Лекция 5.
ЭКСПРЕССИЯ ОРГАНЕЛЬНЫХ ГЕНОМОВ
Генные кластеры
Хлоропластные промоторы
Митохондриальные промоторы
Гены РНК-полимеразы
Процессинг матричных РНК
Трансляция органельных матриц
Хлоропластные гены у высших растений собраны в
полицистронные транскрипционные единицы – кластеры
rpl23-rpl2-rps19-rpl22-rps3- rpl16- rpl14-rps8- infA- rpl36-rps11-rpoA
16S rDNA-trnI-trnA-23S rDNA-4.5S rDNA-5S rDNA
L23
psbK-psbI-psbD**-psbC**- orf62-trnG
psbE-psbF-psbL-psbJ
ndhC- ndhK- ndhJ
atpB-atpE
Примеры кластеров
пластидных генов с
гомологичной
функцией
Примеры генных кластеров пластидного
генома с гетерологичными функциями
orf31-petG-psaJ-rpl33-rps18
psbB-psbH-petB-petD
rps2-atpI- atpH**-atpF-atpA
По моноцистронному типу транскрибируются rbcL,
psbA, ndhF, psbM, psbN , часть генов тРНК и
некоторые другие
Митохондриальные гены растений
транскрибируются как индивидуально, так и в
составе полицистронных кластеров
У секвенированных мтДНК высших растений
40 из 60 генов находятся в составе небольших
кластеров ( по 2-3 гена), остальные
транскрибируются моноцистронно
Митохондриальные гены грибов и животных
транскрибируются полицистронно
Общая схема компонентов транскрипции
РНКполимераза
5’ UTR
ori
3’ UTR
иРНК
промотор
cвязывается с РНКполимеразой, что
определяет точное
место начала
транскрипции
У прокариот промоторы: - 10 и –35 от начала гена
Хлоропластные промоторные области разных генов:
Горчица pbsA TTGGTTGACATGGCTATATAAGTCATGTATACTGTTCAAT
Шпинат pbsA TTGGTTGACACGGGCATATAAGGCATGTATACTGTTGAAT
“
rbcL TGGGTTGCGCCATATATATGAAAGAGTATACAATAATGATG
“
atpB TCTTGACAGTGGTATATGTTGTATATGTATATCCTAGATGT
“
trnM TTATATTGCTTATATATAATATTTGATTTATAATCAATCTA
Бактериальные
промоторы
TTGACA
сtp1
Аналог промотора -35
TATAAT
сtp2
Аналог промотора
Промоторы многих пластидных генов: РЕР
являются аналогамии промоторов прокариот
-10
А как в митохондриях?
Митохондриальные
тРНК гены растений
-
Митохондриальные
тРНК гены хлоропластного
происхождения
+
Мотив «–10 – 35»
В митохондриальных тРНК генах
пластидного происхождения имеется
аналог прокариотического промотора
РЕР – промоторы взаимодействуют с plastid-encoded
polymerase
Такие промоторы есть не у всех хлоропластных генов
Некоторые гены промоторные области содержат
прямо в кодирующей части гена
тРНК и 5S РНК
Другие пластидные тРНК гены транскрибируются с
помощью комбинации внешнего (upstream)
и внутреннего промотора
Гены
psbA
и
некоторые
другие
пластидные
фотосинтетические гены
высших растений
между
прокариотическими промоторами содержат мотив типа
хорошо
известного
ТАТА
бокса
ядерных
генов
Это так наз. NEP-промоторы ( nuclear-encoded polymerase)
pbsA TTGGTTGACATGGCTATATAAGTCATGTATACTGTTCAAT
Промоторов у одного кластера генов в пластидном
геноме может быть несколько – «множественные
промоторы»
Транскрипция atpB-atpE может инициироваться с
четырех различных промоторных участков,
самый проксимальный из которых даже
перекрывается с кодирующей областью
Промоторы некоторых генов хлоропластов
шпината и хламидомонас находятся внутри
кодирующей области этих генов
trnR1, trnS1 и
некоторые другие
Как это выяснили?
Эффективная транскрипция этих генов с помощью
растворимой
РНК-полимеразы in vitro
происходит, даже если участок перед
кодирующей областью имеет протяженность
менее 10 пар оснований. Однако транскрипция
отсутствует у делеционных мутантов с
утраченной частью trn-гена
Транскрипция с помощью комбинации
предлежащего (upstream) и внутреннего
промоторов
Ген trnI
Промоторная область, подобная ctp1-, ctp2,
расположена на расстоянии 39 п.о. от начала гена
Если она утрачивается, ген транскрибируется в пять раз
менее интенсивно. Вероятно, существует второй,
альтернативный промотор внутри самого гена, который
может, хотя и менее успешно, заменить утраченный
В чем смысл существования
множественных сайтов инициации
транскрипции???
pr1
pr2
pr3
pr4
ген Х
Наличие у одного гена нескольких промоторов
обеспечивает тонкую регуляцию хлоропластной
транскрипции с использованием двух рНК-полимераз
и двух типов промоторов различной силы
Ряд пластидных генов имеют
так называемые
светочувствительные
промоторы, их структура
весьма специфична
Наконец, некоторые гены содержат промоторы,
обеспечивающие конститутивный синтез мРН
Митохондриальные промоторы растений
Состоят обычно из 17-18 нуклеотидов (-14+4),
имеют центральный домен - 7+5
и вышележащий домен (-11-12)
У гена cox2 и других митохондриальных генов
– множественные промоторы – от 2 до 6
Два промотора выявлено у митохондриального
cob гена кукурузы, три – у cox3 и у atp9 гороха,
четыре – у atp1 гороха
Структура промоторов у однодольных и
двудольных растений различается
У однодольных (кукуруза) замены
нуклеотидов внутри промоторной области
снижают инициацию транскрипции не очень
значительно - на 10-40%
Напротив, у двудольных замена G в
положении +1 на A приводит к потере 70%
активности промотора дикого типа
Как именно транскрипционный аппарат
идентифицирует
промоторную последовательность ???
Гипотеза: молекула иРНК сканируется
специфическими белками с 5‘ к 3‘ концу
5’
Pr1
Pr2
Равная эффективность
инициации транскрипции с
тандемно расположенных
промоторов
3’
Значит, гипотеза
сканирования молекулы
неверна
Структура промотора в митохондриях двудольных
растений и компоненты аппарата транскрипции
IVD
43 kDa
R-Pol
110 kDa
TF
63 kDa
TF
32 kDa
NNNNNATAATAGCATAAGAGAAGNNNNN
-14 -12-11 -8 -7
AT-бокс
+1+2 +4
Пурин
Высококонсервативный
10-нуклеотидный мотив
Важна не только первичная
структура самого промотора, но и
геномный контекст, в котором он
расположен
!
Выбор промотора может находиться
под контролем ядерного генома
Ядерный ген Mct (Modifier of cox transcript) влияет на выбор
промотора при транскрипции сох2 гена у кукурузы
У мутанта по Mct снижено кол-во копий типичного
транскрипта 1,9 т.п.н., но доминирует нетипичный
транскрипт 1,5 т.п.н., полученный с нетипичного промотора
У дрожжей промоторы митохондрий очень
консервативны
ori4
Все промоторы
митохондриального генома
ori6
дрожжей начинаются
с высококонсервативной
cob
последовательности
5'АТАТААGTA 3'
ori3
rnl
var
1
cox2
atp9
tmtl
cox3
ori5
tsI
ori2
ori7
ori1
atp8
rns
atp6
ori8
Промоторы множественные
Сильные и слабые промоторы
cox1
Сильные и слабые промоторы дрожжей
ATPase 9
тРНКSer Var1
Ор1 Ор2
Какова причина?
Промотор Ор1 в 12-15 раз сильнее, чем Ор2
(расстояние между ними 78 п.н.)
Чем больше расстояние между сильным и слабым
промоторами, тем слабее эффект подавления сильным
слабого (>600 п.н. – эффект исчезает)
При делеционном мутагенезе удаление сильного промотора в
несколько раз повышает интенсивность транскрипции со
слабого
Чем ближе ген в ДНК-матрице к промотору, с которого идет
полицистронная транскрипция, тем больше мРНК копий этого гена
в митохондрии
Структура промоторов различается у различных классов позвоночных
Ключевая последовательность - окружает
сайт инициации транскрипции и
совершенно необходима для
транскрипции
Ключевая последовательность - предшествует
сайту инициации транскрипции и
обеспечивает высокий уровень транскрипции
связываются с фактором
инициации
транскрипции, mtTFA
LSP
Человек
(D-петля)
HSP
Xenopus
(D-петля)
Gallus
(D-петля)
9-нуклеотидный
промотор
Дрожжи
У земноводных оба
промотора инициируют
транскрипцию в обоих
направлениях
У птиц один промотор
инициирует
транскрипцию в двух
направлениях с обеих
цепочек
Митохондриальный геном животных транскрибируется полицистронно
На карте мтДНК млекопитающих выявлено два промотора,
по одному для каждой цепочки: LSP и HSP
Полицистронная м-РНК с LSP содержит транскрипт 8 генов, с HSP – всех остальных
(29). LSP также участвует в инициации репликации мтДНК.
Оба промотора инициируют транскрипцию только в одном направлении
Предполагают также наличие на
Н-цепи второго промотора, так
как еще 25 лет назад было
показано
,
что
с
Н-цепи
существуют 2 полицистронных
транскрипта: короткий
(12S+16S
рРНК) и длинный, несущий все O
гены Н-цепи. Количество первых
в 50-100 раз превышает число
транскриптов других генов
HSP2
12S rRNA
V
L(CUN)
S (AGY)
H
HSP1
F
D-loopND 4
16S rRNA
T
LSP
L(UUR)
ND1
I
CYTb
P
OH
E
ND6
1/16569
Q
M
12427
4142
ND 5
ND2
A
N
C
Y
W
L
COI
8285
S(UCN)
D
COII
R
K
ATP6 COIII
ATP8
G
ND3
ND4L
В отличие от хлоропластов,
прокариотическое происхождение
митохондриальных промоторов не является
очевидным
Скорее всего, промоторы митохондрий
были эволюционно адаптированы к
другому,
чем у хлоропластов, типу РНК-полимеразы
РНК-полимераза органелл
(ДНК-зависимая РНК полимераза)
РНК-полимераза пластид
РНК-полимераза
E. сoli
4 субъединицы
а2ββ'
rpoA
rpoB
rpoC
N и С- части
β'-субъединицы
кодируются
разными генами
хлоропласт
5 субъединиц
а2ββ'β''
rpoA
rpoB
rpoC1
rpoC2
Гены rpo E.coli гибридизуются с ДНК пластид, что
помогло обнаружить и локализовать rpo гены в хпДНК
Гены rpoA-rpoC гены обнаружены во всех
секвенированных геномах пластид
С помощью rpo - полимеразы транскрибируются
в основном гены тРНК и белков хлоропластов
А как транскрибируются сами rpoA-rpoC гены
????
Как ???
Существует в клетке еще одна РНК-полимераза пластид:
РНК-полимераза пластид ядерного кодирования
Ряд фактов свидетельствовал в пользу ее существования:
•
•
•
•
гены без РЕР-промоторов,
мутанты без пластидных рибосом, но интенсивно транскрибирующие
ряд пластидных генов,
нефотосинтетические растения-паразиты, не имеющие пластидных rpo
генов
делеционные мутанты по rpo, растущие в культуре клеток.
В изолированных хлоропластах выявлены 2 фракции с РНКполимеразной активностью, одна из которых чувствительна к
рифампицину – ингибитору прокариотической РНК-полимеразы,
вторая – резистентна
Это полипептид 110 kd, сходный с ДНК-полімеразой фага Т7.
Активность фермента максимальна на разных стадиях
развития пластид
РНК-полимераза пластид ядерного кодирования
обеспечивает транскрипцию генов rpo (РНК-полимеразы )
в хлоропластах
ядро
цитоплазма
ген пластидной
РНК-полимеразы
мРНК
белок 110 кДа
РНКполимераза
ядерного
кодирования
пропластида
транскрипция некоторых
пластидных генов, в т.ч.
РНК-полимеразы
хлоропласт
РНК-полимераза пластома
транскрибирует остальные
хлоропластные гены, в т.ч.
гены фотосинтетических
белков
Где расположены гены РНК-полимеразы
митохондрий ?
В секвенированных геномах митохондрий
высших растений данный ген не был выявлен
Митохондриально кодируемые РНКполимеразы обнаружены лишь у
простейшего и у бурой водоросли
Reclinomonas
аmericana
Pylaiella
littoralis
В ядре почти одновременно у пшеницы, табака, кукурузы нашли
гены Т3- и Т7- фагоподобной РНК-полимеразы
В ядре арабидопсиса нашли семейство
из трех родственных генов
2 гена - мт РНКполимераза
1 ген - хп РНКполимераза
+
Пшеница
Ген rpoTm
кодирует мт РНК-полимеразу
массой 113 кд
+
Ген rpoTр
кодирует хп РНК-полимеразу
массой 107 кд
Продукты генов rpoTm и rpoTр гомологичны
по аминокислотному составу на 45%
Гомология РНК-полимераз фагов и разных органелл грибов и растений:
Фаги
Митохондрии дрожжей
Митохондрии растений
Найдено 11
высококонсервативных
доменов
Хлоропласты растений
Гомология наиболее велика в каталитической
части, наименьшая в промоторной
Митохондриальная РНК-полимераза дрожжей
ядерный ген RPO41 – кодирует белок размером 145 кд, значительная часть
молекулы гомологична Т3 и Т7 фаговым РНК-полимеразам.
Митохондриальная РНК-полимераза животных также
гомологична Т3 и Т7 фаговым РНК-полимеразам.
C
N
последовательность,
обеспечивающая
импорт в
митохондрии
амино-концевое
расширение
область гомологии с
бактериофаговой РНКполимеразой
Митохондриальная РНК-полимераза дрожжей
кодируется ядерным геном RPO41
Структура комплекса T7 РНК-полимераза-промотер
Аминокислотный консерватизм
фагоподобной РНК-полимеразы
органелл
Модель замены в процессе эволюции
органельной РНК-полимеразы бактериального
типа на фагоподобные ферменты ядерного
кодирования
(b)
(a)
(c)
Утрата
RpoY
Rpo A,B,C,D
rpoA,B,C,D
RpoY
rpoA,B,C,D
РНК-полимераза
фагового типа
(f)
RpoY
RpoZ
(e)
Утрата
RpoY
rpoA,B,C1,C2 RpoZ
(d)
rpoA,B,C1,C2
rpoA,B,C1,C2
RpoY
дупликация
гена
RpoY
(а) Reclinomonas americana, хотя отсутствие ядерного RpoY гена еще не доказано; (b)
пока не найден; (c) большинство эукариот; (d) возможно, некоторые водоросли (пока не
изученные); (e) однодольные и двудольные растения; (f) паразитическое растение
Epifagus virginiana.
Процессинг полицистронных матриц
Полицистронные матрицы превращаются в монодицистронные
До тех пор, пока матрицы не стали
моноцистронными, они не связываются с
рибосомами.
После разрезания каждая из мРНК транслируется
независимо от другой.
и
Стабильность мРНК молекул у прокариот обеспечивается
связыванием с рибосомами,
у эукариотических генов ядра – кэпированием и полиаденилированием.
А как обеспечивается стабильность матриц органельных мРНК?
У большинства молекул пластидных мРНК содержит в нетранслируемой
области на 3' конце последовательность с инвертированным повтором,
которая складывается в стабильную петлю.
Эти последовательности консервативны у одних и тех же генов даже у
эволюционно отдаленных видов, но для разных генов в одном пластоме –
разные.
На хламидомонас показано, что полная или частичная делеция такого
инвертированного повтора приводит к 60-80% потере мРНК данного гена,
хотя кодирующая и 5'-UTR не изменены.
Первичный транскрипт
Кодирующая область
5’
3’
Эндонуклеазное разрезание
Экзонуклеазное укорачивание
Модель процессинга
3’области и деградации
пластидной РНК
Разрушение мРНК инициируется
альтернативными механизмами:
(1) эндонуклеазным
Стабильная РНК
(связанная с белками)
Эндонуклеазн
ое разрезание
Полиаденилирование
АААААААА
или
Полиаденилирование
Экзонуклеазная
деградация
АААААААА
Экзонуклеазная деградация
АААААААА
(1)
расщеплением перед
петлеобразной структурой с
последующим 3’- полиаденилированием, которое в свою
очередь, вызывает деградацию
путем экзонуклеазной активности
3’ → 5’;
АААААААА
(2)
(2) полиаденилированием за
петлеобразной структурой и
последующей экзонуклеазной
деградацией
У пластидных мРНК полиаденилирование – сигнал к деградации
Короткие инвертированные повторы на 3‘ конце транскриптов обнаружены
также у ряда митохондриальных генов. Молекулы мРНК, содержащие такие
транскрипты, отличаются более продолжительным периодом полу-жизни, чем
не имеющие их.
Вспомните, что длинные поли-А концы в транскриптах ядерных генов –
гарант
их
стабильности.
Деградация
начинается
с
деаденилирования и де-кэпирования.
У прокариот
матриц.
полиаденилирование
Полиаденилирование хлоропластных
провоцирует деградацию матриц
провоцирует
генов,
как
деградацию
и у
прокариот,
Поли-А хвост хлоропластных генов может достигать длины нескольких сот
нуклеотидов, в нем имеются вкрапления G и крайне редко – С или U.
Очевидно, добавление поли-А делает мРНК уязвимой по отношению к нуклеолитической
активности 3'-5'. Поли-А хвост обладает сродством к хлоропластной экзонуклеазе.
Показано, что полиаденилирование фотосинтетических генных
транскриптов усиливается в темноте
Модель вторичной структуры 3’инвертированных повторов
митохондриальных генов растений (atp9 гороха)
Защищают
инвертированный повтор
и вышележащие участки
матрицы
A-T
A-T
G-C
A-T
A-T
Кофакторы,
A-T
вспомогательные
G-C ACTTTCGTTTT(N)n
белки
G
РНКаза
(N)GGAC GAGG
C-G
C-G
C-G
C-G
C-G
GAGG
A-T
Последовательность,
G
A
предшествующая первому
CA
двуспиральному участку
(обнаружена у нескольких
разных генов)
Недавно поли-А последовательности длиной 52-56
нуклеотидов обнаружены в митохондриальных
транскриптах растений.
В данном случае это также сигнал к деградации.
Транскрипция – созревание (процессинг)
транскриптов–сплайсинг (эдитинг)- трансляция
В регуляции экспрессии как пластидных, так и
митохондриальных генов основным этапом
является не транскрипция, а трансляция
Инициация трансляции у прокариот:
– комплекс
Shine-Dalgarno (SD) инициирует образование
комплекса между мРНК и 16S рРНК рибосом. SD –
последовательность находится на расстоянии -7 + 2 от
AUG инициирующего кодона.
Более половины хлоропластных генов также содержат
(SD) последовательности, хотя расстояние до
инициирующего кодона у растений более вариабельно:
от 2 до 29 с пиком от 7 до 9. (SD)- последовательность в
пластидах обычно GGAGG, хотя встречаются
укороченные варианты: GGA, AGG, GAGG, GGAG.
Четыре модели инициации трансляции в хлоропластах
50S
а)
мРНК
SD
30S
AUG
50S
30S
AUG
SD
(б)
70S инициирующий
комплекс
50S
мРНК
30S
SD
AUG
SD
30S
AUG
50S
30S
AUG
SD
70S инициирующий
комплекс
(в)
30S
50S
AUG
мРНК
30S
AUG
30S
AUG
50S
70S инициирующий
комплекс
(г)
30S
SD
мРНК
50S
AUG
30S
AUG
30S
AUG
50S
SD
70S инициирующий
комплекс
Четыре модели инициации трансляции в хлоропластах
(а) Элемент Shine-Dalgarno (SD) находится рядом с инициирующим кодоном (AUG). Связывание с
30S субъединицей рибосомы предшествует присоединению 50S субъединицы. Аналог
классического бактериального механизма трансляции (пример - трансляция rbcL у ячменя).
(б) SD последовательность удалена от инициирующего кодона. После присоединения 30S
субъединицы к SD следует “сканирование” до встречи с инициирующим кодоном (пример трансляция psbA у ячменя). (в) Инициация, не зависящая от SD последовательности. Для инициации
требуется участие активатора трансляции (овал), который связывается с 5’UTR и 30S
субъединицей (пример - трансляция psbС у Chlamydomonas).
(г) Инициация, требующая как SD последовательности, так и активатора трансляции. Вторичная
структура, образующаяся в 5’UTR и содержащая элемент SD, препятствует связыванию мРНК с
30S субъединицей рибосомы. Активатор трансляции (шестиугольник) разрушает вторичную
структуру, 30S субъединица связывается с SD последовательностью, образуя 70 S инициирующий
комплекс (пример - трансляция psbA у Chlamydomonas)
При отсутствии структур SD связывание мРНК с рибосомой
происходит за счет других механизмов. Например, взаимодействие 5'
UTR мРНК с ядерно - кодируемыми факторами, которые могут быть как
сайт-специфичны, так и активировать трансляцию многих мРНК.
Хлоропластно кодируемые факторы инициации трансляции
обнаружены в хлоропластном геноме эвглены и высших растений
ATP
ATP
PSII
ADP+Pi
HS SH
ADP+Pi
S–S
S–S
P
NADPH
киназа
D1
SH
SH
GUA
P
S
S
AUG
хлоропласт
?
?
PABP
цитоплазма
PDI
Модель активации трансляции psbA мРНК Chlamydomonas под действием света.
Активаторы трансляции, кодируемые ядерным геномом, транслируются в цитоплазме и импортируются в
хлоропласт. Уровень фотосинтетической активности хлоропласта связан с сPDI, переносчиком хлоропластного
редокс-потенциала. Активность сPDI может ингибироваться ADP-зависимой киназой, когда фотосинтез, а значит и
отношение АТP/ADP малы.
Два не изученных пока активатора трансляции представляют собой белки 55 и 38 kDa
Таким образом,
первоначально предполагавшаяся
гомология экспрессии пластидных геномов с
системой прокариотов оказалась весьма
ограниченной
МНОЖЕСТВЕННЫЕ ПРОМОТОРЫ, РАЗНЫЕ РНКПОЛИМЕРАЗЫ, СЛОЖНЫЙ ПРОЦЕСС СОЗРЕВАНИЯ
МАТРИЦ И ИНИЦИАЦИИ ТРАНСЛЯЦИИ:
система регуляции пластидных генов
значительно сложнее, чем казалось вначале
Экспрессия генов в митохондриях растениях
необычна прежде всего образованием множественных
транскриптов с одного участка генома.
Такая вариабельность размеров мРНК вызывается:
•
•
•
множественностью сайтов инициации транскрипции
множественностью сайтов терминации транскрипции
наличием пост-транскрипционного расщепления и сплайсинга
Осуществляет транскрипцию митохондриальных генов
ядерная РНК-полимераза, которая чрезвычайно похожа на РНКполимеразу бактериофагов Т7, Т4 и SP6
Трансляционные синтезы в митохондриях растений
происходят при участии третьего клеточного генома хлоропластного, а именно – необходим экспорт ряда
пластидных тРНК, не кодируемых митохондриальными генами
Регуляция трансляции митохондриального генома дрожжей
изучена наиболее подробно
Трансляционный аппарат митохондрий грибов кодируется в основном
ядерными генами: 77 рибосомальных белков, тРНК-синтетазы,
гомологи бактериальных факторов элонгации Tu и G
КАК митохондриальные рибосомы дрожжей идентифицируют
инициирующие кодоны???
неясно
Рибосомы митохондрий дрожжей не сканируют мРНК в поисках
инициирующего кодона, подобно цитоплазматическим.
Нет никаких указаний, что в данной системе задействованы
последовательности Shine-Dalgarno
Необычной чертой трансляционной системы
митохондрий дрожжей являются специфические белкиактиваторы:
именно они взаимодействуют с 5’-UTR областями
митохондриальных транскриптов и играют решающую
роль в регуляции трансляции. Такие активаторы
кодируются ядром и обнаружены почти для всех
генов, транслируемых на митохондриальных матрицах
Общая картина регуляции экспрессии
митохондриального генома пока отсутствует
Неясно,
• чем объясняются различия количества
транскриптов с разных участков одной
полицистронной матрицы
• как координируются процессы транскрипции
и трансляции в митохондриях,
• как активируется трансляция мтДНК
специфическими белками.
Скачать

РНК-полимеразой