНК, исследования последовательности нуклеотидов были выполнены у клонов 3,
5, 7, L2, и H10. Результаты, полученные в итоге Рис. 10A, подтвердили организменные хромосомные
контрольные точки ДНК, рассеянные всюду по области AAVS1 вниз по течению trs и связанного Rep
элемента ( Рис. 10B). Кроме того гибридная векторная ДНК всегда ломалась вверх по течению в p5IEE
последовательности (Рис. 10C). Эти данные подтверждают, что у каждой вставки есть определенная
последовательность. Кроме того проанализированные соединения не содержали последовательности
кроме таковых из гибридного векторного генома и AAVS1. Наконец, интенсивности гибридизации при
саусен блот анализе совместимы с данными о последовательности ДНК. В целом эти эксперименты
демонстрируют способность двойных hcAd/AAV гибридных векторов предназначаться для чужеродной
ДНК в AAVS1 на человеческой хромосоме 19 при условии, что Rep78 и Rep68 доступны в пределах
преобразованных клеток.
Дискуссия
hcAd векторы достигают эффективного транспорта полной последовательности
ДНК in vitro и in vivo (19, 27, 31) и благодаря недостатку Ad протеин
кодирующей последовательности значительно менее иммуногены, чем Ad
векторы с одним или более удаленным ранним регионом (28). Тем не менее,
если используются большие количества Ad капсидов in vivo,это может вызвать
активацию иммунной системы.
(5, 49). Поэтому, увеличение числа
терапевтических генных копий, поставленных в пределах каждой капсулы
вируса , позволит использовать более низкие векторные дозы при достижении определенного
трансгенного уровня экспрессии. Кроме того, обычные hcAd векторы не удовлетворяют необходимость
постоянного генетического исправления распространяющихся групп клеток, потому что поставленная
ДНК обычно остается в клетках. В данном исследовании представлена новая система переноса генов,
которая основывается на привлекательных особенностях hcAd векторов. Эти двойные hcAd/AAV
гибридные векторы несут димерные геномы и могут устойчиво преобразовать клетки интеграцией ДНК в
предопределенное место в пределах человеческой ДНК.
Здесь, мы показали, что механизм репликации ДНК может быть соединена с AAV ITR-опосредованным
процессом димеризации, чтобы собрать определенные ДНК репликоны в зараженных вектором
помошником клетках . Применяя этот принцип мы произвели гибридные векторные частицы, кодирующие
две человеческих последовательности дистрофина во всю длину. Мы предполагаем два пути для
повторного исследования двойных hcAd/AAV гибридных векторов (Рис. 11). После трансфекции MssIпереваренных гибридных векторных плазмид Ad/AAV в PRE tTA.Cre76 клетки заражаются вектором
помошником Ad.floxedΨ с делецией E1. В пути I, AAV ITRs представляют собой в ковалентные закрытые
шпильки AAV Rep78 и белки Rep68 или, альтернативно, клеточными действиями, которые действуют на
их вторичную структуру подобную Holliday (53, 55). Эта структура может быть сформирована в AAV ITR
из-за его мультирецидивирующего характера. Интересно, выше упаковочные уровни химерных геномов
Ad/AAV в капсулы вируса наблюдались в присутствии белков AAV Rep наиболее вероятно в результате
расширения AAV ITRs от ковалентной присоединенной прокариотической ДНК
каталитических
действий AAV Rep. Эти данные в соответствии с предыдущими экспериментами с ДНК AAV, ITRсодержащими плазмидами в наличии или отсутствии экспрессии AAV rep(55).
Комплекс инициирования репликации Ad ДНК признает Ad ITR, расположенный близко к другому концу
молекул. Впоследствии, смещение и полимеризация ДНК, которая продвигает через ковалентный
закрытый AAV ITR структуры последовала. Эти процессы производят структуры ДНК, содержащие в
обоих концах Ad и упаковочных элементов, который делает их эффективными субстратами для
репликации Ad ДНК. Для простоты не вынуты двойные дочерние молекулы , произведенные во время
этого процесса. Заканчивающиеся одноцепочечные молекулы ДНК содержат AAV ITRs с непарными
хвостами в их 3 концах ′. Удаление этих хвостов 3 ′ экзонуклеазами производит шпильки со свободными 3
′ гидроксильными группами. Эти структуры составляют идеальные инициаторы для полимеризации ДНК.
После удлинения двойные 5 ′ Ad ITRs с функциональной Ad ДНК восстановлены. Дальше Ad ДНК
подчиненная реинициации, следующей за ДНК полимеризацией через AAV ITR, содержащий в ДНК
молекулах оба конца Ad и упаковочные элементы. Эти элементы могут дальше быть амплифицированы и
упакованы в Ad капсид. Оба пути не взаимно исключающи, и согласно эксперементальным данным
приближаются к одному типу продукции
После сбора двойные hcAd/AAV.eDYS гибридные векторные частицы могли быть усилены высоким
титрам посредством последовательного распространения
Ad floxedΨна
PER.tTA.Cre76 клетках.
Структурные исследования ДНК, извлеченной из двойных hcAd/AAV.eDYS гибридных векторных частиц,
подтвердили накопление тандемных геномов от хвоста к хвосту. Хотя мономеры не были обнаружены в
пределах векторных частиц, они присутствовали в экстрахромосомной фракции ДНК клеток
производителя после одного раунда распространения. Кроме того они были также найдены в клетках
производителя при втором способе (не показано). Эти данные предполагают, что фракция
двойных hcAd/AAV химерных геномов заключена в мономеры возможно из-за клеточных
действий, действующих на крестообразные структуры подобные Holliday, которые могут
быть сформированы в центрально ограниченном AAV ITRs (55). Кроме того отсутствие
мономеров из упакованного материала ДНК может быть связано с легкой энкапсидацией
димерных геномов, длина которых ниже предела размера генома, что необходимо для
эффективного накопления ДНК (37).
Данные флюоресцентной микроскопии из экспериментов с рекомбинантным человеческим
дистрофином, помеченным в окончании N EGFP, вместе с результатами иммуногистохимии,
полученными с MAb для С конца дистрофина, показали эффективную передачу
рекомбинантного гена в мышечные клетки in vitro и в естественных условиях и синтез белка
дистрофина во всю длину в этих клетках. Хотя этот белок ограничивал положение ядер к сарколемме
страдающих дистрофией mdx волокон мышцы, перераспределение ядер мышечного волокна к периферии
синцития не наблюдалось. Этот результат является, вероятно, относящимся к факту, что процедура
переноса генов имела место во взрослую клетку (13) и к промежутку времени, требуемому для этого
феномена. Предыдущие результаты указали на причастность последовательности ДНК, которая
накладывается p5 промотором в предназначенной интеграции ДНК AAV из-за высокой частоты
контрольных точек, наблюдаемых в пределах или около этой области в дополнение к контрольным
точкам, которые были найдены в AAV ITRs (14, 43, 50). Позже, непосредственного участия этой
последовательности ДНК в интенсивной определенной для места интеграции иностранной ДНК было
продемонстрировано в экспериментах трансфекции, выполненных с круглыми плазмидами(38, 39). p5IEE
отсутствует в стандартных рекомбинантных векторах AAV, которые содержат от вирусного генома
исключительно AAV ITRs. Введение p5IEE последовательности в рекомбинантные векторы AAV, чтобы
восстановить интенсивную сайт специфическую интеграцию ДНК, далее уменьшит их уже ограниченную
способность кодирования. В данном исследовании мы представили свидетельства, что эффективный Ad,
установленный капсулой вируса процесс переноса генов может быть использован, чтобы ввести в ядра
целевых клеток большие сегменты ДНК, напоминающие о провирусных геномах AAV, и мы показали, что
эти структуры - субстраты для AAVS1-предназначенной интеграции ДНК в присутствии белков члена
палаты представителей AAV. Исследования последовательности нуклеотида AAVS1-гибридных
векторных соединений ДНК показали, что контрольные точки встречались вверх по течению в p5IEE,
оставляющем позади полное Ad ITR и некоторые или все Ad упаковочные элементы. Эта особенность
важна по двум причинам. Во-первых, это предполагает, что разрушение
терапевтических и/или трансгенных последовательностей ДНК часто не происходит и,
во-вторых, это указывает, что интегрированная генетическая информация не будет склонной к
мобилизации после инфекции устойчиво преобразованных клеток с диким типом Ad (40).
Клетка - и основанные на гене подходы к терапии МДД в настоящее время является объектом
интенсивного исследования. Прежнее влечет за собой изоляцию и аллогенную трансплантацию
прародителя или стволовых клеток с миогенным потенциалом, тогда как последние нацеливаются
непосредственно на дополнение дефектного гена
посредством передачи функциональной
последовательности кодирующей дистрофин. Третий путь для лечения МДД должен был бы объединить
эти два подхода, чтобы позволить генетическому исправлению и аутогенной трансплантацию типа (ов)
клеток, у которых, оказывается, есть самая высокая регенеративная способность большинства страдающих
дистрофией мышц. В настоящее время, однако, нет никакой системы трансгенеза, которая разрешает
устойчивую трансдукцию КОМПЛЕМЕНТАРНОЙ ДНК во всю длину в дефектные миогенные клетки.
Ссылки
1. ↵
Aki, T., S. Yanagisawa, and H. Akanuma. 1997. Identification and characterization of positive regulatory
elements in the human glyceraldehyde 3-phosphate dehydrogenase gene promoter. J. Biochem. 122:271278.
Abstract/FREE Full Text
2. ↵
Bett, A. J., L. Prevec, and F. L. Graham. 1993. Packaging capacity and stability of human adenovirus
type 5 vectors. J. Virol. 67:5911-5921.
Abstract/FREE Full Text
3. ↵
Bevis, B. J., and B. S. Glick. 2002 Rapidly maturing variants of the Discosoma red fluorescent protein
(DsRed). Nat. Biotechnol. 20:83-87.
CrossRefMedline
4. ↵
Blake, D. J., A. Weir, S. E. Newey, and K. E. Davies. 2002. Function and genetics of dystrophin and
dystrophin-related proteins in muscle. Physiol. Rev. 82:291-329.
Abstract/FREE Full Text
5. ↵
Brown, B. D., C. X. Shi, S. Powell, D. Hurlbut, F. L. Graham, and D. Lillicrap. 2004. Helper-dependent
adenoviral vectors mediate therapeutic factor VIII expression for several months with minimal
accompanying toxicity in a canine model of severe hemophilia A. Blood 103:804-810.
Abstract/FREE Full Text
6. ↵
Chapdelaine, P., P.-A. Moisset, P. Campeau, I. Asselin, J.-T. Vilquin, and J. P. Tremblay. 2000.
Functional EGFP-dystrophin fusion proteins for gene therapy vector development. Protein Eng. 13:611615.
Abstract/FREE Full Text
7. ↵
Chiorini, J. A., M. D. Weitzman, R. A. Owens, E. Urcelay, B. Safer, and R. M. Kotin. 1994. Biologically
active rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli. J.
Virol. 68:797-804.
Abstract/FREE Full Text
8. ↵
Cox, G. F., and L. M. Kunkel. 1997. Dystrophies and heart disease. Curr. Opin. Cardiol. 12:329-343.
Medline
9. ↵
Danialou, G., A. S. Comtois, R. Dudley, G. Karpati, G. Vincent, C. Des Rosiers, and B. J. Petrof. 2001.
Dystrophin-deficient cardiomyocytes are abnormally vulnerable to mechanical stress-induced contractile
failure and injury. FASEB J. 15:1655-1657.
FREE Full Text
10. ↵
Fallaux, F. J., A. Bout, I. van der Velde, D. J. M. van den Wollenberg, K. M. Hehir, J. Keegan, C.
Auger, S. J. Cramer, H. van Ormondt, A. J. van der Eb, D. Valerio, and R. C. Hoeben. 1998. New helper
cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent
adenoviruses. Hum. Gene Ther. 9:1909-1917.
Medline
11. ↵
Gilbert, R., R. W. R. Dudley, A.-B. Liu, B. J. Petrof, J. Nalbantoglu, and G. Karpati. 2003. Prolonged
dystrophin expression and functional correction of mdx mouse muscle following gene transfer with a
helper-dependent (gutted) adenovirus-encoding murine dystrophin. Hum. Mol. Genet. 12:1287-1299.
Abstract/FREE Full Text
12. ↵
Gilbert, R., A.-B. Liu, B. J. Petrof, J. Nalbantoglu, and G. Karpati. 2002. Improved performance of a
fully gutted adenovirus vector containing two full-length dystrophin cDNAs regulated by a strong
promoter. Mol. Ther. 6:501-509.
CrossRefMedline
13. ↵
Gilchrist, S. C., M. P. Ontell, S. Kochanek, and P. R. Clemens. 2002. Immune response to full-length
dystrophin delivered to dmd muscle by a high-capacity adenoviral vector. Mol. Ther. 6:359-368.
CrossRefMedline
14. ↵
Giraud, C., E. Winocour, and K. I. Berns. 1995. Recombinant junctions formed by site-specific
integration of adeno-associated virus into an episome. J. Virol. 69:6917-6924.
Abstract/FREE Full Text
15. ↵
Gonçalves, M. A. F. V., M. G. Pau, A. A. F. de Vries, and D. Valerio. 2001. Generation of a highcapacity hybrid vector: packaging of recombinant adenoassociated virus replicative intermediates in
adenovirus capsids overcomes the limited cloning capacity of adenoassociated virus vectors. Virology
288:236-246.
CrossRefMedline
16. ↵
Gonçalves, M. A. F. V., I. van der Velde, J. M. Janssen, B. T. H. Maassen, E. H. Heemskerk, D.-J. E.
Opstelten, S. Knaän-Shanzer, D. Valerio, and A. A. F. de Vries. 2002. Efficient generation and
amplification of high-capacity adeno-associated virus/adenovirus hybrid vectors. J. Virol. 76:1073410744.
Abstract/FREE Full Text
17. ↵
Gonçalves, M. A. F. V., I. van der Velde, S. Knaän-Shanzer, D. Valerio, and A. A. F. de Vries. 2004.
Stable transduction of large DNA by high-capacity adeno-associated virus/adenovirus hybrid vectors.
Virology 321:287-296.
CrossRefMedline
18. ↵
Greelish, J. P., L. T. Su, E. B. Lankford, J. M. Burkman, H. Chen, S. K. Konig, I. M. Mercier, P. R.
Desjardins, M. A. Mitchell, X. G. Zheng, J. Leferovich, G. P. Gao, R. J. Balice-Gordon, J. M. Wilson,
and H. H. Stedman. 1999. Stable restoration of the sarcoglycan complex in dystrophic muscle perfused
with histamine and a recombinant adeno-associated viral vector. Nat. Med. 5:439-443.
CrossRefMedline
19. ↵
Haecker, S. E., H. H. Stedman, R. J. Balice-Gordon, D. B. J. Smith, J. P. Greelish, M. A. Mitchell, A.
Wells, H. L. Sweeney, and J. M. Wilson. 1996. In vivo expression of full-length human dystrophin from
adenoviral vectors deleted of all viral genes. Hum. Gene Ther. 7:1907-1914.
Medline
20. ↵
Hajjar, R. J., F. del Monte, T. Matsui, and A. Rosenzweig. 2000. Prospects for gene
therapy for heart failure. Circ. Res. 86:616-621.
Abstract/FREE Full Text
21. ↵
Harper, S. Q., M. A. Hauser, C. DelloRusso, D. Duan, R. W. Crawford, S. F. Phelps, H. A. Harper, A. S.
Robinson, J. F. Engelhardt, S. V. Brooks, and J. S. Chamberlain. 2002. Modular flexibility of
dystrophin: implications for gene therapy of Duchenne muscular dystrophy. Nat. Med. 8:253-261.
CrossRefMedline
22. ↵
Hay, R. T., N. D. Stow, and I. M. McDougall. 1984. Replication of adenovirus mini-chromosomes. J. Mol.
Biol. 175:493-510.
CrossRefMedline
23. ↵
Hong, G., P. Ward, and K. I. Berns. 1994. Intermediates of adeno-associated virus DNA replication in
vitro. J. Virol. 68:2011-2015.
Abstract/FREE Full Text
24. ↵
Hüser, D., and R. Heilbronn. 2003. Adeno-associated virus integrates site-specifically into human
chromosome 19 in either orientation and with equal kinetics and frequency. J. Gen. Virol. 84:133-137.
Abstract/FREE Full Text
25. ↵
Jankowski, R. J., and J. Huard. 2004. Establishing reliable criteria for isolating myogenic cell fractions
with stem cell properties and enhanced regenerative capacity. Blood Cells Mol. Dis. 32:24-33.
CrossRefMedline
26. ↵
Knaän-Shanzer, S., I. van der Velde, M. J. E. Havenga, A. A. C. Lemckert, A. A. F. de Vries, and D.
Valerio. 2001. Highly efficient targeted transduction of undifferentiated human hemopoietic cells by
adenoviral vectors displaying fiber knobs of subgroup B. Hum. Gene Ther. 12:1989-2005.
CrossRefMedline
27. ↵
Kochanek, S., P. R. Clemens, K. Mitani, H. H. Chen, S. Chan, and C. T. Caskey. 1996. A new adenoviral
vector: replacement of all viral coding sequences with 28 kb of DNA independently expressing both fulllength dystrophin and β-galactosidase. Proc. Natl. Acad. Sci. USA 93:5731-5736.
Abstract/FREE Full Text
28. ↵
Kochanek, S., G. Schiedner, and C. Volpers. 2001. High-capacity “gutless” adenoviral vectors. Curr.
Opin. Mol. Ther. 3:454-463.
Medline
29. ↵
Kotin, R. M., J. C. Menninger, D. C. Ward, and K. I. Berns. 1991. Mapping and direct visualization of a
region-specific viral DNA integration site on chromosome 19q13-qter. Genomics 10:831-834.
CrossRefMedline
30. ↵
Kotin, R. M., M. Siniscalco, R. J. Samulski, X. Zhu, L. Hunter, C. A. Laughlin, S. McLaughlin, N.
Muzyczka, M. Rocchi, and K. I. Berns. 1990. Site-specific integration by adeno-associated virus. Proc.
Natl. Acad. Sci. USA 87:2211-2215.
Abstract/FREE Full Text
31. ↵
Kumar-Singh, R., and J. S. Chamberlain. 1996. Encapsidated adenovirus minichromosomes allow
delivery and expression of a 14-kb dystrophin cDNA to muscle cells. Hum. Mol. Genet. 5:913-921.
Abstract/FREE Full Text
32. ↵
Linden, R. M., P. Ward, C. Giraud, E. Winocour, and K. I. Berns. 1996. Site-specific integration by
adeno-associated virus. Proc. Natl. Acad. Sci. USA 93:11288-11294.
Abstract/FREE Full Text
33. ↵
McCarty, D. M., D. J. Pereira, I. Zolotukhin, X. Zhou, J. H. Ryan, and N. Muzyczka. 1994.
Identification of linear DNA sequences that specifically bind the adeno-associated virus Rep protein. J.
Virol. 68:4988-4997.
Abstract/FREE Full Text
34. ↵
Moisset, P.-A., Y. Gagnon, G. Karpati, and J. P. Tremblay. 1998. Expression of human dystrophin
following the transplantation of genetically modified mdx myoblasts. Gene Ther. 5:1340-1346.
CrossRefMedline
35. ↵
Niwa, H., K.-I. Yamamura, and J.-i. Miyazaki. 1991. Efficient selection for high-expression transfectants
with a novel eukaryotic vector. Gene 108:193-200.
CrossRefMedline
36. ↵
Parks, R. J., L. Chen, M. Anton, U. Sankar, M. A. Rudnicki, and F. L. Graham. 1996. A helperdependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral
packaging signal. Proc. Natl. Acad. Sci. USA 93:13565-13570.
Abstract/FREE Full Text
37. ↵
Parks, R. J., and F. L. Graham. 1997. A helper-dependent system for adenovirus vector production helps
define a lower limit for efficient DNA packaging. J. Virol. 71:3293-3298.
Abstract/FREE Full Text
38. ↵
Philpott, N. J., C. Giraud-Wali, C. Dupuis, J. Gomos, H. Hamilton, K. I. Berns, and E. Falck-Pedersen.
2002. Efficient integration of recombinant adeno-associated virus DNA vectors requires a p5-rep sequence
in cis. J. Virol. 76:5411-5421.
Abstract/FREE Full Text
39. ↵
Philpott, N. J., J. Gomos, K. I. Berns, E. Falck-Pedersen. 2002. A p5 integration efficiency element
mediates Rep-dependent integration into AAVS1 at chromosome 19. Proc. Natl. Acad. Sci. USA 99:1238112385.
Abstract/FREE Full Text
40. ↵
Rademaker, H. J., M. A. Abou El Hassan, G. A. Versteeg, M. J. W. E. Rabelink, and R. C. Hoeben.
2002. Efficient mobilization of E1-deleted adenovirus type 5 vectors by wild-type adenoviruses of other
serotypes. J. Gen. Virol. 83:1311-1314.
Abstract/FREE Full Text
41. ↵
Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.
42. ↵
Sampaolesi, M., Y. Torrente, A. Innocenzi, R. Tonlorenzi, G. D'Antona, M. A. Pellegrino, R. Barresi, N.
Bresolin, M. G. C. De Angelis, K. P. Campbell, R. Bottinelli, and G. Cossu. 2003. Cell therapy of αsarcoglycan null dystrophic mice through intra-arterial delivery of mesoangioblasts. Science 301:487-492.
Abstract/FREE Full Text
43. ↵
Samulski, R. J., X. Zhu, X. Xiao, J. D. Brook, D. E. Housman, N. Epstein, and L. A. Hunter. 1991.
Targeted integration of adeno-associated virus (AAV) into human chromosome 19. EMBO J. 10:39413950. (Erratum, 11:1228).
Medline
44. ↵
Sandig, V., R. Youil, A. J. Bett, L. L. Franlin, M. Oshima, D. Maione, F. Wang, M. L. Metzker, R.
Savino, and C. T. Caskey. 2000. Optimization of the helper-dependent adenovirus system for production
and potency in vivo. Proc. Natl. Acad. Sci. USA 97:1002-1007.
Abstract/FREE Full Text
45. ↵
Scott, J. M., S. Li, S. Q. Harper, R. Welikson, D. Bourque, C. DelloRusso, S. D. Hauschka, and J. S.
Chamberlain. 2002. Viral vectors for gene transfer of micro-, mini-, or full-length dystrophin.
Neuromuscul. Disord. 12:S23-S29.
CrossRefMedline
46. ↵
Seale, P., A. Asakura, and M. A. Rudnicki. 2001. The potential of muscle stem cells. Dev. Cell 1:333-342.
CrossRefMedline
47. ↵
Sicinski, P., Y. Geng, A. S. Ryder-Cook, E. A. Barnard, M. G. Darlison, and P. J. Barnard. 1989. The
molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 244:1578-1580.
Abstract/FREE Full Text
48. ↵
Taboit-Dameron, F., B. Malassagne, C. Viglietta, C. Puissant, M. Leroux-Coyau, C. Chéreau, J. Attal,
B. Weill, and L.-M. Houdebine. 1999. Association of the 5′HS4 sequence of the chicken β-globin locus
control region with human EF1α gene promoter induces ubiquitous and high expression of human CD55
and CD59 cDNAs in transgenic rabbits. Transgenic Res. 8:223-235.
CrossRefMedline
49. ↵
Thomas, C. E., G. Schiedner, S. Kochanek, M. G. Castro, and P. R. Lowenstein. 2001. Preexisting antiadenoviral immunity is not a barrier to efficient and stable transduction of the brain, mediated by novel
high-capacity adenovirus vectors. Hum. Gene Ther. 12:839-846.
CrossRefMedline
50. ↵
Tsunoda, H., T. Hayakawa, N. Sakuragawa, and H. Koyama. 2000. Site-specific integration of adenoassociated virus-based plasmid vectors in lipofected HeLa cells. Virology 268:391-401.
CrossRefMedline
51. ↵
Umaña, P., C. A. Gerdes, D. Stone, J. R. E. Davis, D. Ward, M. G. Castro, and P. R. Lowenstein. 2001.
Efficient FLPe recombinase enables scalable production of helper-dependent adenoviral vectors with
negligible helper-virus contamination. Nat. Biotechnol. 19:582-585.
CrossRefMedline
52. ↵
van der Wees, C. G. C., M. P. G. Vreeswijk, M. Perssoon, A. van der Laarse, A. A. van Zeeland, and L.
H. F. Mullenders. 2003. Deficient global genome repair of UV-induced cyclobutane pyrimidine dimers in
terminally differentiated myocytes and proliferating fibroblasts from the rat heart. DNA Repair 2:12971308.
CrossRefMedline
53. ↵
Ward, P., and K. I. Berns. 1991. In vitro rescue of an integrated hybrid adeno-associated virus/simian
virus 40 genome. J. Mol. Biol. 218:791-804.
CrossRefMedline
54. ↵
Weitzman, M. D., S. R. M. Kyöstiö, R. M. Kotin, and R. A. Owens. 1994. Adeno-associated virus (AAV)
Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc.
Natl. Acad. Sci. USA 91:5808-5812.
Abstract/FREE Full Text
55. ↵
Xiao, X., W. Xiao, J. Li, and R. J. Samulski. 1997. A novel 165-base-pair terminal repeat sequence is the
sole cis requirement for the adeno-associated virus life cycle. J. Virol. 71:941-948.
Abstract/FREE Full Text
Ссылка на оригинальную статью http://jvi.asm.org/content/79/5/3146.full?view=long&pmid=15709034
Переведено проектом МОЙМИО http://www.mymio.org/